Intellectual disability associated with a homozygous missense mutation in THOC6

Institutional Research Ethics Board approval for the study reported here was obtained from the University of Calgary and the Children’s Hospital of Eastern Ontario and informed consent was obtained from responsible persons (parents) on behalf of all study participants. Total genomic DNA was extracted from blood following standard procedures.

Ninety-seven out of the 173 genes within the 5.1 Mb critical region on 16p13.3 (NCBI build 36.3, including hypothetical genes and pseudogenes) were PCR amplified and Sanger sequenced. These genes were chosen based on expression or function indicating a potential role in neurodevelopment; genes associated with dissimilar disorders or unrelated functions were excluded from sequencing. Primers were designed to assess the coding regions and intron-exon boundaries of the prioritized genes using the program Oligo (Molecular Biology Insights, Inc., Cascade, CO). PCR and bidirectional sequencing was performed on DNA samples from a patient, a parent, and unaffected control. Primer sequences and reaction conditions are available upon request. Sequence subtraction analysis was performed using Mutation Surveyor (SoftGenetics LLC, State College, PA).

Exome capture and high-throughput sequencing of DNA from one patient was performed at the McGill University and Genome Québec Innovation Centre (Montréal, Canada). Exome target enrichment was performed using the Agilent SureSelect 50 Mb All Exon Kit (V3), and sequencing (Illumina HiSeq) generated 14 Gbp of 100 bp paired-end reads. An in-house annotation pipeline was used to call and annotate coding and splice-site variants. Reads were aligned to hg19 using BWA [7] and duplicate reads were marked using Picard [8] and excluded. Single nucleotide variants and short insertions and deletions (indels) were called using SAMtools mpileup [9] and bcftools and quality-filtered to require a minimum 20% of reads supporting the variant call. Variants were annotated using Annovar [10] as well as custom scripts to select coding and splice-site variants, and to exclude common (≥1% minor allele frequency) polymorphisms represented in the NHLBI exome server [11], or in 435 control exomes sequenced at the McGill University and Genome Québec Innovation Centre. Variants within the mapped region at 16p13.3 were considered as candidates. Coverage of genes within the region was assessed to determine the fraction of bases in each exon with at least 5 reads covering the position. Although average coverage was much higher, 5× was deemed sufficient to call variants within this homozygous region. To determine the proportion of CCDS exons with sufficient coverage, exons of all isoforms within the region were counted (exons present in multiple isoforms were counted only once) and exons with less than 99% coverage at 5× were deemed incomplete.

500 Schemiedeleut controls, 92 Daruisleut controls, and 120 Lehrerleut controls were genotyped by a TaqMan SNP genotyping assay for the variant. Life Technologies’ TaqMan genotyping protocol and mix were used following standard procedures (Forward Primer: AGAAACTTCCCACATGGTGAGAC, Reverse Primer: ATTAGCCCTGGCACTTGGC, Wild-type Probe: VIC-TG GCAACAATTACGGGC-mgb (minor groove binder), Mutant Probe: FAM-ACAATTACAGG CAGATT-mgb).

Wild-type (WT) THOC6 cDNA was purchased from the Centre for Applied Genomics (Toronto). The primer sets: 5’ TTA GGA TCC ATG GAC TAC AAG GAT GAC GAT GAC AAG GAG CGA GCT GTG CCG CTC 3’/5’ GTA GCG GCC GC TCA GAA GGA CAG GGA GAA GGC TCG 3’ and 5’ TTA GGA TCC ATG GAG CGA GCT GTG CCG CTC 3’/5’ GGA GCG GCC GC TCA CTT GTC ATC GTC ATC CTT GTA GTC GAA GGA CAG GGA GAA GGC TCG 3’ were used to PCR amplify the full length THOC6 cDNA in order to introduce a FLAG tag at the N- and C-terminus, respectively and subsequently the cDNA was subcloned into pcDNA3. Site-directed mutagenesis of THOC6 was performed using the QuikChange II mutagenesis kit (Agilent). The mutated cDNA constructs were sequenced to confirm the fidelity of the mutagenesis reactions.

HeLa cells were seeded at 2 × 10⁵ cells/well on glass coverslips in six-well plates and transiently transfected with FLAG-tagged WT THOC6 or mutant THOC6 plasmids with lipofectamine 2000 (Invitrogen). Twenty-four hours after the transfection, the cells were fixed in 2% paraformaldehyde and permeabilized with PBS containing TritonX-100 (0.05%). Cells were incubated with anti-FLAG antibody (Sigma) for 1 h followed by incubation with Alexa 488-conjugated goat anti-mouse IgG secondary antibody (Invitrogen). The cells were stained with DAPI and mounted onto microscope slides. Images were obtained with a Nikon Eclipse TE2000-E system controlled and processed by EZ-C1 3.50 (Nikon) software. Two replicates and a chi-square test were performed on each replicate.

