Background
Tumor-associated macrophages (TAMs) are the most abundant cancer stromal cells involved in the host immune system [
1,
2]. In recent years, increasing attention has focused on TAMs, unique macrophage populations that play pivotal roles in tumor immunosuppression, and provide a suitable microenvironment for cancer development and progression[
3]. TAM infiltration has been found to be correlated with a worse outcome in several malignant tumors [
4‐
9]. The possible mechanism by which TAMs support tumor progression and help the tumor evade immunosurveillance is through the release a spectrum of tumor promoting and immunosuppressive products.
Interleukin-10(IL-10),
cathepsin B or
cathepsin S was reported to be closely associated with TAMs in recent literatures [
10‐
12].
IL-10 is produced primarily by T cells, B cells, dendritic cells, and monocytes/macrophages[
13]. Tumor-associated macrophages form a major component in a tumor, and have been suggested to play an essential role in the complex process of tumor-microenvironment coevolution and tumorigenesis[
1]. Previous reports have also shown that TAMs produce high levels of
IL-10, exhibit little cytotoxicity for tumor cells[
14]. However, there are controversies regarding its role in the progression of cancer [
15,
16]. So it is important to isolate TAM from tumor cells to study the role of
IL-10 in the progress of cancer.
By using DNA-microarray technology, recent study demonstrated that NSCLC patients with a high expression level of cathepsins in lung cancer tissue (both tumor cells and stroma cells) had a poor outcome [
17]. Interestingly, it has been shown that TAM is the primary source of high levels of cathepsin activity in pancreatic, breast and prostate cancer animal models [
10‐
12]. However, the significance of cathepsins expressed by TAM in NSCLC remains unknown.
In the present study, we assessed IL-10, cathepsin B and cathepsin S expression in TAMs, freshly isolated from lung tumor tissue, in correlation with clinicopathological factors in NSCLC.
Materials and methods
Subject characteristics
63 paired peripheral blood samples and primary lung cancer tissues were collected from patients before or at the time of surgical resection at the Center for Lung Cancer Prevention and Treatment of Shanghai Cancer Hospital from June 2009 to March 2010. Data collected included age, sex, smoking history, histopathological diagnosis, TNM stage, lymphovascular invasion, pleural invasion, and tumor differentiation. Histological diagnoses, presence of lymphovascular invasion(LVI), and grade of differentiation were confirmed by two senior histopathologists. A consent form was signed by every patient or his/her legal representatives. This study was approved by the committees for Ethical Review of Research at Shanghai Cancer Hospital.
Histological diagnosis and grade of differentiation were determined in accordance with the World Health Organization criteria for lung cancer[
18]. The pathologic tumor stage (p stage) was determined according to the revised TNM classification of lung cancer[
19].
Isolation of tumor-associated macrophages
TAMs were isolated from solid tumors according to literature reports [
20‐
22]. Briefly, Tumor tissue was cut into 2 mm fragments, followed by collagenase digestion (0.3 mg/ml, Worthington Biochemical Corp, NJ, USA) for 1 h at 37°C. The suspension was filtered through a 70 μm stainless steel wire mesh to generate a single-cell suspension. The suspension was centrifuged and washed twice with PBS. Cells were left to adhere in serum-free RPMI 1640 for 40 min. Nonadherent cells were washed away. Ninety-five percent of the remaining adherent cells were TAMs as assessed by morphology and macrophage specific marker CD68 positivity.
Immunofluorescence
TAMs were adhered to 24-well plate , fixed in 4% paraformaldehyde at room temperature for 5 minutes, washed with PBS twice, incubated with 1% BSA at 37°C for 30 minutes to block nonspecific interactions, and then stained with primary antibodies to CD68 (1:100 dilution, sc-20060, Santa Cruz Biotechnology, CA, USA) at 4°C overnight. After several washes with PBS, the cells were incubated in an appropriate, rhodamine-labeled goat anti-mouse secondary antibody(Proteintech Group, Inc, Chicago ,USA) at room temperature for 1 h. Nuclei of all cells were then stained with 4'6-diamidino-2-phenylindole(DAPI). Image was taken at 200 × magnification on an Olympus-IX51 microscope. For each patient, 10 fields were imaged and measured for percentage of macrophage (CD68 positive cells/DAPI stained cells). Immunofluorescence was repeated in three randomly selected patients.
