Introduction
The meniscus serves as a critical fibrocartilaginous tissue in the biomechanics of the knee joint, and it plays an important role in load distribution and joint stability [
1,
2]. Its biomechanical importance is further highlighted by the high incidence of osteoarthritis after menisectomy [
3‐
8]. The function of the meniscus is reflected in its cellular and biochemical composition, which ensures that shear, tensile and compressive forces are appropriately distributed in the knee joint [
9]. The meniscus exhibits regional and zonal variations in its cellular composition [
9‐
13], reparative capacity [
14,
15] and microstructure [
16,
17]. The cells of the outer one-third are fibroblast-like, with extensive cellular processes that may stain positively for CD34 and are within a dense connective tissue, which is composed predominantly of type I collagen fibre bundles aligned in the circumferential direction of the tissue, along with smaller amounts of proteoglycans and minor collagens including types III and V [
16,
18‐
21]. In contrast, cells from the middle and inner portions, accounting for the remaining two-thirds of the tissue, are with few processes [
17,
22] and are negative for CD34 [
21]. These cells have been termed fibrochondrocytes [
17] and are surrounded by an extracellular matrix that is composed of collagen types I and II [
17‐
19], with a higher content of aggrecan than in the outer region [
22‐
24]. Based on morphological differences, the cells of the tissue have been further divided into three to four distinct populations [
12].
The presence of type II collagen and aggrecan in the inner meniscus shows that this region has some similarities with articular cartilage [
18‐
20,
25]. However, the type II collagen in the meniscus is organized in a close network with collagen I fibres, which is in contrast to its diffuse fine fibre distribution in articular cartilage [
19]. Further regional differences within the meniscus include the presence of vascular and neural components in the outer meniscus, which are absent from the inner region [
15,
26]. Perhaps as a consequence of the lack of blood supply, the reparative and regeneration potential of the inner meniscus is more limited than that of the outer region [
14,
27].
Cell-based tissue engineering strategies have been proposed to aid repair and to generate a meniscus substitute for implantation [
13,
28‐
32]. Meniscus cells may be appropriate for this strategy. However, during monolayer expansion of human meniscus cells there is increased expression of type I collagen and decreased expression of type II collagen, similar to the de-differentiation in culture of chondrocytes [
13].
Several investigators have exploited low oxygen tension during
in vitro culture of chondrocytes as a strategy to restore differentiated phenotype [
33‐
37]. This stems from the fact that conventional cell culture is performed in an atmosphere containing 20% oxygen tension, whereas cartilage
in vivo, being avascular, has much lower oxygen tension (1% to 7%) [
38‐
41]. We recently showed that the matrix-forming phenotype of cultured primary human meniscus cells was enhanced in lowered oxygen (5%) [
42,
43], but the responses of cells isolated from the outer and inner regions were not investigated separately.
Recent studies have distinguished cells and tissue from the outer and inner regions of the meniscus by showing that cartilaginous marker genes, namely type II collagen and aggrecan, both exhibited significantly higher expression in cells or tissues derived from the inner region relative to cells or tissues from the outer meniscus [
23,
24].
The objective of the current investigation was to determine whether hypoxia inducible factor (HIF)-1α and downstream target genes that are involved in the adaptive response of cells and tissues to low oxygen tension were expressed differently in cells in the outer and inner regions of the human meniscus [
44‐
48]. We also wished to determine whether the cells isolated from the outer and inner meniscus in culture differed in their response to lowered oxygen tension.
Materials and methods
Human meniscus and cartilage tissue source and cell isolation
Human articular cartilage and meniscus was obtained, with informed consent and local ethical approval (Ethics Committee of South Manchester Health Care Trust), during total knee arthroplasty from seven patients (mean age 59 years, range 36 to 77 years) with osteoarthritis. The meniscus tissue was from intact samples of medial and lateral meniscus.
