Introduction
There are currently two known receptors for CXCL12: CXCR4 and CXCR7 [
1,
2], which belong to the family of G-protein coupled receptors (GPCRs). CXCR4 is expressed in several human cancers including glioma [
3], neuroblastoma [
4], pancreatic [
5] and breast [
6], with overexpression of CXCR4 in breast cancer correlating with poor patient prognosis [
7‐
9]. CXCL12/CXCR4 signaling has been reported to stimulate growth of several tumors including breast [
10‐
13], with carcinoma-associated fibroblasts (CAFs) being an important source of CXCL12 in the tumor microenvironment [
14]. CAFs can enhance tumor growth in a paracrine manner, with secreted CXCL12 directly stimulating growth of CXCR4 expressing breast cancer cells, and in an endocrine manner, recruiting endothelial progenitor cells (EPCs) to the primary tumors, thus enhancing angiogenesis [
15]. CXCL12, also known as SDF-1, belongs to the CXC family of chemokines. CXCL12 functions as a growth factor for B cell progenitors [
16], a chemotactic factor for both T cells and monocytes, a regulator of hematopoiesis and as a chemoattractant for tissue-committed stem cells [
17,
18]. Importantly, CXCL12 has been found to be expressed in many human solid tumors including breast, pancreas and prostate cancers, and glioblastoma [
17], with high levels of CXCL12 expression correlating with poor prognosis of breast cancer patients [
19].
CXCL12/CXCR4 signaling has been shown to stimulate the chemotactic and invasive behavior of breast cancer cells
in vitro and
in vivo [
6,
10,
19‐
21], and has been proposed to serve as a homing mechanism for cancer cells to sites of metastasis. CXCL12 is expressed at high levels in the bone marrow, lung, liver, and lymph nodes, common sites of breast cancer metastasis, with protein extracts from these organs stimulating chemotaxis of breast cancer cells in a CXCR4-dependent manner [
6]. Furthermore, downregulation of CXCR4 signaling using a neutralizing antibody or miRNA, decreases spontaneous and experimental lung metastasis formation of MDA-MB-231 cells [
6,
20].
Like CXCR4, CXCR7 is also expressed in different human cancers, including breast, being highly expressed in the tumor vasculature [
22,
23]. CXCR7 is considered an atypical GPCR because ligand binding does not result in intracellular Ca
2+ release [
2,
24], and there are conflicting reports on the ability of CXCR7 to activate phosphatidylinositol 3-kinase (PI3K) or mitogen-activated protein kinase (MAPK) signaling, and to promote cell motility. Binding of CXCL12 or interferon-inducible T-cell alpha chemoattractant (I-TAC/CXCL11), the other known CXCR7 ligand, to CXCR7 activates PI3K and MAPK signaling in astrocytes, Schwann cells, gliomas, rhabdomyosarcoma, and pancreatic cancer cells [
23‐
26]. Moreover, CXCR7 has been reported to mediate CXCL12 chemotaxis in T cells [
1] and rhabdomyosarcoma cells [
26], and to promote hepatocellular carcinoma invasion
in vitro [
27]. However, other studies have shown that CXCR7 does not play a role in bare filter migration but in transendothelial migration [
28], and that CXCR7 plays no role in T cell chemotaxis or MAPK/PI3K signaling [
29]. Although the interaction of CXCR7 with G proteins is controversial, new studies have found that CXCR7 binds to β-arrestin 2, with this interaction resulting in receptor internalization [
28,
30,
31], and mediating chemotaxis to I-TAC in vascular smooth muscle cells [
32]. Furthermore, CXCR4 and CXCR7 can form both homodimers and heterodimers with heterodimer formation suggested to modulate CXCR4 signaling both positively, and negatively [
33‐
35]. Most recently, CXCR4+CXCR7+ MDA MB 231 cells have been shown to chemotax in response to CXCL12 stimulation better than 231 cells expressing only CXCR4, with this chemotactic response being dependent on β-arrestin 2 [
36].
CXCR7 has been implicated in enhancing cancer cell adhesion to fibronectin and endothelial cells [
2,
23,
27]; increasing cell survival by decreasing apoptosis [
2,
23] and promoting primary tumor growth of lymphoma, lung, breast, prostate and hepatocellular cancer cells [
2,
22,
23,
27]. CXCR7 expression has been reported to contribute to tumor angiogenesis through the secretion of angiogenic factors such as vascular endothelial growth factor (VEGF) [
23,
27], as well as to promote experimental metastasis formation of breast cancer cells [
22].
