Skip to main content
Erschienen in: Journal of Experimental & Clinical Cancer Research 1/2009

Open Access 01.12.2009 | Research

Establishment of a new human osteosarcoma cell line, UTOS-1: cytogenetic characterization by array comparative genomic hybridization

verfasst von: Taketoshi Yasuda, Masahiko Kanamori, Shigeharu Nogami, Takeshi Hori, Takeshi Oya, Kayo Suzuki, Tomoatsu Kimura

Erschienen in: Journal of Experimental & Clinical Cancer Research | Ausgabe 1/2009

Abstract

The cytogenetic characteristics of osteosarcoma (OS) remain controversial. The establishment of a new human OS cell line may improve the characterization. We report the establishment of a new human osteosarcoma cell line, UTOS-1, from a typical osteoblastic OS of an 18-year-old man. Cultured UTOS-1 cells are spindle-shaped, and have been maintained in vitro for over 50 passages in more than 2 years. Xenografted UTOS-1 cells exhibit features typical of OS, such as production of osteoid or immature bone matrix, and proliferation potency in vivo. UTOS-1 also exhibit morphological and immunohistochemical characteristics typical of osteoblastic OS. Chromosomal analysis by G-band show 73~85 chromosomes with complicated translocations. Array CGH show frequent gains at locus DAB2 at chromosome 5q13, CCND2 at 12p13, MDM2 at 12q14.3-q15, FLI and TOP3A at 17p11.2-p12 and OCRL1 at Xq25, and show frequent losses at HTR1B at 6q13, D6S268 at 6q16.3-q21, SHGC17327 at 18ptel, and STK6 at 20q13.2-q13.3. The UTOS-1 cell line may prove useful for biologic and molecular pathogenetic investigations of human OS.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1756-9966-28-26) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

Authors have made substantial contributions to conception and design MK and TY acquisition of data. SN, TH, TO and KS analysis, interpretation of data, organizing study. TY and supervision of research group TK

Introduction

Osteosarcoma (OS) is the most common malignant bone tumor in adolescents and young adults, and is characterized by proliferation of tumor cells which produce osteoid or immature bone matrix. Despite recent advances in multimodality treatment consisting of aggressive adjuvant chemotherapy and wide local excision, pulmonary metastasis occurs in approximately 40 to 50% of patients with OS and remains a major cause of fatal outcome [13].
There have been several reports describing xenotransplantation models of human OS [47], but characterization of human OS at the molecular cytogenetic level has been limited [8, 9]. We describe the establishment and characterization of a new human OS cell line, designated as UTOS-1, derived from a conventional osteoblastic OS. In addition, we analyze chromosomal aberrations and DNA copy number changes in UTOS-1 by array comparative genomic hybridization (aCGH).

Methods

Source of Tumor Cells

An 18-year-old Japanese man noticed swelling and pain of the left shoulder for 2 months. Radiographs showed a periosteal reaction and an osteosclerotic change in the proximal metaphysis of the left humerus. An open biopsy of this humeral tumor confirmed that it was conventional osteoblastic OS (Figure 1). Immunohistochemically, most of the tumor cells were strongly positive for vimentin, alkaline phosphatase (ALP), osteopontin (OP), and osteocalcin (OC). Despite intensive chemotherapy, the patient died of lung metastasis 2 months after open biopsy. The present study was conducted after a human experimentation review by our ethics committee.

Tumorigenicity in severe combined immunodeficiency (SCID) mice

To determine the tumorigenicity of the UTOS-1 cell line in vivo, 1 × 108 cells were washed, suspended in phosphate-buffered saline (PBS), and injected subcutaneously into the leg of 4-week-old male SCID mice (CB-17/Icrscid; Clea Japan Incorporation, Osaka, Japan). Also, tumor growth in vivo was measured by calculating tumor volume based on the measurement of 2 perpendicular diameters using a caliper [10]. The volume was estimated using the following formula: 0.5 × L × (S)2, where L and S are the largest and smallest perpendicular tumor diameters, respectively.

Establishment of the tumor cell line

Tumor cells were seeded in a 25 cm2 plastic flask (35–3109; Falcon, Franklin Lakes, NJ, USA) [11]. These cells were cultured in RPMI 1640 (MP Biomedicals, Solon, OH, USA), supplemented with 100 mg/ml streptomycin (Meiji Seika, Tokyo, Japan), 100 U/ml penicillin (Meiji Seika) and 10% fetal bovine serum (FBS; Funakoshi, Tokyo, Japan), at 37°C in a humidified atmosphere of 5% CO2 and 95% air. The medium was replaced once per week. When semiconfluent layers were obtained, the cells were dispersed with Ca2+- and Mg2+-free PBS containing 0.1% trypsin and 0.02% EDTA solution, and were then seeded in new flasks for passage. The configuration of tumor cells was almost equalized after the 3rd generation. These procedures were serially performed until the UTOS-1 cell line was established.

Cell growth in vitro

To determine the doubling time, UTOS-1 cells were seeded in each well of 96-well dishes (Corning Costar, Tokyo, Japan) with fresh medium containing 100 μl of RPMI 1640 with 10% FBS. Cell growth was measured using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Cell Counting Kit-8, Dojindo, Tokyo, Japan) [12]. A volume of 10 μl of MTT was added to each well, followed by mixing. Plates were incubated for 3 hours at 37°C in a humidified atmosphere of 5% CO2 and 95% air. Formazan levels, which correspond to the number of viable cells, were quantified using a microplate reader (model 450; Bio-Rad Laboratories, Hercules, CA, USA) at a wavelength of 450 nm. The absorbance of each well was evaluated at 6, 12, 24, 48, 72, 96 and 120 hours after seeding. Triplicate wells were used for each observation.

Immunohistochemistry

Cells were cultured in chamber slides (Lab-Tek; Nalge Nunc International, Naperville, IL, USA). For the detection of mesenchymal phenotype, we used 3 monoclonal antibodies: anti-AE1/AE3, anti-keratin mix, and anti-vimentin. Also, to assess osteoblastic differentiation, we used 2 monoclonal antibodies: anti-OP and anti-OC. ALP activity of UTOS-1 cells was estimated using a modified version of a cytochemical method described elsewhere [13], with naphthol AS-MX phosphate-fast blue RR staining (ALP staining kit; Muto Pure Chemicals Corporation, Tokyo, Japan).
Cells grown in chamber slides were washed in PBS, fixed in 4% paraformaldehyde for 15 minutes at room temperature, and then fixed in methanol for 20 minutes at -20°C. The cells were incubated with each of the primary antibodies for 24 hours at 4°C. Immunoreaction products were detected using DAKO envision (DAKO Sytomation, Carpinteria, CA, USA), and were visualized after adding diaminobenzidine (DAB; DAKO) as the chromogen.