The tissue was cut into small pieces within 6 hours of surgery, before overnight digestion at 37°C with 0.2% (weight/vol) collagenase II (Worthington Biochemical Corp., Reading, UK) in Dulbecco's modified Eagles medium (DMEM) containing 10% foetal calf serum (FCS). In addition, fresh tissue pieces from the inner and outer regions of samples of intact lateral meniscus were digested with collagenase, as described above, or preserved in RNAlater (Qiagen Ltd, Crawley, UK) for gene expression analysis. Tissue from the inner and outer regions represented pieces taken from about two-third and one-third of the radial distance, respectively. Isolated meniscus cells were seeded in a 75 cm2 tissue culture flask at 1 × 104 cells/cm2 in a humidified atmosphere under 20% oxygen and 5% carbon dioxide at 37°C in DMEM. Cells were cultured in DMEM supplemented with 10% FCS, 100 units/ml penicillin and 100 units/ml streptomycin, with added L-glutamine (2 mmol/l; all from Cambrex, Wokingham, UK). The media was changed every 2 days, and on reaching confluence (within 2 weeks) the cells were passaged (passage one) into a 225 cm2 tissue culture flask. The cells were used in experiments at passage two or three of monolayer culture. Human chondrocytes were isolated from articular cartilage (obtained from the same individuals who donated menisci) by a sequential trypsin/collagenase digestion and also used in experiments at passage two or three of monolayer culture in DMEM with 10% FCS, 100 units/ml penicillin and 100 units/ml streptomycin (all from Cambrex, Wokingham, UK).
Three-dimensional cell aggregate culture
Aggregates of second or third passage outer and inner meniscus cells or articular chondrocytes (5 × 10
5 cells per aggregate) were formed by centrifugation at 1,200 rpm for 5 min in a 15 ml conical culture tube. The cell aggregates were cultured for 14 days in a humidified atmosphere under conditions of normoxia (95% air and 5% carbon dioxide [20% oxygen]) or hypoxia (5% oxygen, 5% carbon dioxide and 90% nitrogen) at 37°C in DMEM containing 10% FCS and chondrogenic medium. The chondrogenic medium was composed of the following [
49]: ITS+1, dexamethasone (10 nmol/l) and ascorbate-2-phosphate (25 μg/ml; all from Sigma, Poole, UK), and transforming growth factor-β
3 (10 ng/ml; R&D Systems, Abingdon, UK).
Meniscus cell incubation with hypoxia inducible factor-1α inhibitor (YC-1)
Cells cultured from whole meniscus at passage two were seeded onto a 12-well plate in DMEM with 10% FCS at 1 × 104 cells per well. The cells were allowed to adhere overnight under normoxia. HIF-1α inhibitor, namely 3-(5'-hydroxymethyl-2'furyl)-1-benzyl indazole (YC-1; Calbiochem, Nottingham, UK), in dimethylsulphoxide was added to DMEM with FCS at a final concentration of 1 to 50 μmol/l and incubated with meniscus cells for 5 days under normoxic and hypoxic conditions. Control monolayer cultures were incubated with DMEM containing FCS and vehicle alone (dimethylsulphoxide; 0.6% vol/vol). The growth medium was changed every 2 days.
Gene expression analysis
Total RNA was prepared from meniscus tissue, monolayer cells and cell aggregate cultures using Tri-Reagent (Sigma, Poole, UK). To minimize changes in gene expression, cultures caps were closed before removal from the low oxygen tension incubator, and cell aggregates were immediately (<1 min) transferred into Tri-Reagent. Total RNA from fresh tissue was isolated after homogenization with a Braun mikrodismembranator (Biotech, Melsungen, Germany). Cell aggregate cultures were ground up in Tri-Reagent using Molecular Grinding Resin (Geno Technology Inc, St Louis, MO, USA). For gene expression analysis, cDNA was derived from 10 to 100 ng total RNA using global amplification [
50]. Samples were diluted 1:1000 and a 1 μl aliquot was amplified by polymerase chain reaction in a 25 μl reaction volume in an MJ Research Opticon 2 real-time thermocycler using a SYBR Green Core Kit (Eurogentec, Seraing, Belgium) with gene-specific primers designed using ABI Primer Express software (Applied Biosystems, Foster City, CA, USA). Relative expression levels were normalized to β-actin mRNA expression and calculated using the 2
-ΔCt method [
51]. All primer concentrations were 300 nmol/l unless stated otherwise. All primers were from Invitrogen (Paisley, UK) and were designed based on human sequences as summarized in Table
1.