Although CXCL12 signaling has been implicated in breast cancer metastasis as a homing mechanism for cancer cells to common sites of metastasis, not much is currently known about the role of CXCL12 signaling in the early steps of metastasis within the primary tumor. Also, the role of CXCR7 in breast cancer cell motility, tumor growth and metastasis is still unclear, with the effect of coexpression of CXCR4 and CXCR7 in these processes mostly unknown. With research suggesting that both CXCR4 and CXCR7 alone can enhance metastasis, we set out to dissect the roles of CXCR4 and CXCR7 in the different steps of metastasis (invasion, intravasation, and metastasis formation) by overexpressing CXCR4, CXCR7, or both receptors in the rat mammary adenocarcinoma cell line MTLn3. Here we report that CXCR4 overexpression increases the chemotactic and invasive behavior of MTLn3 cells, in vitro and in vivo, to CXCL12, as well as their motile behavior within the primary tumor. Furthermore, although CXCR4 overexpression had no effect on primary tumor growth, it enhanced intravasation without affecting spontaneous lung metastasis formation. CXCR7 overexpression alone did not result in CXCL12-induced chemotaxis or invasion in vitro; however, in the context of high CXCR4 expression it further increased the in vitro chemotactic response of MTLn3 CXCR4 cells to CXCL12, while reducing invasion and matrix degradation. In vivo, CXCR7 increased primary tumor growth while it impaired invasion to CXCL12, intravasation and spontaneous lung metastasis formation. CXCR7 overexpression downregulated the effects of CXCR4 in motility within the primary tumor, intravasation, and spontaneous lung metastasis formation.
Materials and methods
Cell lines
All MTLn3 cell lines were grown in alpha MEM supplemented with 5% FBS (100-106; Gemini Bio-Products, West Sacramento, CA, USA) and 0.5% penicillin/streptomycin (15140-122; Invitrogen, Grand Island, NY, USA). To create the human CXCR4 expressors, hCXCR4 was transferred from the pDNR-Dual hCXCR4 vector (Harvard Institute of Proteomics, Boston, MA, USA), to the JP1520 retroviral vector following the Creator Cloning protocol, using Cre recombinase (Clontech, Mountain View, CA, USA) and Max Efficiency DH5alpha bacteria (Life Technologies, Grand Island, NY, USA) grown in 7% sucrose, 30 μg/ml chloramphenicol plates. Colonies were picked and correct insertion of human CXCR4 verified by sequencing. The human CXCR7 sequence was digested out from the pcDNA 3.1+ plasmid (kindly provided by ChemoCentryx, Mountain View, CA, USA) using NotI, the ends blunted using DNA Polymerase I, large Klenow fragment (NEB, Ipswich, MA, USA), to insert into JP1520, which was digested with BamHI and BbsI removing the loxP site, ends blunted as above and treated with Antarctic phosphatase (NEB, Ipswich, MA, USA). Both insert and vector were gel purified using the Qiagen Gel extraction kit, then ligated using a Rapid DNA Ligation kit (Roche, Branchburg, NJ, USA). Subcloning efficiency DH5alpha bacteria (Life Technologies, Grand Island, NY, USA) were transformed with the ligated vector and colonies screened for correct insertion of hCXCR7 using differential enzyme digestions, followed by verification using sequencing analysis. MTLn3-GFP (MTLn3 cells expressing green fluorescent protein) cells were transduced with either the empty JP1520 vector, JP1520-CXCR4, JP1520-CXCR7, or both CXCR4 and CXCR7, by first transfecting Phoenix packaging cells with 2 μg of each vector using lipofectamine (Invitrogen, Grand Island, NY, USA), collecting virus and transducing MTLn3-GFP cells seeded at 60% confluency. Transduced cells were selected with 1 μg/ml puromycin. MTLn3 CXCR7 and MTLn3 CXCR4-CXCR7 cells were subsequently fluorescence-activated cell sorting (FACS) sorted in a DakoCytomation MoFlo to obtain a homogenous population of CXCR7 expressing cells. MDA MB 435 cell lines were grown in DMEM (10-013 CV, Cellgro, Manassas, VA, USA) supplemented with 10% FBS (S11550, Atlanta Biologicals, Lawrenceville, GA, USA) and 0.5% penicillin/streptomycin. 435 cells seeded at 60% confluency, were transduced with either the empty JP1520 vector, JP1520-CXCR4 or JP1520-CXCR7 using premade virus, with transductants selected using 1 μg/ml puromycin. MDA MB 435 CXCR7 cells were FACS sorted in a DakoCytomation (Carpinteria, CA, USA) MoFlo to obtain a homogenous population of CXCR7 expressing cells. The 435 double overexpressors, CXCR4-CXCR7, were made by transducing sorted 435-CXCR7 cells with JP1520-CXCR4 virus and then FACS sorted for high CXCR4 expression. MDA MB 435 CXCR4 cells were sorted at the same time to obtain cell lines with homogenous CXCR4 expression.