RNA extraction and reverse-transcription polymerase chain reaction (RT-PCR)

Expression of osteoblastic differentiation markers was assessed using RT-PCR. UTOS-1 cells were grown to confluence, and total cellular RNA was isolated using a TRIzol® Reagent (Invitrogen, San Diego, CA, USA). Total RNA was used as a template for cDNA synthesis using the SuperScript First-strand Synthesis System (Invitrogen). PCR was performed to assess expression of ALP, OP and OC. The oligonucleotide primer sequences and PCR conditions for ALP, OP and OC are shown in Table 1. Amplified products were analyzed by 2% agarose gel (Cambrex Bio Science Rockland Incorporation, Rockland, ME, USA) electrophoresis and ethidium bromide staining (Invitrogen). For comparison, Saos-2 [7], which is one of the most popular OS cell lines, was used as a positive control.
Table 1
The oligonucleotide primer sequences and PCR conditions for ALP, OP, and OC in this study.
Molecule
Primers
(5' to 3')
Strand
Size (bp)
Conditions
(temperature, cycle number)
ALP
ACGTGGCTAAGAATGTCATC
CTGGTAGGCGATGTCCTTA
+
--
475
55°C
35 cycles
OP
CCAAGTAAGTCCAACGAAAG
GGTGATGTCCTCGTCTGTA
+
--
347
58°C
45 cycles
OC
ATGAGAGCCCTCACACTCCTC
GCCGTAGAAGCGCCGATAGGC
+
--
294
59°C
45 cycles
GAPDH
GAAGGTGAAGGTCGGAGTCA
GAAGATGGTGATGGGATTTC
+
--
226
55°C
35 cycle
Abbreviations: ALP, alkaline phosphatase; OP, osteopontin; OC, osteocalcin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Cytogenetic analysis

For cytogenetic analysis, preparations of metaphase chromosomes from UTOS-1 cells at passage 15 were obtained, and were banded with Giemsa-trypsin [14]. Karyotypes were described using the short version of the International System for Human Cytogenetic Nomenclature [15].

DNA extraction and array CGH

Genomic DNA was extracted from UTOS-1 cells at passage 15. The CGH procedure used was similar to published standard protocols [16]. Genomic DNA was isolated from tumor samples using standard procedures including proteinase K digestion and phenol-chloroform extraction.
Array CGH was performed using the GenoSensor Array 300 system, following the manufacturer's instructions (Vysis, Downers Grove, IL, USA). This array contains the 287 chromosomal regions that are commonly altered in human cancer, such as telomeres, regions involved in microdeletions, oncogenes, and tumor suppressor genes. Tumor DNA (100 ng) was labeled by random priming with fluorolink cy3-dUTP, and normal reference (control) DNA was labeled using the same method with cy5-dUTP. The tumor and control DNAs were then mixed with Cot-1 DNA (GIBCO-BRL, Gaithersburg, MD, USA), precipitated, and resuspended in microarray hybridization buffer containing 50% formamide. The hybridization solution was heated to 80°C for 10 minutes to denature the DNA, and was then incubated for 1 hour at 37°C. Hybridization was performed for 72 hours in a moist chamber, followed by a post-hybridization wash in 50% formamide/2 × SCC at 45°C. Slides were mounted in phosphate buffer containing 4',6-diamidino-2-phenylindole (DAPI; Sigma, St. Louis, MO, USA). Fluorescence intensity images were obtained using the GenoSensor Reader System (Vysis) according to the manufacturer's instructions. For each spot, the total intensity of each of the 2 dyes and the ratio of their intensities were automatically calculated. The diagnostic cut-off levels representing gains and losses were set at 1.2 (upper threshold) and 0.8 (lower threshold). This assay was performed in triplicate, and common aberrations were considered to be meaningful aberrations.

Results

Tumor growth in vivo

Approximately 5 weeks after implantation, all SCID mice had palpable elastic hard nodules with a volume of about 1000 mm3 (Figure 2). The tumor volume was about 4000 mm3 at 6 weeks after implantation, and was > 10,000 mm3 at 8 weeks after implantation. The cut surfaces of these tumors were solid and white-gray with small necrotic foci. Histopathologically, the tumors contained primarily atypical tumor cells, and exhibited formation of osteoid or immature bone matrix, which is similar in characteristics to the original tumor (Figure 3).

Cell growth and morphological findings in vitro

UTOS-1 cells were spindle-shaped, contained several nucleoli, and formed clumps. Two weeks after initial cultivation in primary culture, the tumor cells reached subconfluence with some piled-up foci of cells (Figure 4A). After the cells were serially subcultured for about 3 months, they began to grow rapidly at passage 6 (Figure 4B).
This new cell line has been maintained in vitro for more than 50 passages over more than 2 years. In the exponential phase of cell growth, the population-doubling time was 40 hours (Figure 5).

Immunohistochemical and cytochemical findings

All UTOS-1 cells were negative for AE1/AE3 and keratin mix. Most UTOS-1 cells were positive for vimentin. All UTOS-1 cells were positive for OP, OC and ALP (Figure 6).

RT-PCR

UTOS-1 cells expressed ALP, OP and OC, which is similar to the results for Saos-2 (Figure 7).

Cytogenetic findings

A representative karyotype is shown in Figure 8. 50 UTOS-1 cells exhibited a complex karyotype. The karyotypes of UTOS-1 cells at passage 15 were similar to those of the original tumor. The composite karyotypes were as follows: 73~85, Y, -X [7],+Y[10],add(X)(q11)[9],add(X)(q11)[2],+1[8],del(1)(q11)[9], der(1)add(1)(p11)add(1)(q42)[9],der(1)add(1)(p22)add(1)(q32)[2],der(1)add(1)(p32)add(1)(q42)[6],-3[10],-4[3],add(4)(q11)[9],-5 [4],del(5)(p13)[9], +add(6)(q11)[3],der(6)del(6)(p21)add(6)(q2?)[10],der(6)del(6)(p24)add(6)(q13) ×2,[10]-7[10],add(7)(p22)[6],der(7)t(7;7)(p22;q22)[10],+8[3],-9[10],-9[8],add(9)(q22)[9],-10[10],add(10)(p11)[4],add(10)(q26)[7], der(10)add(10)(p11)add(10)(q26)[3],add(11)(p11)[9],add(11)(p11)[4], del(11)(p11)[6],-12[5],der(12)(q21)[6],der(12)add(12)(p11)add(12)(q24)[10], der(12)add(12)add(12)[7],-13[10],+14[2], add(14)(p11)[10],add(14)[2], add(14)(p11)[8],-15[7],add(15)(p11)[5],add(15)(p11)[4],+16[5], add(16)(p11)[3],add(16)(q24)[2],add(16)(p11)[10],add(16)[4],-17[10],-17[8],add(17)(q24)[3],?del(17)(p11)[3],-18[5],add(18)(p11)[9], add(18)(q21)[5],+19[5],add(19)(p11)[9],add(19)(q13)[8],del(19)(p13)[9],+20[7],add(20)(p11)[7],add(20)(p13)[8],add(20)(q11)[4],+21[8],+21[4],add(21)(p11)[10],add(21)(p11)[4],add(21)(q22)[7],+22[10],+22[7],+22[3],del(22)(q13)[10],del(22)[9],+10~18 mar.