Preparation normal macrophage
Macrophage (Mφ) was obtained as described previously [
20]. In brief, the mononuclear cells were isolated from peripheral blood matched with TAMs by Ficoll-Hypaque density gradient centrifugation (density, 1.077 ± 0.001 g/ml, Axis-Shield, Oslo, Norway) at 450 × g for 30 min at room temperature. The mononuclear cells were washed thrice with PBS and plated at 1 × 10
7 in 6-cm tissue culture dishe for 2 h in DMEM alone. Thereafter, the nonadherent cells were washed thrice with warm PBS and the adherent monocytes were cultured in DMEM containing 5% FBS and 25 ng/ml human macrophage colony-stimulating factor((rhM-CSF, PeproTech, Rocky Hill, NJ, USA), The medium was changed every 2 days, and macrophage were obtained after 6 days in vitro cultivation.
RNA isolation and Quantitative real-time RT-PCR(QRT-PCR)
Total RNA was isolated from TAMs and their matched macrophages by using RNeasy Mini Kit (Qiagen, Valencia, CA, USA) as described by the manufacturer's protocol. For mRNA analysis, an aliquot containing 2 μg of total RNA was transcribed reversely using M-MLV reverse transcriptase (Promega, Madison, WI, USA). Specific primers (Genery, Shanghai, China) were used to amplify cDNA. QRT-PCR was done using SYBR Green PCR master mix (Applied Biosystems, Piscataway, NJ, USA). The primers for QRT-PCR were: β-actin forward (F) 5' ACCACA CCTTCTACAATGA3', β-actin reverse(R) 5'GTCATCTTCTCGCGGTTG3'; IL-10 F 5' AGAACCT GAAGACCCTCAGGC3', IL-10 R 5' CCACGGCCTTGCTCTTGTT 3'; cathepsin B F 5' TGCA GCGCTGGGTGGATCTA 3'; cathepsin B R 5' ATTGGCCAACACCAGCAGGC 3'; cathepsin S F 5' GCTTCTCTTGGT GTCCATAC 3', cathepsin S R 5' CATTACTGCGGGAATGAGAC 3'. The amplification protocol consisted of an initial 10 min denaturation step at 95°C, followed by 40 cycles of PCR at 95°C for 15s, 60°C for 1 min and detection by the ABI-Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA). Each sample was assayed in triplicate. The comparative CT method (ΔΔCT method) was used to determine the quantity of the target sequences in TAM relative both to Mφ (calibrator) and to β-actin (an endogenous control). Relative expression levels were presented as the relative fold change and calculated using the formula: 2 -ΔΔCT= 2-(ΔCT(TAM) - ΔCT(Mφ) where each ΔCT =ΔCTtarget-ΔCTβ-actin.
Immunohistochemistry
For exact identification of IL-10 or cathepsin B expression in TAMs, serial sections were used to examine the expression of IL-10, cathepsin B in TAMs. Samples were fixed in 4% formaldehyde in PBS (pH 7.2) and paraffin embedded. 4-μm thickness was cut from each paraffin block. After dewaxing and rehydration, the sections were microwaved for antigen retrieval in 10 mmol/liter citrate buffer (pH 6.0) for 10 min, and then allowed to cool for 1 hour at room temperature. Endogenous peroxidase activity was blocked with hydrogen peroxide; Nonspecific binding was blocked by preincubation with 10% goat serum in PBS for 30 minutes at room temperature. Slides were incubated with the primary antibodies directed against monoclonal anti-human CD68 antibody (1:200 dilution, sc-20060, Santa Cruz, CA, USA), monoclonal anti-human IL-10 antibody (1:100 dilution, BA1201,Boster, WuHan, China) or polyclonal anti-human cathepsin B antibody (1:100 dilution, ab49232, Abcam, MA, USA). The results were visualized using the streptavidine-biotin immunoperoxidase detection kit and AEC chromogen (Maixin Bio, FuZhou, China) based on the manufacturer's instruction. Positive cells stained red. The negative control involved omission of the primary antibody.
Statistical analysis
Statistical analysis software (Prism 5.0, GraphPad Software Inc, La Jolla, CA, USA and SPSS Version 13.0 software, SPSS Inc, Chicago, IL, USA) was used to perform the analyses. Data are expressed as median (range). The Mann-Whitney test was used for the comparison between TAM and normal macrophage. The correlation between IL-10 or cathepsin B expression and clinicopathologic factors was analyzed by Mann-Whitney test. Multivariate logistic regression was performed to evaluate the relationships between the pathological stage (with early and late stage as dependent variables) and covariates (age, sex, tobacco use, tumor histology and IL-10 expression in TAMs). For this analysis, the median value of IL-10 was chosen as the cut-off point for dividing the patients into the two groups. Two-tailed P value less than 0.05 was considered statistically significant.