Reverse transcription and PCR
MTLn3 cells grown to 70 to 85% confluency were used for RNA isolation using the Qiagen RNeasy Mini kit with DNase I treatment (Valencia, CA, USA). A 1 μg sample of total RNA was used for reverse transcription using Superscript III and random hexamers in a 20 μl reaction volume. A 2 μl aliquot of the reaction was used for PCR using Taq polymerase for 30 cycles. Primers used were: rat glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (PPR06557A Superarray), rat CXCR4 (5' AGGAACTGAACGCTCCAGAA 3' and 5' AACCACACAGCACAACCAAA 3'), human CXCR4 (5' CTCCAAGCTGTCACACTCCA 3' and 5' TCGATGCTGATCCCAATGTA 3'), human and rat CXCR7 (5' GCACTACATCCCGTTCACCT 3' and 5'AAGGCCTTCATCAGCTCGTA 3'). PCR products were run in a 1.5% agarose gel containing ethidinium bromide. For quantitation of endogenous expression of rat CXCR4, the collected cDNA was used for quantitative real-time PCR with SYBR Green (PA-012, SuperArray Biosciences, Frederick, MD, USA) and an Applied Biosystems 7900HT (Carlsbad, CA, USA). To evaluate the expression of matrix metalloproteinases (MMPs) in the different MTLn3 transductants, the cell lines were grown to 80 to 90% confluency in six-well plates, starved overnight in alpha-MEM/0.35% BSA in a 37°C incubator, and then stimulated for four hours with 10 nM CXCL12 (460-SD; R&D systems, Minneapolis, MN, USA) in alpha-MEM/0.35% BSA or just alpha-MEM/0.35% BSA at 37°C. RNA was extracted using the Qiagen RNeasy Mini kit with DNase I treatment. A 2 μg sample of total RNA was used for reverse transcription using a Superscript First Strand kit (11904-018, Invitrogen, Grand Island, NY, USA) and cDNA used for real time PCR with SYBR Green (PA-012) on an Applied Biosystems 7900HT. Rat specific primers for MMPs were obtained from real-time primers (Elkins Park, PA, USA). RNA expression of MMPs was normalized to GAPDH.
Fluorescent activated cell sorting (FACS)
To analyze the levels of CXCR4 and CXCR7 expression in the MTLn3 and MDA MB 435 cell lines, cells were grown to 80% confluency, detached at 37°C using PBS without Ca2+/Mg2+ +2 mM ethylenediaminetetraacetic acid (EDTA) and resuspended in 1 ml cold PBS without Ca2+/Mg2+ supplemented with 0.2% BSA. Cells were labeled with either control mouse IgG antibody (MAB002; R&D systems, Minneapolis, MN, USA), anti-human CXCR4 antibody (MAB172; R&D systems, Minneapolis, MN, USA) or anti-human CXCR7 antibody (11G8; ChemoCentryx, Mountain View, CA, USA) for 45 minutes at 4°C. Unbound primary antibody was removed by washing and bound antibody was detected with APC antimouse secondary antibody (Jackson ImmunoResearch, West Grove, PA, USA). Expression of rat CXCR4 protein was evaluated in the MTLn3 transductants using a rat specific CXCR4 antibody (ab7199, Abcam, Cambridge, MA, USA) with a rabbit IgG as a control (011-000-003, Jackson ImmunoResearch, West Grove, PA, USA) and anti-rabbit DyLight 649 as the secondary antibody (111-496-144, Jackson ImmunoResearch, West Grove, PA, USA). Fluorescently labeled cells were evaluated using a Becton Dickinson LSRII (Franklin Lakes, NJ, USA). FCS files were analyzed using FlowJo software (Ashland, OR, USA).