Array CGH

Significant gains of DNA sequences were observed for locus DAB2 at chromosome 5q13, CCND2 at 12p13, MDM2 at 12q14.3-q15, FLI, TOP3A at 17p11.2-p12, and OCRL1 at Xq25. Significant losses of DNA sequences were observed for HTR1B at 6q13, D6S268 at 6q16.3-q21, SHGC17327 at 18ptel, and STK6 at 20q13.2-q13.3. The representative aCGH profile is shown in Figure 9.

Discussion

There have been several reports describing xenotransplantation models of human OS [47]. In the present study, the parent tumor, the cultured tumor cells, and the xenografted tumor exhibited features typical of OS, as reported previously [15, 17]. Cultured UTOS-1 cells have a spindle shape with several nucleoli, which is similar to the original tumor cells. Biochemical characteristics of UTOS-1, such as cell growth rate and osteoblastic activity, have not changed during the 2 years that they have been maintained. Immunohistochemically, the UTOS-1 cells remain positive for ALP, OP and OC. After implantation from cell culture into SCID mice, UTOS-1 cells grew in vivo, producing osteoid resembling that of the original tumor. Abundant osteoid tissue formed in the xenografted tumors and reimplanted tumors. These findings suggest that UTOS-1 cells have an osteoblastic phenotype and retain the characteristics of the original tumor. The population-doubling time of UTOS-1 cells in vitro is 40 hours, which is similar to that of other OS cell lines [4, 6, 18].
Several reports indicate that OS cells have karyotypes with multiple numerical rearrangements and complex structural rearrangements [9, 1921]. Together, the results of several cytogenetic surveys indicate that OS cells frequently have structural alterations at chromosome bands 1p11-13, 1q11-12, 1q21-22, 11p15, 12p13, 17p11-3, 19q13, and 22q11-13, and frequently have the numerical chromosome abnormalities +1, -9, -10, -13, and -17. In UTOS-1 cells, the clonal chromosomal abnormalities that were detected were triploidies. The chromosomal rearrangements that were observed in UTOS-1 involved chromosomes 1q11-12, 11p15, 19q13, and 22q11-13. The numerical chromosome abnormalities that were observed in UTOS-1 included +1, -9, -10, -13, and -17. These findings are similar to studies of other OS cell lines [8].
Metaphase CGH studies of OS have identified frequent gains at chromosome bands 1p32, 1q21, 5p13, 6p12, 8q24, 8cen-q13, 17p11.2, and Xp21, and frequent losses at bands 6q16, 10p12pter, and 10q22-q26 [22, 23]. Recent metaphase CGH studies of OS have focused on amplifications at chromosomes 8q, 6p, and 17p [22, 24]. Advances in mapping resolution of microarray CGH [25, 26] have greatly improved its resolving power, such that it now provides greater detail than metaphase CGH regarding the complexity and exact location of genomic rearrangements leading to copy number imbalances.
In the present study, chromosome 12 showed several distinct regions of focal amplification, occurring at gains of CCND2 at 12p13 12q13 and MDM2 at 12q14.3-q15. Previous CGH studies of OS have revealed abnormalities of chromosome 12, including gains at bands 12p12-p13 [24], 12q12-q13 [27], and 12q13-q14 [28]. Expression of the CCND2 gene, which is located at chromosome 12p13, has been observed in various malignancies, including prostate cancer and breast cancer [2931]. CCND2 encodes a protein belonging to the cyclin family of proteins that regulate cyclin-dependent kinase (CDK) kinases [32]. CDK activity controls the cell cycle G1/S transition by regulating phosphorylation of the tumor suppressor protein Rb [33]. These facts suggest that CCND2 controls proliferation of UTOS-1 tumor cells.
Some studies indicate that 14 to 27% of OS tumors have abnormal MDM2 expression [34, 35]. MDM2 is a target gene of the transcription factor tumor protein p53 [36]. The encoded protein is a nuclear phosphoprotein that binds and inhibits transactivation by tumor protein p53, as part of an autoregulatory negative feedback loop [37, 38]. Overexpression of MDM2 gene can result in excessive inactivation of tumor protein p53, diminishing its tumor suppressor function. These findings suggest the possible involvement of the p53 tumor suppressor gene, which is associated with development of OS in UTOS-1 cells.
The gain of chromosome band at 17p11.2-p12 has been observed in approximately 13 to 29% of high-grade OS [24, 39, 40]. In UTOS-1 cells, gain of the genes FLI and TOP3A at chromosome 17p11.2-p12 has been observed. These findings suggest that multiple gains, including FLI, TOP3 or other genes close to these candidate oncogenes, are present at chromosome 17p11.2-p12 and contribute to OS tumorigenesis [41]. Recent studies indicate that overexpression of 17p11.2-p12 is associated with p53 degradation [4244].
In a study of OS using a cDNA array, Squire et al. observed amplification of the genes MYC, GAS7, and PM1 in OS cells [45]. Other reports indicate that losses of chromosome bands 6q16 and 6q21-q22 occur in high-grade OS [46]. These findings and those of the present study suggest that gene losses on chromosome 6q, including HTR1B and D6S268, contribute to OS tumorigenesis.
One of the most remarkable breakpoint clusters that have been found in OS tumors was detected on chromosome 20 by spectral karyotyping (SKY) analysis [47]. Chromosome 20 is one of the smaller chromosomes, suggesting that it is particularly vulnerable to structural rearrangement. However, there is little evidence that chromosome 20 is frequently involved in chromosomal imbalances [26, 28]. In the present study, the only loss that involved chromosome 20 occurred at band 20q13.2-q13.3. Many chromosomal changes have been observed in CGH studies of high-grade OS [46]. Reports indicate that the genes involved in OS tumorigenesis include DAB2 (at chromosome 5q13), OCRL1 (at Xq25), and SHGC17327 (at 18ptel). However, many of these genes were not previously known to be associated with OS tumorigenesis.
In conclusion, we have isolated and characterized a new permanent human cell line, UTOS-1, established from an osteoblastic OS. This cell line retains the morphology, osteoblastic activities and cytogenetic characteristics of the original tumor in vitro. The UTOS-1 cell line is useful for biologic and molecular pathogenetic studies of human OS.