Table 1
Primers used in the present study
β-actin | Forward 5'-3' AAGCCACCCCACTTCT-CTCTAA |
| Reverse 5'-3' AATGCTATCACCTCCCCTGTGT |
COL1A2 | Forward 5'-3'TTGCCCAAAGTT-GTCCTCTTCT |
| Reverse 5'-3' AGCTTCTGTGGAACCATGGAA |
COL2A1 | Forward 5'-3' CTGCAAAATAAAATCTCGGTGTTCT |
| Reverse 5'-3' GGGCATTTGACTCACACCAGT |
HIF-1α | Forward 5-3' GTAGTTGTGGAAGT-TTATGCTAATATTGTGT |
| Reverse 5'-3' CTTGTTTACAGTCTGCTCA-AAATATCTT |
P4Hα(I) | Forward 5'-3' GCAGGGTGGTAATATTGGCATT |
| Reverse 5'-3' AAATCAATTCCCTCATCACTGAAAG, |
P4Hα(II) | Forward 5'-3'TTAGCTGTCTAGCGCCTAGCAA |
| Reverse 5'-3' TTTGGTTCACTGAAACA-TCTCACA |
P4Hα(III) | Forward 5'-3' CTCAACAGTCTCAGGTTCGATCA |
| Reverse 5'-3' TTCTTGGTCCCTGTGGTCAAG |
PHD2 | Forward 5'-3'TGGCC-TATATGTGTTTAATCCTGGTT |
| Reverse 5'-3'TGTTTTACAGCTGGTTAATGTG-TTGA |
SOX9 | Forward 5'-3'CTTTGGTTTGTGTTCGTGTTTTG |
| Reverse 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTT |
Discussion
The lack of vasculature in the inner meniscus suggests that the resident cells exist in a hypoxic environment relative to meniscus cells in the outer meniscus. The results of the gene expression analysis provide new data on region-specific differences in mRNA expression in a panel of genes that are susceptible to transcriptional regulation by HIF-1α in human meniscus. Furthermore, it supports the use of gene expression to distinguish tissues and cells from different regions of the meniscus. In addition, the study provides, for the first time, data on the response of cells isolated from the inner and outer meniscus regions to low oxygen tension in culture. It was interesting that cells isolated from the outer meniscus were relatively more responsive to 5% oxygen tension than were inner meniscus cells, based on the large modulation in gene expression of collagen types I and II, SOX9 and P4Hα(I). Furthermore, it was particularly interesting that in contrast to the response of outer meniscus cell aggregates, increased SOX9 expression did not accompany the upregulated expression of type II collagen in aggregate culture of inner meniscus cells in 5% oxygen tension.
The level of type II collagen expression in aggregate culture of inner meniscus cells at 20% oxygen tension is consistent with previous reports [
19,
23,
24], which found that the inner meniscus exhibits a more chondrocytic phenotype than does the outer meniscus. The differential induction of SOX9 seen here in response to low oxygen tension suggested that SOX9 is a necessary transcription factor of type II collagen synthesis, but that it acts in conjunction with other factors, such as SOX5 and SOX6, which are known enhancers of SOX9 [
55,
56]. It also suggests that increased SOX9 expression does not always correlate with type II collagen expression, and this is consistent with the findings of a previous report in articular chondrocytes [
57]. Nevertheless, there were unquestionable differences between the responses of aggregate cultures of articular chondrocytes and meniscus cells (regardless of the region of cell isolation) to 5% oxygen tension. The expression of the genes studied here was clearly not modulated in aggregate cultures of articular chondrocytes by 5% oxygen tension. This may therefore reflect a greater sensitivity of meniscus cells to oxygen tension. Naturally, articular chondrocytes exist in a completely avascular microenvironment, and an oxygen tension lower than 5% may be required to elicit an hypoxic response in these cells.