Discussion
Increased infiltration of TAMs into NSCLC correlates with a poor prognosis [
5,
9]. However, the mechanisms for this effect remain unclear. TAM derived molecules that function to suppress immune activation, promote extracellular matrix (ECM) remodeling may play important roles in NSCLC progression.
In the present study, the rational we selected
IL-10, cathepsin B or
cathepsin S, is that they were reported to be closely associated with TAMs in recent literatures [
10‐
12,
24].
IL-10 is widely known as an potent immunosuppressive cytokine associated with cancer [
13,
25]. It is produced by a number of cells, including tumor cells and TAMs[
14,
25].
Cathepsins B, cathepsin S, proteolytic enzymes, were thought to facilitate the breakdown of basement membranes thereby promoting cancer cell invasion into surrounding normal tissues. TAM expressed
cathepsin B or
cathepsin S in pancreatic islet, breast or prostate cancer animal models. In our study, we showed, TAM expressed high levels of
IL-10, cathepsin B, but not
cathepsin S in NSCLC.
Our study suggested that increased
IL-10 expression of TAM in NSCLC patients correlated with late stage disease (stage II, III and IV), lymph node metastases, pleural invasion, lymphovascular invasion and poor differentiation. Although recent animal model studies indicated that
cathepsin B or
cathepsin S expressed by TAM play an important role in tumor progression[
10,
11], and we also found
cathepsin B upregulated in TAM, we failed to demonstrate any correlation between
cathepsin B in TAM and stage, lymph nodal metastasis, pleural invasion or differentiation in NSCLC.
TAMs are derived from blood monocytes that are attracted to a tumor by cytokines and chemokines[
14]. In the tumor microenvironment, monocytes differentiate into a distinct macrophage phenotype, which is characterized by the production of high level of
IL-10. TAM with high
IL-10 expression level may tune inflammatory responses and adaptive Th2 immunity, exhibit anti-inflammatory and tissue remodeling functions and thereby, to favor tumor progression[
14]. We demonstrated that NSCLC patients with late stage disease had a higher level of
IL-10 expression in TAM, which further supports this hypothesis.
IL-10 is a potent immunosuppressive factor that may promote lung cancer growth by suppressing macrophage function and enabling tumors to evade immunosurveillance[
26]. The potential importance of
IL-10 in cancer progression is supported by reports of an association between high
IL-10 levels in serum or in tumors and worse survival in lung cancer patients[
15]. However, other authors demonstrated that lack of
IL-10 expression by the tumor was associated with a worse survival in patients with stage I NSCLC [
16]. The reason for these conflicting results might be that, both tumor cells and stromal(including macrophage) cells can secrete
IL-10. Additionally, Wagner S et al identified that macrophage was the major source of
IL-10 in gliomas[
27]. So it is important to isolate TAM from tumor cells to study the role of
IL-10 in the progression of cancer. In our study, we demonstrated the phenotype of isolated TAM was closely associated with clinicopathological features. We can predict tumor size, lymph nodal metastasis and pleural invasion through.
IL-10 expression in isolated TAM. We also found that the high expression of
IL-10 in TAM was associated with poorly differentiation, which highlighted a significance role of
IL-10 secreted by TAM in tumor aggressiveness.
A crucial step of cancer invasion and metastasis is the destruction of basement membrane by proteases. Recent studies showed invasion of cancer cell is increased by the proteases secreted from TAMs.
Cathepsin B or
cathepsin S has been implicated in the progression of various human cancers, including bladder, breast, prostate and lung cancers [
17,
28‐
30]. The cellular source of this protease in human cancers, consisting of both tumor cells and stromal cells (e.g., fibroblasts, endothelial cells, and TAMs), has remained elusive. Studies using animal models have demonstrated that TAMs are the primary source of high levels of
cathepsin B or
cathepsin S in prostate, pancreatic islet cancers, and mammary tumors, and its expression by TAMs plays critical roles in multiple stages of tumor growth and metastasis[
10,
12,
29]. Our studies demonstrated that TAM isolated from NSCLC overexpressed
cathepsin B but not
cathepsin S, and the
cathepsin B levels were not associated with NSCLC stage, lymph metastasis, lymphovascular invasion or histological differentiation.
Authors' contributions
RW and ML designed and performed the experiment and prepared the manuscript. HQC and JZ supervised the project. YQ, SFC, XYL acquired their authorship for assistance in collecting samples and analyzing data. All authors have read and approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.