Acknowledgements

We thank all members of the Department of Orthopaedic Surgery, University of Toyama.
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

Authors have made substantial contributions to conception and design MK and TY acquisition of data. SN, TH, TO and KS analysis, interpretation of data, organizing study. TY and supervision of research group TK
Literatur
1.
Zurück zum Zitat Meyers PA, Gorlick R, Heller G, Casper E, Lane J, Huvos AG, Healey JH: Intensification of preoperative chemotherapy for osteogenic sarcoma: results of the Memorial Sloan-Kettering (T12) protocol. J Clin Oncol. 1998, 16: 2452-2458. Meyers PA, Gorlick R, Heller G, Casper E, Lane J, Huvos AG, Healey JH: Intensification of preoperative chemotherapy for osteogenic sarcoma: results of the Memorial Sloan-Kettering (T12) protocol. J Clin Oncol. 1998, 16: 2452-2458.
2.
Zurück zum Zitat Bacci G, Lari S: Current treatment of high grade osteosarcoma of the extremity: review. J Chemother. 2001, 13: 235-243.CrossRef Bacci G, Lari S: Current treatment of high grade osteosarcoma of the extremity: review. J Chemother. 2001, 13: 235-243.CrossRef
3.
Zurück zum Zitat Uchida A, Myoui A, Araki N, Yoshikawa H, Shinto Y, Ueda T: Neoadjuvant chemotherapy for pediatric osteosarcoma patients. Cancer. 1997, 79: 411-415. 10.1002/(SICI)1097-0142(19970115)79:2<411::AID-CNCR26>3.0.CO;2-2.CrossRef Uchida A, Myoui A, Araki N, Yoshikawa H, Shinto Y, Ueda T: Neoadjuvant chemotherapy for pediatric osteosarcoma patients. Cancer. 1997, 79: 411-415. 10.1002/(SICI)1097-0142(19970115)79:2<411::AID-CNCR26>3.0.CO;2-2.CrossRef
4.
Zurück zum Zitat Fournier B, Price PA: Characterization of a new human osteosarcoma cell line OHS-4. J Cell Biol. 1991, 114: 577-583. 10.1083/jcb.114.3.577.CrossRef Fournier B, Price PA: Characterization of a new human osteosarcoma cell line OHS-4. J Cell Biol. 1991, 114: 577-583. 10.1083/jcb.114.3.577.CrossRef
5.
Zurück zum Zitat Yamane T: Establishment and characterization of cell lines derived from a human osteosarcoma. Clin Orthop. 1985, 199: 261-271. Yamane T: Establishment and characterization of cell lines derived from a human osteosarcoma. Clin Orthop. 1985, 199: 261-271.
6.
Zurück zum Zitat Yoshikawa H, Ohishi M, Kohriki S, Yoshiura M, Ohsaki Y: Establishment and characterization of an osteoblastic clonal cell line from human mandibular osteosarcoma (HMOS-1). Oral Oncol. 1997, 33: 163-168. 10.1016/S0964-1955(96)00075-9.CrossRef Yoshikawa H, Ohishi M, Kohriki S, Yoshiura M, Ohsaki Y: Establishment and characterization of an osteoblastic clonal cell line from human mandibular osteosarcoma (HMOS-1). Oral Oncol. 1997, 33: 163-168. 10.1016/S0964-1955(96)00075-9.CrossRef
7.
Zurück zum Zitat Rodan SB, Imai Y, Thiede MA, Wesolowski G, Thompson D, Bar-Shavit Z, Shull S, Mann K, Rodan GA: Characterization of a human osteosarcoma cell line (Saos-2) with osteoblastic properties. Cancer Res. 1987, 47: 4961-4966. Rodan SB, Imai Y, Thiede MA, Wesolowski G, Thompson D, Bar-Shavit Z, Shull S, Mann K, Rodan GA: Characterization of a human osteosarcoma cell line (Saos-2) with osteoblastic properties. Cancer Res. 1987, 47: 4961-4966.
8.
Zurück zum Zitat Boehm AK, Squire JA, Bayani J, Nelson M, Neff J, Bridge JA: Cytogenetic findings in 35 osteosarcoma specimens and a review of the literature. Pediatr Pathol Mol Med. 2000, 19: 359-376. 10.1080/15227950050193623.CrossRef Boehm AK, Squire JA, Bayani J, Nelson M, Neff J, Bridge JA: Cytogenetic findings in 35 osteosarcoma specimens and a review of the literature. Pediatr Pathol Mol Med. 2000, 19: 359-376. 10.1080/15227950050193623.CrossRef
9.
Zurück zum Zitat Ozaki T, Neumann T, Wai D, Schäfer KL, van Valen F, Lindner N, Scheel C, Böcker W, Winkelmann W, Dockhorn-Dworniczak B, Horst J, Poremba C: Chromosomal alterations in osteosarcoma cell lines revealed by comparative genomic hybridization and multicolor karyotyping. Cancer Genet Cytogenet. 2003, 140: 145-152. 10.1016/S0165-4608(02)00685-4.CrossRef Ozaki T, Neumann T, Wai D, Schäfer KL, van Valen F, Lindner N, Scheel C, Böcker W, Winkelmann W, Dockhorn-Dworniczak B, Horst J, Poremba C: Chromosomal alterations in osteosarcoma cell lines revealed by comparative genomic hybridization and multicolor karyotyping. Cancer Genet Cytogenet. 2003, 140: 145-152. 10.1016/S0165-4608(02)00685-4.CrossRef
10.
Zurück zum Zitat Cherrier B, Gouin F, Heymann MF, Thiéry JP, Rédini F, Heymann D, Duteille F: A new experimental rat model of osteosarcoma established by intrafemoral tumor cell inoculation, useful for biology and therapy investigations. Tumor Biol. 2005, 26: 121-130. 10.1159/000086483.CrossRef Cherrier B, Gouin F, Heymann MF, Thiéry JP, Rédini F, Heymann D, Duteille F: A new experimental rat model of osteosarcoma established by intrafemoral tumor cell inoculation, useful for biology and therapy investigations. Tumor Biol. 2005, 26: 121-130. 10.1159/000086483.CrossRef
11.
Zurück zum Zitat Yasuda T, Matsui H, Kanamori M, Yudoh K, Ohmori K, Aoki M, Tsuji H: Effects of tumor cell-derived interleukin 1 alpha on invasiveness of metastatic clones of murine RCT sarcoma through endothelial cells. Tumor Biol. 1999, 20: 105-116. 10.1159/000030053.CrossRef Yasuda T, Matsui H, Kanamori M, Yudoh K, Ohmori K, Aoki M, Tsuji H: Effects of tumor cell-derived interleukin 1 alpha on invasiveness of metastatic clones of murine RCT sarcoma through endothelial cells. Tumor Biol. 1999, 20: 105-116. 10.1159/000030053.CrossRef
12.
Zurück zum Zitat Carmichael J, DeGraff WG, Gazdar AF: Evaluation of a tetrazolium-based semiautomated colorimetric assay: assessment of chemosensitivity testing. Cancer Res. 1987, 47: 936-942. Carmichael J, DeGraff WG, Gazdar AF: Evaluation of a tetrazolium-based semiautomated colorimetric assay: assessment of chemosensitivity testing. Cancer Res. 1987, 47: 936-942.
13.
