Background
Materials and methods
Study subjects and peripheral blood samples
Characteristics | HCC n(%) | CHB n(%) | HEAL n(%) | P value | |
---|---|---|---|---|---|
n = 392 | n = 344 | n = 372 | |||
Age | <55 | 252(64.3) | 223(64.8) | 245(65.9) | 0.90 |
≥55 | 140(35.7) | 121(35.2) | 127(34.1) | ||
Gender | Male | 345(88.0) | 267(77.6) | 306(82.3) |
0.001
|
Female | 47(12.0) | 77(22.4) | 66(17.7) | ||
Alcohol abuse | Absent | 75(19.1) | 44(12.8) | 31(8.3) |
<0.001
|
Present | 317(80.9) | 300(87.2) | 341(91.7) | ||
Cirrhosis | Absent | 50(12.8) | 331(96.2) | 372 | |
Present | 342(87.2) | 13(3.8) | 0 | ||
Anti-HCV positive | 0 | 0 | 0 | ||
HBsAg positive | 364(92.9) | 344(100.0) | 0 | ||
AFP(ng/ml) | 923.3 ± 597.1 | 7.6 ± 6.9 |
<0.001
| ||
ALT(IU/L) | 51.0 ± 24.0 | 54.0 ± 41.0 | 21.0 ± 8.1 | 0.30 | |
AST(IU/L) | 36.3 ± 29.4 | 45.3 ± 34.3 | 26.1 ± 6.9 | 0.67 | |
GGT(IU/L) | 27.7 ± 23.5 | 39.4 ± 35.7 | 19.5 ± 17.1 | 0.56 | |
TBIL(μmol/L) | 16.4 ± 12.6 | 19.0 ± 7.3 | 12.1 ± 4.2 | 0.56 |
FOXP3 SNP genotyping
SNPs | PCR primers sequences | Single base extension primers sequences |
---|---|---|
rs2280883 | F: ACGTTGGATGAGATGAAGGAGTTGGGATGG | GACAAGGAAAGGTTGGGAA |
R: ACGTTGGATGTGTCAATACACCCCCAACTG | ||
rs3761549 | F: ACGTTGGATGACCCCACAGGTTTCGTTCC | AGTTTCGTTCCGAGAACT |
R: ACGTTGGATGACATCACCTACCACATCCAC |
Statistical analysis
Results
The distribution of demographic and clinical characteristics of all donors
The analysis of FOXP3 SNPs allele frequency in all donors
SNPs | HCC n(%) | CHB n(%) | HEAL n(%) | HCC-HEAL | CHB-HEAL | HCC-CHB | |||
---|---|---|---|---|---|---|---|---|---|
n = 392 | n = 344 | n = 372 | OR(95% CI) | P value | OR(95% CI) | P value | OR(95% CI) | P value | |
Allele | |||||||||
rs2280883 | 0.20 | 0.54 | 0.06 | ||||||
C | 134(17.1) | 144(20.9) | 146(19.6) | 0.84(0.65-1.10) | 1.07(0.87-1.31) | 0.78(0.60-1.01) | |||
T | 650(82.9) | 544(79.1) | 598(80.4) | 1.18(0.91-1.54) | 0.98(0.93-1.04) | 1.28(0.99-1.67) | |||
rs3761549 |
0.03
| 0.11 | 0.58 | ||||||
C | 630(81.2) | 549(80.0) | 554(76.5) | 1.32(1.03-1.70) | 1.05(0.99-1.11) | 1.08(0.83-1.40) | |||
T | 146(18.8) | 137(20.0) | 170(23.5) | 0.76(0.59-0.97) | 0.85(0.70-1.04) | 0.93(0.72-1.20) | |||
Genotype | |||||||||
rs2280883 |
<0.001
|
<0.01
| 0.158 | ||||||
CC | 54(13.8) | 55(16.0) | 41(11.0) | 1.29(0.84-1.99) | 1.54(0.99-2.37) | 0.84(0.56-1.26) | |||
TT | 312(79.6) | 255(74.1) | 267(71.8) | 1.53(1.10-2.14) | 1.13(0.81-1.57) | 1.38(0.98-1.95) | |||