In vitro chemotaxis
Chemotaxis was evaluated using a 48-well microchemotaxis chamber (Neuroprobe, Gaithersburg, MD, USA) and PVP-free 8 μm pore polycarbonate filters (Neuroprobe, Gaithersburg, MD, USA) coated with 27 μg/ml rat tail collagen type I (BD Bioscience, Franklin Lakes, NJ, USA). Cell lines were starved in L15 medium supplemented with 0.35% BSA for three hours at 37°C, detached using PBS without Ca2+/Mg2+ + 2 mM EDTA and resuspended in L15-0.35% BSA to plate 2 × 104 cells per well for MTLn3 transductants, or 1.5 × 104 cells per well for the MDA MB 435 transductants. CXCL12 solutions were prepared in L15-0.35% BSA and placed in the bottom wells with cells plated in the top wells of the assembled chamber. To inhibit CXCL12 binding to CXCR7, we added 10 nM I-TAC (572-MC; R&D systems, Minneapolis, MN, USA), or used the CXCR7 inhibitors CCX733 (ChemoCentryx, Mountain View, CA, USA) and CCX771 (ChemoCentryx, Mountain View, CA, USA) added to both top and bottom wells, including vehicle (DMSO) as a control. To inhibit CXCR4, we added AMD3100 (Sigma, St. Louis, MO, USA) to both top and bottom wells. After a four-hour incubation at 37°C, filters were placed in 10% formalin solution to fix the cells for 30 minutes, cells on the top of the filter, non-migrating cells, were removed using a cotton swab, and migrating cells subsequently stained overnight in hematoxylin. The number of cells crossing the filter in one representative 10× field was counted per well for the MTLn3 transductants, using a Nikon Labophot light microscope (Melville, NY, USA), and corresponding wells averaged per experiment. To determine MDA MB 435 chemotaxis, the number of cells that crossed each well were counted and corresponding wells averaged per experiment.
In vitro invasion
MTLn3 transductants grown to 70 to 85% confluency were starved for three hours in alpha-MEM supplemented with 0.35% BSA in a 37°C incubator. Cells were detached using PBS without Ca2+/Mg2+ containing 2 mM EDTA, resuspended in alpha-MEM supplemented with 0.35% BSA to plate 1 × 105 cells in a 500 μl volume on top of Matrigel-precoated 8 μm pore-filters (354480; BD Biosciences transwells, Franklin Lakes, NJ, USA) that had been equilibrated for one hour with alpha-MEM/0.35% BSA in a 37°C incubator. Cells were allowed to invade overnight in a 37°C incubator in response to either alpha-MEM/0.35% BSA alone or containing 10 nM CXCL12. The filters were fixed in 10% formalin for 30 minutes and stained with crystal violet for 15 minutes. Cells that had not invaded were removed with a cotton tip applicator from the top of the filter, filters removed, placed in a coverslip and the total number of invading cells present in a filter counted using a Nikon Labophot light microscope with a 10× objective.
Matrix degradation assay
MTLn3 CXCR4 or MTLn3 CXCR4-CXCR7 GFP labeled cells were plated overnight on MatTek dishes, at 1 × 10
5 cells/dish, over a thin Alexa 405-gelatin matrix in the presence of the protease inhibitor GM6001 (10 μm). Cells were subsequently starved for three hours, washed three times in starvation media [
37] and stimulated with 5 nM CXCL12 for six hours. At the end of the incubation time, cells were fixed in 3.7% paraformaldehyde and imaged. The images were processed using the ImageJ Spot enhancing filter 2D (3.0 pixels Gaussian filter) and the threshold levels set to select only degradation areas. The degradation area was normalized to the cell coverage area in the GFP channel. Alexa405 (A30000, Invitrogen, Grand Island, NY, USA) was conjugated to gelatin (G2500, Sigma, St. Louis, MO, USA) and thin matrix Alexa405-gelatin matrix was prepared as previously described [
38]. Results are reported as the degraded area/cell area per field normalized to the MTLn3 CXCR4 unstimulated levels.