Zurück zum Zitat Koide O, Iwai S, Kanno T, Kanda S: Isoenzyme of alkaline phosphatase in germinoma cells. Am J Clin Pathol. 1988, 89: 611-616. Koide O, Iwai S, Kanno T, Kanda S: Isoenzyme of alkaline phosphatase in germinoma cells. Am J Clin Pathol. 1988, 89: 611-616.
14.
Zurück zum Zitat Nishio J, Iwasaki H, Ishiguro M, Ohjimi Y, Yo S, Isayama T, Naito M, Kikuchi M: Supernumerary ring chromosome in a Bednar tumor (pigmented dermatofibrosarcoma protuberans) is composed of interspersed sequences from chromosomes 17 and 22: a fluorescence in situ hybridization and comparative genomic hybridization analysis. Genes Chromosomes Cancer. 2001, 30: 305-309. 10.1002/1098-2264(2000)9999:9999<::AID-GCC1091>3.0.CO;2-R.CrossRef Nishio J, Iwasaki H, Ishiguro M, Ohjimi Y, Yo S, Isayama T, Naito M, Kikuchi M: Supernumerary ring chromosome in a Bednar tumor (pigmented dermatofibrosarcoma protuberans) is composed of interspersed sequences from chromosomes 17 and 22: a fluorescence in situ hybridization and comparative genomic hybridization analysis. Genes Chromosomes Cancer. 2001, 30: 305-309. 10.1002/1098-2264(2000)9999:9999<::AID-GCC1091>3.0.CO;2-R.CrossRef
15.
Zurück zum Zitat Shaffer LG, Tommerup N, editors: ISCN. An international system for human cytogenetic Nomenclature. Basel: S Karger. 2005 Shaffer LG, Tommerup N, editors: ISCN. An international system for human cytogenetic Nomenclature. Basel: S Karger. 2005
16.
Zurück zum Zitat Kallioniemi A, Kallioniemi OP, Sudar D, Rutovitz D, Gray JW, Waldman F, Pinkel D: Comparative genomic hybridization for molecular cytogenetic analysis of solid tumors. Science. 1992, 258: 818-821. 10.1126/science.1359641.CrossRef Kallioniemi A, Kallioniemi OP, Sudar D, Rutovitz D, Gray JW, Waldman F, Pinkel D: Comparative genomic hybridization for molecular cytogenetic analysis of solid tumors. Science. 1992, 258: 818-821. 10.1126/science.1359641.CrossRef
17.
Zurück zum Zitat Bilbe G, Roberts E, Birch M, Evans DB: PCR phenotyping of cytokines, growth factors and their receptors and bone matrix proteins in human osteoblast-like cell lines. Bone. 1996, 19: 437-445. 10.1016/S8756-3282(96)00254-2.CrossRef Bilbe G, Roberts E, Birch M, Evans DB: PCR phenotyping of cytokines, growth factors and their receptors and bone matrix proteins in human osteoblast-like cell lines. Bone. 1996, 19: 437-445. 10.1016/S8756-3282(96)00254-2.CrossRef
18.
Zurück zum Zitat Rochet N, Dubousset J, Mazeau C, Zanghellini E, Farges MF, de Novion HS, Chompret A, Delpech B, Cattan N, Frenay M, Gioanni J: Establishment, characterization and partial cytokine expression profile of a new human osteosarcoma cell line (CAL 72). Int J Cancer. 1999, 82: 282-285. 10.1002/(SICI)1097-0215(19990719)82:2<282::AID-IJC20>3.0.CO;2-R.CrossRef Rochet N, Dubousset J, Mazeau C, Zanghellini E, Farges MF, de Novion HS, Chompret A, Delpech B, Cattan N, Frenay M, Gioanni J: Establishment, characterization and partial cytokine expression profile of a new human osteosarcoma cell line (CAL 72). Int J Cancer. 1999, 82: 282-285. 10.1002/(SICI)1097-0215(19990719)82:2<282::AID-IJC20>3.0.CO;2-R.CrossRef
19.
Zurück zum Zitat Bridge JA, Nelson M, McComb E, McGuire MH, Rosenthal H, Vergara G, Maale GE, Spanier S, Neff JR: Cytogenetic findings in 73 osteosarcoma specimens and a review of the literature. Cancer Genet Cytogenet. 1997, 95: 74-87. 10.1016/S0165-4608(96)00306-8.CrossRef Bridge JA, Nelson M, McComb E, McGuire MH, Rosenthal H, Vergara G, Maale GE, Spanier S, Neff JR: Cytogenetic findings in 73 osteosarcoma specimens and a review of the literature. Cancer Genet Cytogenet. 1997, 95: 74-87. 10.1016/S0165-4608(96)00306-8.CrossRef
20.
Zurück zum Zitat Murata H, Kusuzaki K, Takeshita H, Hirasawa Y, Ashihara T, Abe T, Inazawa J: Aberrations of chromosomes 1 and 17 in six human osteosarcoma cell lines using double-target fluorescence in situ hybridization. Cancer Genet Cytogenet. 1998, 107: 7-10. 10.1016/S0165-4608(98)00072-7.CrossRef Murata H, Kusuzaki K, Takeshita H, Hirasawa Y, Ashihara T, Abe T, Inazawa J: Aberrations of chromosomes 1 and 17 in six human osteosarcoma cell lines using double-target fluorescence in situ hybridization. Cancer Genet Cytogenet. 1998, 107: 7-10. 10.1016/S0165-4608(98)00072-7.CrossRef
21.
Zurück zum Zitat Wolf M, Tarkkanen M, Hulsebos T, Larramendy ML, Forus A, Myklebost O, Aaltonen LA, Elomaa I, Knuutila S: Characterization of the 17p amplicon in human sarcomas: microsatellite marker analysis. Int J Cancer. 1999, 82: 329-333. 10.1002/(SICI)1097-0215(19990730)82:3<329::AID-IJC4>3.0.CO;2-1.CrossRef Wolf M, Tarkkanen M, Hulsebos T, Larramendy ML, Forus A, Myklebost O, Aaltonen LA, Elomaa I, Knuutila S: Characterization of the 17p amplicon in human sarcomas: microsatellite marker analysis. Int J Cancer. 1999, 82: 329-333. 10.1002/(SICI)1097-0215(19990730)82:3<329::AID-IJC4>3.0.CO;2-1.CrossRef
22.
Zurück zum Zitat Sandberg AA, Bridge JA: Updates on the cytogenetics and molecular genetics of bone and soft tissue tumors: osteosarcoma and related tumors. Cancer Genet Cytogenet. 2003, 145: 1-30. 10.1016/S0165-4608(03)00105-5.CrossRef Sandberg AA, Bridge JA: Updates on the cytogenetics and molecular genetics of bone and soft tissue tumors: osteosarcoma and related tumors. Cancer Genet Cytogenet. 2003, 145: 1-30. 10.1016/S0165-4608(03)00105-5.CrossRef
23.
Zurück zum Zitat Overholtzer M, Rao PH, Favis R, Lu XY, Elowitz MB, Barany F, Ladanyi M, Gorlick R, Levine AJ: The presence of p53 mutations in human osteosarcomas correlates with high levels of genomic instability. Proc Natl Acad Sci USA. 2003, 100: 11547-11552. 10.1073/pnas.1934852100.CrossRef Overholtzer M, Rao PH, Favis R, Lu XY, Elowitz MB, Barany F, Ladanyi M, Gorlick R, Levine AJ: The presence of p53 mutations in human osteosarcomas correlates with high levels of genomic instability. Proc Natl Acad Sci USA. 2003, 100: 11547-11552. 10.1073/pnas.1934852100.CrossRef
24.