This study shows that P4Hα(I) was induced by 5% oxygen tension in aggregate culture of meniscus cells, regardless of the region of origin. In contrast, aggregate cultures of articular chondrocytes exhibited no comparable induction of P4Hα. Furthermore, the upregulation of P4Hα(I) suggested that the response of meniscus cells to low oxygen tension is mediated by HIF-1α [
52], and this was confirmed by its inhibition by the HIF-1α inhibitor YC-1 [
53,
54]. Previous studies have demonstrated YC-1 to block the expression of HIF-1α and HIF-1α regulated genes in the presence of soluble guanylyl cyclase inhibitors [
54]. This strongly suggests that soluble guanylyl cyclase/cGMP signal transduction does not mediate the HIF-1α induction of P4Hα(I).
To determine whether the
in vitro response of meniscus cells to hypoxia was relevant to their behaviour
in vivo, we analyzed intact meniscus tissue and found higher expression of HIF-1α, P4Hα(I) and PHD2 in the inner region of the meniscus tissue as compared with the outer region. The pattern of expression correlated with the reported lower vascularity of the inner meniscus and a potentially more hypoxic microenvironment. The differential level of the constitutive expression of HIF-1α and its target genes between the meniscus regions may thus reflect a mechanism that regulates the matrix-forming phenotype of the inner meniscus. The differential expression of HIF-1α seen here is of particular interest, because the action of HIF-1α is modulated at the post-translational level. Furthermore, HIF-1α has been shown to bind to CREB (cAMP-response element-binding protein)-binding protein/p300, which SOX9 utilizes to exert its cartilage-specific type II collagen gene promoter activity [
58,
59]. These results suggest that the combination of the upregulation of SOX9, which activates type II collagen transcription in chondrogenic cells, and low oxygen induced upregulation of P4Hα(I) may enhance the expression of type II collagen in human meniscus cells.
Conclusion
We demonstrate for the first time that cells isolated from the outer and inner regions of the meniscus respond differentially to lowered oxygen tension (5% oxygen). Based on the large modulation in gene expression of the panel of genes (collagen types I and II, SOX9 and P4Hα(1)) investigated in this study, it appears that cells from the outer meniscus are relatively more responsive to lowered oxygen tension than are their inner counterparts. Furthermore, the results show gene expression analysis to be a powerful tool in distinguishing tissue or cells from the outer and inner meniscus, and further extend the repertoire of genes that are constitutively and differentially expressed within specific regions of the meniscus. Most importantly, our findings revealed that HIF1α and downstream target genes PHD2 and P4Hα were upregulated in the inner meniscus relative to the outer meniscus, and that the response of meniscus cells (regardless of the region of cell isolation) to 5% oxygen tension was mediated by HIF-1α. Collectively, our data suggest that hypoxia driven expression of HIF-1α may be important in determining the phenotype of the inner meniscus.
Acknowledgements
We should like to thank Drs Kaye Williams and Rachel Cowen (School of Pharmacy and Pharmaceutical Sciences, University of Manchester, UK) for technical advice on the YC-1 studies, and Drs Ann Canfield and Simon Tew (UKCTE, University of Manchester) for access to the hypoxia incubator and for discussion. This work was supported by grants from the European Framework V Program (Meniscus Regeneration Project Contract GRD-CT-2002-00703).
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
ABA conceived, designed and executed the experiments described in this study, and was responsible for writing the initial versions of the manuscript. LMG and SJMS performed RNA isolation and cell culture experiments included in this manuscript. WSK was responsible for tissue procurement and processing. DMS and TEH supervised and oversaw the completion of the studies as well as the writing of the manuscript.