In vivo invasion
All animal procedures were conducted observing the National Institutes of Health regulations on the use and care of experimental animals. Our animal protocol was approved by the Albert Einstein College of Medicine animal use committee. Female severe combined immunodeficiency (SCID) mice aged four to seven weeks from NCI were used for all experiments. To form primary tumors, MTLn3 transductants grown to 70 to 85% confluency were detached using PBS without Ca
2+/Mg
2+ + 2 mM EDTA, resuspended in cold PBS supplemented with 0.2% BSA to inject 5 × 10
5 cells per animal in a 100 μl volume. Cells were injected into the fourth mammary fat pad and tumors allowed to grow until they reached an average volume of 1,300 mm
3 for the
in vivo invasion assay. Mice were anesthetized using isoflurane and blocking needles placed into the primary tumors using micromanipulators (MN-151; Narishige, East Meadow, NY, USA). Hamilton 33 gauge needles were loaded with a mixture of EDTA, 10% matrigel and CXCL12 dissolved in L15-0.35% BSA, and these experimental needles used in place of the blocking needles after the animal was appropriately setup. Detailed information about this assay can be found in [
39]. To block the colony stimulating factor 1 (CSF-1) receptor on the mouse tumor associated macrophages we used the anti-mouse CSF-1R antibody (AFS98) [
40] at 15 μg/ml; to block epidermal growth factor (EGF)-derived from the mouse tumor associated macrophages from binding to EGF receptor (EGFR) we used a neutralizing EGF antibody at a concentration of 20 μg/ml (AF2028; R&D systems, Minneapolis, MN, USA). An isotype IgG antibody (012-000-007 or 111-005-144, Jackson ImmunoResearch, West Grove, PA, USA) was used at the same concentration as the blocking/neutralizing antibodies as a control. To inhibit CXCR4 we used 100 nM AMD3100. Cells were allowed to invade into the needles for four hours and the contents of the needles were subsequently extruded into coverslips, invasive cells stained with 4',6-diamidino-2-phenylindole (DAPI) and counted using an Inverted Olympus IX70 microscope (Center Valley, PA, USA).
Intravital imaging
Primary tumors of an average volume of 1,300 mm
3 were used for intravital imaging. Mice were anesthetized with isoflurane and a skin-flap surgery carefully performed to expose the primary tumor while minimizing damage to tissue and blood vessels. Animals were placed on the stage of an inverted microscope and the GFP-labeled carcinoma cells imaged using an Olympus Fluoview FV1000-MPE microscope (Center Valley, PA, USA) at an excitation of 880 nm with a 25 × 1.05 NA water objective. Collagen fibers were visualized by second harmonic generation. Time-lapse Z-series were taken at 5 μm steps for a total of 100 μm into the tumor over 30 minutes at two-minute intervals. Movies were analyzed using Image J
http://imagej.nih.gov/ij/. A cancer cell was considered to be motile when it had protruded/translocated at least half a cell length, and the total number of motile cancer cells in a 50 μm Z-stack time-lapse movie was determined. A more detailed description of this protocol can be found in [
41].
Primary tumors were allowed to grow until they reached an average volume of 1,500 mm3 to perform end-point metastasis assays. At this time, mice were anesthetized using isoflurane and blood collected via cardiac puncture from the right side of the heart to obtain cancer cells that had intravasated. The blood drawn was then plated into a 10 cm dish with alpha MEM supplemented with 5% FBS/0.5% P/S, and cancer cell colonies allowed to grow for a week in a 37°C incubator followed by counting using a light microscope. Tumor blood burden is reported as the total number of cancer cell colonies present in a dish normalized to the volume of blood plated. Lungs and primary tumors were harvested and fixed in 10% formalin solution. The lungs were paraffin-embedded, sectioned and stained with H&E to count the number of lung metastasis present in all lobes of a single section using a light microscope with a 10× objective. To evaluate lymph node metastasis, both axillary and inguinal lymph nodes were removed from tumor-bearing mice, fixed in 10% formalin solution, paraffin-embedded, sectioned and stained with H&E. The presence of metastases was assessed using a Nikon Labophot light microscope (Melville, NY, USA). To estimate bone marrow metastasis, the femur ipsilateral to the site of primary tumor growth was dissected and bone marrow was flushed using 1 ml syringes with 25-gauge needles into a 10 cm plate containing alpha MEM supplemented with 5% FBS/0.5% P/S. Plates were incubated at 37°C for a week and tumor colonies then counted.