Zurück zum Zitat Tarkkanen M, Karhu R, Kallioniemi A, Elomaa I, Kivioja AH, Nevalainen J, Böhling T, Karaharju E, Hyytinen E, Knuutila S, Kallioniemi OP: Gains and losses of DNA sequences in osteosarcomas by comparative genomic hybridization. Cancer Res. 1995, 55: 1334-1338. Tarkkanen M, Karhu R, Kallioniemi A, Elomaa I, Kivioja AH, Nevalainen J, Böhling T, Karaharju E, Hyytinen E, Knuutila S, Kallioniemi OP: Gains and losses of DNA sequences in osteosarcomas by comparative genomic hybridization. Cancer Res. 1995, 55: 1334-1338.
25.
Zurück zum Zitat Beheshti B, Braude I, Marrano P, Thorner P, Zielenska M, Squire JA: Chromosomal localization of DNA amplifications in neuroblastoma tumors using cDNA microarray comparative genomic hybridization. Neoplasia. 2003, 5: 53-62.CrossRef Beheshti B, Braude I, Marrano P, Thorner P, Zielenska M, Squire JA: Chromosomal localization of DNA amplifications in neuroblastoma tumors using cDNA microarray comparative genomic hybridization. Neoplasia. 2003, 5: 53-62.CrossRef
26.
Zurück zum Zitat Pollack JR, Perou CM, Alizadeh AA, Eisen MB, Pergamenschikov A, Williams CF, Jeffrey SS, Botstein D, Brown PO: Genome-wide analysis of DNA copy-number changes using cDNA microarrays. Nat Genet. 1999, 23: 41-46. 10.1038/14385.CrossRef Pollack JR, Perou CM, Alizadeh AA, Eisen MB, Pergamenschikov A, Williams CF, Jeffrey SS, Botstein D, Brown PO: Genome-wide analysis of DNA copy-number changes using cDNA microarrays. Nat Genet. 1999, 23: 41-46. 10.1038/14385.CrossRef
27.
Zurück zum Zitat Hulsebos TJ, Bijleveld EH, Oskam NT, Westerveld A, Leenstra S, Hogendoorn PC, Bras J: Malignant astrocytoma-derived region of common amplification in chromosomal band 17p12 is frequently amplified in high-grade osteosarcomas. Genes Chromosomes Cancer. 1997, 18: 279-285. 10.1002/(SICI)1098-2264(199704)18:4<279::AID-GCC5>3.0.CO;2-Y.CrossRef Hulsebos TJ, Bijleveld EH, Oskam NT, Westerveld A, Leenstra S, Hogendoorn PC, Bras J: Malignant astrocytoma-derived region of common amplification in chromosomal band 17p12 is frequently amplified in high-grade osteosarcomas. Genes Chromosomes Cancer. 1997, 18: 279-285. 10.1002/(SICI)1098-2264(199704)18:4<279::AID-GCC5>3.0.CO;2-Y.CrossRef
28.
Zurück zum Zitat Tarkkanen M, Böhling T, Gamberi G, Ragazzini P, Benassi MS, Kivioja A, Kallio P, Elomaa I, Picci P, Knuutila S: Comparative genomic hybridization of low-grade central osteosarcoma. Mod Pathol. 1998, 11: 421-426. Tarkkanen M, Böhling T, Gamberi G, Ragazzini P, Benassi MS, Kivioja A, Kallio P, Elomaa I, Picci P, Knuutila S: Comparative genomic hybridization of low-grade central osteosarcoma. Mod Pathol. 1998, 11: 421-426.
29.
Zurück zum Zitat Knuutila S, Autio K, Aalto Y: Online access to CGH data of DNA sequence copy number changes. Am J Pathol. 2000, 157: 689-CrossRef Knuutila S, Autio K, Aalto Y: Online access to CGH data of DNA sequence copy number changes. Am J Pathol. 2000, 157: 689-CrossRef
30.
Zurück zum Zitat Padar A, Sathyanarayana UG, Suzuki M, Maruyama R, Hsieh JT, Frenkel EP, Minna JD, Gazdar AF: Inactivation of cyclin D2 gene in prostate cancers by aberrant promoter methylation. Clin Cancer Res. 2003, 9: 4730-4734. Padar A, Sathyanarayana UG, Suzuki M, Maruyama R, Hsieh JT, Frenkel EP, Minna JD, Gazdar AF: Inactivation of cyclin D2 gene in prostate cancers by aberrant promoter methylation. Clin Cancer Res. 2003, 9: 4730-4734.
31.
Zurück zum Zitat Yu J, Leung WK, Ebert MP, Leong RW, Tse PC, Chan MW, Bai AH, To KF, Malfertheiner P, Sung JJ: Absence of cyclin D2 expression is associated with promoter hypermethylation in gastric cancer. Br J Cancer. 2003, 88: 1560-1565. 10.1038/sj.bjc.6600940.CrossRef Yu J, Leung WK, Ebert MP, Leong RW, Tse PC, Chan MW, Bai AH, To KF, Malfertheiner P, Sung JJ: Absence of cyclin D2 expression is associated with promoter hypermethylation in gastric cancer. Br J Cancer. 2003, 88: 1560-1565. 10.1038/sj.bjc.6600940.CrossRef
32.
Zurück zum Zitat Morgan DO: Principles of Cdk regulation. Nature. 1995, 374: 131-134. 10.1038/374131a0.CrossRef Morgan DO: Principles of Cdk regulation. Nature. 1995, 374: 131-134. 10.1038/374131a0.CrossRef
33.
Zurück zum Zitat Weinberg RA: The retinoblastoma protein and cell cycle control. Cell. 1995, 81: 323-330. 10.1016/0092-8674(95)90385-2.CrossRef Weinberg RA: The retinoblastoma protein and cell cycle control. Cell. 1995, 81: 323-330. 10.1016/0092-8674(95)90385-2.CrossRef
34.
Zurück zum Zitat Ladanyi M, Cha C, Lewis R, Jhanwar SC, Huvos AG, Healey JH: MDM2 gene amplification in metastatic osteosarcoma. Cancer Res. 1993, 53: 16-18. Ladanyi M, Cha C, Lewis R, Jhanwar SC, Huvos AG, Healey JH: MDM2 gene amplification in metastatic osteosarcoma. Cancer Res. 1993, 53: 16-18.
35.
Zurück zum Zitat Oliner JD, Kinzler KW, Meltzer PS, George DL, Vogelstein B: Amplification of a gene encoding a p53-associated protein in human sarcomas. Nature. 1992, 358: 80-83. 10.1038/358080a0.CrossRef Oliner JD, Kinzler KW, Meltzer PS, George DL, Vogelstein B: Amplification of a gene encoding a p53-associated protein in human sarcomas. Nature. 1992, 358: 80-83. 10.1038/358080a0.CrossRef
36.
Zurück zum Zitat Sakamuro D, Sabbatini P, White E, Prendergast GC: The polyproline region of p53 is required to activate apoptosis but not growth arrest. Oncogene. 1997, 15: 887-898. 10.1038/sj.onc.1201263.CrossRef Sakamuro D, Sabbatini P, White E, Prendergast GC: The polyproline region of p53 is required to activate apoptosis but not growth arrest. Oncogene. 1997, 15: 887-898. 10.1038/sj.onc.1201263.CrossRef
37.
Zurück zum Zitat Kubbutat MH, Jones SN, Vousden KH: Regulation of p53 stability by Mdm2. Nature. 1997, 387: 299-303. 10.1038/387299a0.CrossRef Kubbutat MH, Jones SN, Vousden KH: Regulation of p53 stability by Mdm2. Nature. 1997, 387: 299-303. 10.1038/387299a0.CrossRef
38.