Human THOC6-specific and non-targeting control siRNAs were purchased from Dharmacon. HeLa cells were plated at a density of 2 × 10⁵ cells/well on a coverslip in a six-well plate, 24 h prior to transfections. Cells were transfected with 100 nM of THOC6-specific or non-targeting scramble siRNA with Lipofectamine RNAiMAX (Invitrogen) and cultured for 48 h.

Whole-mount in situ hybridization was performed on embryos at 24, 48, and 72 h post fertilization (hpf) as described previously [12]. Briefly, full-length cDNA of zebrafish thoc6 was obtained from Open Biosystems (EDR5649-100965848). The cDNA was cloned into pGEM-T vector (Promega) and used as a template for in vitro synthesis of an antisense mRNA probe. Embryos were fixed in 4% paraformaldehyde in PBS, hybridized with DIG-labeled riboprobes at 65°C, and followed by incubation with anti-DIG antibody conjugated with alkaline phosphatase (AP) (Roche). NBT and BICP were used as the substrates of AP to generate the purple coloration.

Prior to the availability of whole-exome sequencing, the coding regions of 97 out of the 173 genes within the mapped region (NCBI build 36.3, including hypothetical genes and pseudogenes) were Sanger sequenced in a patient and parent. These genes were chosen based on expression or function indicating a potential role in neurodevelopment; genes associated with dissimilar disorders or unrelated functions were excluded from sequencing. A potential disease-causing missense mutation was identified in THOC6 (fSAP35), c.136G>A (p.Gly46Arg) (RefSeq NM_024339.3) (Figure 1A). Sanger sequencing confirmed the presence of this potential mutation in the homozygous state in the other three patients.

Exome sequencing was performed to determine if any additional potentially pathogenic variants were present in the coding sequence of genes within the critical region. The mean exome read depth for the sample was 143×. Exome sequencing coverage was determined for all CCDS annotated genes (hg19) within the region and 92% of exons from all isoforms were covered completely at greater than 5×. When Sanger sequencing results were included this increased to 96% of exons being covered. Gene coverage statistics are included in Additional file 1: Table S1. Variants identified by exome sequencing were filtered to exclude common (≥1% minor allele frequency) polymorphisms represented in the NHLBI exome server [11], dbSNP, or in 435 control exomes sequenced at our center. The only rare variant in the mapped region was the THOC6 homozygous variant c.136G>A, which was not present in any of the controls.

The c.136G>A variant was found in the heterozygous state in the parents of the patients and none of the six unaffected siblings available for testing were homozygous. The variant was not seen in 150 controls from the general population. Frequency of the variant was determined in the three Hutterite leuts by Taqman genotyping. The variant was seen at a frequency of 3% in 92 Dariusleut controls and at a frequency of 2% in 120 Lehrerleut controls; no homozygous controls were identified. The variant was not seen in 500 Schmiedeleut controls indicating it is likely shared only between the Dariusleut and Lehrerleut and that additional affected individuals may exist within these communities. The glycine at position 46 is highly conserved between species and occurs within a relatively conserved region (Figure 1B), suggesting that this amino acid plays an important role in THOC6. Polyphen [13] and SIFT [14] predicted THOC6 p.Gly46Arg to be damaging.

THOC6 is a part of the THO complex which is involved in coordinating mRNA processing with export. In humans, this complex is comprised of THOC1, THOC2, THOC5, THOC6, and THOC7 [15]. The THO complex components also interact with UAP56, ALY, and TEX forming the larger TREX complex (transcription export complex) [15‐17]. In yeast, this complex was found to have a role in coupling transcription and polyadenylation to mRNA export with mutants showing defects in transcription, polyadenylation, nuclear accumulation of poly (A) RNA, the formation of heavy chromatin, and accumulation of stalled nuclear pore components [17‐19]. The necessity of the THO complex for export of individual transcripts in yeast has been linked to genes with strong promoters and rapid transcription rates [20, 21]. Initial studies in human cell lines found THOC1 to bind DNA and interact with RNA Polymerase II as in yeast [22]; however, recent literature has favoured the hypothesis that in metazoan organisms the THO complex couples mRNA processing with export. In metazoans, the THO complex components have only been found bound to processed transcripts [15] and export of transcripts to the cytoplasm by THO was determined to be both cap and splicing dependent [23].