CT | 26(6.6) | 34(9.9) | 64(17.2) | 0.34(0.21-0.55) | 0.53(0.34-0.82) | 0.65(0.38-1.10) | |||
rs3761549 |
<0.001
|
<0.001
| 0.239 | ||||||
CC | 301(77.6) | 256(74.6) | 233(64.4) | 1.92(1.39-2.64) | 1.63(1.18-2.25) | 1.18(0.84-1.65) | |||
TT | 59(15.2) | 50(14.6) | 41(11.3) | 1.40(0.92-2.15) | 1.34(0.86-2.08) | 1.05(0.70-1.58) | |||
CT | 28(7.2) | 37(10.8) | 88(24.3) | 0.24(0.15-0.38) | 0.38(0.25-0.57) | 0.64(0.39-1.08) |
The association between FOXP3 genotype and susceptibility to hepatitis B-related HCC
The stratified analysis of the association between FOXP3 genotypes and HCC clinical pathology variables
Characteristics | rs2280883 | P values | rs3761549 | P values | ||
---|---|---|---|---|---|---|
TT n(%) | CC/CT n(%) | CC n(%) | TT/CT n(%) | |||
n = 151 | n = 37 | n = 155 | n = 33 | |||
Age | 0.48 | 0.15 | ||||
<55 | 101(66.9) | 27(73.0) | 109(70.3) | 19(57.6) | ||
≥55 | 50(33.1) | 10(27.0) | 46(29.7) | 14(42.4) | ||
Gender | 0.216 | 0.33 | ||||
Male | 136(90.0) | 30(81.1) | 139(89.7) | 27(81.8) | ||
Female | 15(10.0) | 7(18.9) | 16(10.3) | 6(18.2) | ||
Alcohol abuse | 0.63 | 0.80 | ||||
Absent | 72(47.7) | 16(43.2) | 76(49.0) | 17(51.5) | ||
Present | 79(52.3) | 21(56.8) | 79(51.0) | 16(48.5) | ||
Tumor Size (cm) | 0.61 | 0.64 | ||||
≤5 | 42(27.8) | 9(24.3) | 44(28.4) | 7(21.2) | ||
>5, ≤10 | 57(37.7) | 11(29.7) | 54(34.8) | 14(42.4) | ||
>10, ≤20 | 43(28.5) | 14(37.9) | 48(31.0) | 9(27.3) | ||
>20 | 9(6.0) | 3(8.1) | 9(5.8) | 3(9.1) | ||
Tumor nodule (No.) | 0.54 | 0.48 | ||||
1 | 98(64.9) | 26(70.3) | 104(67.1) | 20(60.6) | ||
≥2 | 53(35.1) | 11(29.7) | 51(32.9) | 13(39.4) | ||
Tumor grade | 0.69 | 0.87 | ||||
I | 24(15.9) | 3(8.1) | 24(15.5) | 3(9.1) | ||
II | 24(15.9) | 6(16.2) | 24(15.5) | 6(18.2) | ||
III | 97(64.2) | 27(73.0) | 101(65.2) | 23(69.7) | ||
IV | 6(4.0) | 1(2.7) | 6(3.8) | 1(3.0) | ||
lymph node metastasis | 0.76 | 0.93 | ||||
Absent | 138(91.4) | 35(94.6) | 142(91.6) | 31(93.9) | ||
Present | 13(8.6) | 2(5.4) | 13(8.4) | 2(6.1) | ||
portal vein tumor thrombus | 0.76 |
0.02
| ||||
Absent | 119(78.8) | 30(81.1) | 118(76.13) | 31(93.94) | ||
Present | 32(21.2) | 7(18.9) | 37(23.87) | 2(6.06) | ||
Distant Metastasis | 0.59 | 0.73 | ||||
Absent | 136(90.1) | 35(94.6) | 142(91.6) | 29(87.9) | ||
Present | 15(9.9) | 2(5.4) | 13(8.4) | 4(12.1) | ||
Recurrence | 0.60 |
0.001
| ||||
Absent | 112(74.2) | 29(77.4) | 124(80.0) | 17(51.5) | ||
Present | 39(25.8) | 8(21.6) | 31(20.0) | 16(48.5) |