Zurück zum Zitat Candau R, Scolnick DM, Darpino P, Ying CY, Halazonetis TD, Berger SL: Two tandem and independent sub-activation domains in the amino terminus of p53 require the adaptor complex for activity. Oncogene. 1997, 15: 807-816. 10.1038/sj.onc.1201244.CrossRef Candau R, Scolnick DM, Darpino P, Ying CY, Halazonetis TD, Berger SL: Two tandem and independent sub-activation domains in the amino terminus of p53 require the adaptor complex for activity. Oncogene. 1997, 15: 807-816. 10.1038/sj.onc.1201244.CrossRef
39.
Zurück zum Zitat Stock C, Kager L, Fink FM, Gadner H, Ambros PF: Chromosomal regions involved in the pathogenesis of osteosarcomas. Genes Chromosomes Cancer. 2000, 28: 329-336. 10.1002/1098-2264(200007)28:3<329::AID-GCC11>3.0.CO;2-F.CrossRef Stock C, Kager L, Fink FM, Gadner H, Ambros PF: Chromosomal regions involved in the pathogenesis of osteosarcomas. Genes Chromosomes Cancer. 2000, 28: 329-336. 10.1002/1098-2264(200007)28:3<329::AID-GCC11>3.0.CO;2-F.CrossRef
40.
Zurück zum Zitat Zielenska M, Bayani J, Pandita A, Toledo S, Marrano P, Andrade J, Petrilli A, Thorner P, Sorensen P, Squire JA: Comparative genomic hybridization analysis identifies gains of 1p35-36 and chromosome 19 in osteosarcoma. Cancer Genet Cytogenet. 2001, 130: 14-21. 10.1016/S0165-4608(01)00461-7.CrossRef Zielenska M, Bayani J, Pandita A, Toledo S, Marrano P, Andrade J, Petrilli A, Thorner P, Sorensen P, Squire JA: Comparative genomic hybridization analysis identifies gains of 1p35-36 and chromosome 19 in osteosarcoma. Cancer Genet Cytogenet. 2001, 130: 14-21. 10.1016/S0165-4608(01)00461-7.CrossRef
41.
Zurück zum Zitat van Dartel M, Cornelissen PW, Redeker S, Tarkkanen M, Knuutila S, Hogendoorn PC, Westerveld A, Gomes I, Bras J, Hulsebos TJ: Amplification of 17p11.2-p12, including PMP22, TOP3A, and MAPK7 in high-grade osteosarcoma. Cancer Genet Cytogenet. 2002, 139: 91-96. 10.1016/S0165-4608(02)00627-1.CrossRef van Dartel M, Cornelissen PW, Redeker S, Tarkkanen M, Knuutila S, Hogendoorn PC, Westerveld A, Gomes I, Bras J, Hulsebos TJ: Amplification of 17p11.2-p12, including PMP22, TOP3A, and MAPK7 in high-grade osteosarcoma. Cancer Genet Cytogenet. 2002, 139: 91-96. 10.1016/S0165-4608(02)00627-1.CrossRef
42.
Zurück zum Zitat van Dartel M, Redeker S, Bras J, Kool M, Hulsebos TJ: Overexpression through amplification of genes in chromosome region 17p11.2-p12 in high-grade osteosarcoma. Cancer Genet Cytogenet. 2004, 152: 8-14. 10.1016/j.cancergencyto.2003.09.024.CrossRef van Dartel M, Redeker S, Bras J, Kool M, Hulsebos TJ: Overexpression through amplification of genes in chromosome region 17p11.2-p12 in high-grade osteosarcoma. Cancer Genet Cytogenet. 2004, 152: 8-14. 10.1016/j.cancergencyto.2003.09.024.CrossRef
43.
Zurück zum Zitat Henriksen J, Aagesen TH, Maelandsmo GM, Lothe RA, Myklebost O, Forus A: Amplification and overexpression of COPS3 in osteosarcomas potentially target TP53 for proteasome-mediated degradation. Oncogene. 2003, 22: 5358-5361. 10.1038/sj.onc.1206671.CrossRef Henriksen J, Aagesen TH, Maelandsmo GM, Lothe RA, Myklebost O, Forus A: Amplification and overexpression of COPS3 in osteosarcomas potentially target TP53 for proteasome-mediated degradation. Oncogene. 2003, 22: 5358-5361. 10.1038/sj.onc.1206671.CrossRef
44.
Zurück zum Zitat van Dartel M, Hulsebos TJ: Amplification and overexpression of genes in 17p11.2-p12 in osteosarcoma. Cancer Genet Cytogenet. 2004, 153: 77-80. 10.1016/j.cancergencyto.2004.03.007.CrossRef van Dartel M, Hulsebos TJ: Amplification and overexpression of genes in 17p11.2-p12 in osteosarcoma. Cancer Genet Cytogenet. 2004, 153: 77-80. 10.1016/j.cancergencyto.2004.03.007.CrossRef
45.
Zurück zum Zitat Squire JA, Pei J, Marrano P, Beheshti B, Bayani J, Lim G, Moldovan L, Zielenska M: High-resolution mapping of amplifications and deletions in pediatric osteosarcoma by use of CGH analysis of cDNA microarrays. Genes Chromosomes Cancer. 2003, 38: 215-225. 10.1002/gcc.10273.CrossRef Squire JA, Pei J, Marrano P, Beheshti B, Bayani J, Lim G, Moldovan L, Zielenska M: High-resolution mapping of amplifications and deletions in pediatric osteosarcoma by use of CGH analysis of cDNA microarrays. Genes Chromosomes Cancer. 2003, 38: 215-225. 10.1002/gcc.10273.CrossRef
46.
Zurück zum Zitat Tarkkanen M, Elomaa I, Blomqvist C, Kivioja AH, Kellokumpu-Lehtinen P, Böhling T, Valle J, Knuutila S: DNA sequence copy number increase at 8q: a potential new prognostic marker in high-grade osteosarcoma. Int J Cancer. 1999, 84: 114-121. 10.1002/(SICI)1097-0215(19990420)84:2<114::AID-IJC4>3.0.CO;2-Q.CrossRef Tarkkanen M, Elomaa I, Blomqvist C, Kivioja AH, Kellokumpu-Lehtinen P, Böhling T, Valle J, Knuutila S: DNA sequence copy number increase at 8q: a potential new prognostic marker in high-grade osteosarcoma. Int J Cancer. 1999, 84: 114-121. 10.1002/(SICI)1097-0215(19990420)84:2<114::AID-IJC4>3.0.CO;2-Q.CrossRef
47.
Zurück zum Zitat Bayani J, Zielenska M, Pandita A, Al-Romaih K, Karaskova J, Harrison K, Bridge JA, Sorensen P, Thorner P, Squire JA: Spectral karyotyping identifies recurrent complex rearrangements of chromosomes 8, 17, and 20 in osteosarcomas. Genes Chromosomes Cancer. 2003, 36: 7-16. 10.1002/gcc.10132.CrossRef Bayani J, Zielenska M, Pandita A, Al-Romaih K, Karaskova J, Harrison K, Bridge JA, Sorensen P, Thorner P, Squire JA: Spectral karyotyping identifies recurrent complex rearrangements of chromosomes 8, 17, and 20 in osteosarcomas. Genes Chromosomes Cancer. 2003, 36: 7-16. 10.1002/gcc.10132.CrossRef
Metadaten
Titel
Establishment of a new human osteosarcoma cell line, UTOS-1: cytogenetic characterization by array comparative genomic hybridization
verfasst von
Taketoshi Yasuda
Masahiko Kanamori
Shigeharu Nogami
Takeshi Hori
Takeshi Oya
Kayo Suzuki
Tomoatsu Kimura
Publikationsdatum
01.12.2009
Verlag
BioMed Central
Erschienen in
Journal of Experimental & Clinical Cancer Research / Ausgabe 1/2009
Elektronische ISSN: 1756-9966
DOI
https://doi.org/10.1186/1756-9966-28-26