Members of the THO complex including THOC1, THOC2, THOC5, and THOC7 have been found to be localized to the nucleus and to shuttle between the nucleus and the cytoplasm [24‐26]. Within the nucleus, they have been found to co-localize with splicing factors in nuclear speckle domains and function in the release of mRNA from these domains [15, 27]. We subcloned the WT and mutant THOC6 (c.136G>A) cDNA with a FLAG epitope at the C-terminus into pcDNA3 vector. Immunostaining was performed with anti-FLAG antibody on HeLa cells transfected with the WT and mutant constructs. The majority of cells showed a speckled nuclear localization of WT THOC6 protein similar to what has been seen for THOC1 and THOC2 [15, 22, 28] (Figure 2A), whereas the mutant THOC6 p.Gly46Arg protein was confined to the cytoplasm (Figure 2B). Similar results were obtained using N-terminal FLAG tagged proteins. The difference in localization was significant for both the C-terminal and N-terminal FLAG tagged protein (chi-square test) (Additional file 2: Figure S1). The absence of localization of the p.Gly46Arg mutant protein in the nucleus suggests that the mutant protein’s normal function may be perturbed. In HeLa cells, knockdown of THOC2, THOC1, and THOC7 led to polyA RNA nuclear accumulation, whereas knockdown of THOC5, THOC6, and TEX did not [29]. Knockdown of the THO complex in Drosophila appears to affect the export of only a very small subset of mRNA transcripts including the rapidly transcribed inducible HSP70 transcripts [16]. Knockdown of THOC5 and THOC6 was seen to lead to the retention of HSP70 mRNA in the nucleus after heat shock [24]. Further elucidation of the role of THOC6 in mRNA export will provide important insights into the pathophysiology of this disorder.

Apoptosis occurs during brain development and is highly regulated; animal models and human disorders suggest that increased levels of apoptosis can lead to severe neurological defects including microcephaly [30‐32]. There has been evidence suggesting a role of the THO complex in the survival of rapidly proliferating cells by preventing apoptosis [33, 34]. We sought to determine whether loss of THOC6 expression causes apoptosis in a mammalian cell line. THOC6 gene-specific siRNAs were used to knockdown THOC6 in HeLa cells. A robust decrease in the levels of THOC6 protein in HeLa cells transfected with THOC6 gene-specific siRNAs (Additional file 3: Figure S2A) was observed. TUNEL staining was performed to examine the level of apoptosis. A significantly increased proportion of cells with positive TUNEL staining was seen in cells transfected with THOC6 siRNAs, compared to the cells transfected with a control siRNA (Figure 3 and Additional file 3: Figure S2B), indicating that loss of THOC6 leads to an increase in apoptosis.

Genes implicated in neurodevelopment and ID are diverse in function and many are not limited to central nervous system expression, but detailed expression studies of THOC6 had not yet been performed. We examined expression of the zebrafish thoc6 ortholog during embryonic development. Zebrafish Thoc6 shares 59% protein sequence identity with human THOC6, and the p.Gly46 in humans is conserved in the zebrafish sequence. In situ hybridization revealed that thoc6 mRNA is highly expressed in the developing midbrain and the eyes at 24 h post fertilization (hpf) and the expression becomes restricted afterwards to the posterior part of the midbrain and the midbrain-hindbrain boundary (Figure 4). This expression pattern implicates an important role for THOC6 in neurodevelopment, which is of interest considering the central clinical manifestation in the patients is intellectual disability. Given the other, more variable, clinical manifestations observed in the patients, it is likely that THOC6 also has a role in the development of other systems, particularly the heart and kidney.

Well-characterized causes of non-syndromic ID include genes encoding for synaptic proteins, neuronal specific proteins, and those involved in neurotransmitter release [5]. Other causes of ID are not neural specific genes, but genes coding for proteins that participate in defined processes known to be important for brain function such as metabolism and cell adhesion [5, 35‐37]. Other identified pathways include the Rho GTPases that play a role in regulating the actin cytoskeleton [38], the ERK/MAPK pathway that responds to growth factors [5], and the NF-κB transcription regulation pathway [39‐41]. Genes causing microcephaly with ID include centrosomal, cell cycle, and DNA damage repair genes [42, 43]. Other ID genes appear to function in fundamental cellular processes, yet give rise to disorders where the predominant or only feature is ID [1, 44]; this includes genes involved in mRNA processing such as ZC3H14[45]. THOC6, as part of a pathway involved in mRNA export and protection against apoptosis, is best classified with this latter group of genes implicated in fundamental cellular processes, though in keeping with the predominant feature of this syndrome, the highest level of expression of THOC6 is in the developing brain.

NHLBI Exome Variant Server http://​evs.​gs.​washington.​edu/​EVS/​

Picard http://​picard.​sourceforge.​net/​

SAMtools http://​samtools.​sourceforge.​net/​

UCSC Genome Browser http://​genome.​ucsc.​edu/​cgi-bin/​hgGateway/​

SIFT http://​sift.​bii.​a-star.​edu.​sg/​

PolyPhen-2 http://​genetics.​bwh.​harvard.​edu/​pph2/​