Weitere Artikel der Ausgabe 1/2009

Journal of Experimental & Clinical Cancer Research 1/2009 Zur Ausgabe

Adjuvante Immuntherapie verlängert Leben bei RCC

25.04.2024 Nierenkarzinom Nachrichten

Nun gibt es auch Resultate zum Gesamtüberleben: Eine adjuvante Pembrolizumab-Therapie konnte in einer Phase-3-Studie das Leben von Menschen mit Nierenzellkarzinom deutlich verlängern. Die Sterberate war im Vergleich zu Placebo um 38% geringer.

Alectinib verbessert krankheitsfreies Überleben bei ALK-positivem NSCLC

25.04.2024 NSCLC Nachrichten

Das Risiko für Rezidiv oder Tod von Patienten und Patientinnen mit reseziertem ALK-positivem NSCLC ist unter einer adjuvanten Therapie mit dem Tyrosinkinase-Inhibitor Alectinib signifikant geringer als unter platinbasierter Chemotherapie.

Bei Senioren mit Prostatakarzinom auf Anämie achten!

24.04.2024 DGIM 2024 Nachrichten

Patienten, die zur Behandlung ihres Prostatakarzinoms eine Androgendeprivationstherapie erhalten, entwickeln nicht selten eine Anämie. Wer ältere Patienten internistisch mitbetreut, sollte auf diese Nebenwirkung achten.

ICI-Therapie in der Schwangerschaft wird gut toleriert

Müssen sich Schwangere einer Krebstherapie unterziehen, rufen Immuncheckpointinhibitoren offenbar nicht mehr unerwünschte Wirkungen hervor als andere Mittel gegen Krebs.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.