Immunohistochemistry
For microvessel density evaluation, formalin-fixed, paraffin-embedded sections from MTLn3 JP, MTLn3 CXCR4, MTLn3 CXCR7, and MTLn3 CXCR4-CXCR7 primary tumors were deparaffinized, rehydrated, blocked in donkey serum and stained with rat antimouse CD34 antibody (CL8927AP; Cedarlane labs, Burlington, NC, USA) at a 1:400 dilution for one hour. Slides were washed and subsequently stained with a biotinylated antirat secondary antibody for 50 minutes. The slides were rinsed and exposed to ABC-HRP (PK-6100, Vector, Burlingame, CA, USA) for 20 minutes, washed and exposed to diaminobenzidine (DAB) for one to four minutes (SK-4100, Vector, Burlingame, CA, USA), and subsequently counterstained with Harris hematoxylin (s212, Poly-scientific, Bay Shore, NY, USA), rinsed and mounted. Mean vessel density was determined by counting the number of blood vessels present per field seen in a light microscope using a 10× objective. A total of three different primary tumors were used per cell line, counting five fields per tumor. For VEGFA evaluation, samples for immunohistochemistry (IHC) were sectioned at 5 μm, deparaffinized in xylene followed by graded alcohols. Antigen retrieval was performed in 10 mM sodium citrate buffer at pH 6.0, heated to 96C, for 20 minutes. Endogenous peroxidase activity was quenched using 3% hydrogen peroxide in PBS for 10 minutes. Blocking was performed by incubating sections in 5% normal donkey serum with 2% BSA for one hour. The primary antibody to VEGFA, (PAB12284, ABNOVA, Walnut, CA, USA) was used at 1:250 for 1.5 hours at room temperature. The primary species (rabbit IgG) was substituted for the primary antibody to serve as a negative control. The sections were stained by routine IHC methods, using HRP rabbit polymer conjugate (Invitrogen, Grand Island, NY, USA), for 20 minutes to localize the antibody bound to antigen, with diaminobenzidine as the final chromogen. All immunostained sections were lightly counterstained with hematoxylin.
Statistical analysis
Analysis of variance (ANOVA) was used to demonstrate that there were significant differences between conditions when there were more than two conditions, and paired analyses were performed using either student t-test, or Mann-Whitney test in order to identify the conditions that were significantly different. Correlation of MMP12 expression with CXCR4 and CXCR7 was performed using Oncomine with the following databases: Bittner Breast, Bonnefoi Breast, Desmedt Breast, Ginestier Breast, Gluck Breast, Hess Breast, Ivshina Breast, Loi Breast, and van't Veer Breast. SPSS was used to determine correlation coefficients and their significance from the downloaded expression data. The Oncomine database was also used to identify clinical parameters with which MMP12 mRNA levels were significantly correlated. The following parameters were examined: estrogen receptor (ER) positive, triple negative, high grade, metastasis, recurrence and survival. The probabilities of overexpression or underexpression of MMP12 for all breast cancer datasets containing more than 40 samples for which the parameters were provided by Oncomine were downloaded. For each parameter, the number of datasets in which the probability of MMP12 overexpression or underexpression was less than 0.05 was identified and the binomial cumulative probability distribution was used to determine the likelihood of that number occurring by chance using SPSS (IBM, Armonk, NY).
Discussion
Previous studies have reported that both CXCR4 and CXCR7 play roles in breast cancer growth and metastasis, with both receptors being implicated in primary tumor growth, invasion and metastasis formation [
2,
6,
10,
12,
22]. However, distinguishing the roles of these receptors in the early steps of metastasis has not been performed. Using the rat mammary adenocarcinoma cell line MTLn3, we studied the effects of overexpression of CXCR4 and CXCR7 on CXCL12-induced chemotaxis and invasion, as well as
in vivo motility, intravasation and metastasis formation. We show that CXCR4 overexpression increases chemotactic and invasive behavior, both
in vitro and
in vivo, in response to a CXCL12 gradient, as well as enhances the motile behavior of tumor cells within the primary tumor and their ability to intravasate. Expression of CXCR7 alone had no effect on chemotaxis or invasion
in vitro, but suppressed CXCL12-induced invasion
in vivo, as well as intravasation and metastasis. Expression of both CXCR4- and CXCR7-enhanced chemotaxis to CXCL12
in vitro, but CXCL12-induced invasion
in vivo and
in vitro was reduced compared with that of cells expressing CXCR4 alone, and metastasis was also reduced.
The increased chemotactic response seen
in vitro upon expression of CXCR4 is consistent with many previous studies demonstrating that CXCR4 can mediate chemotaxis to CXCL12 [
47]. The literature on the ability of CXCR7 to mediate chemotactic responses is mixed, with some reports suggesting that CXCR7 can mediate chemotactic responses [
1] and others indicating that it cannot [
2,
29]. Our data are consistent with the latter studies; using two cell lines (MTLn3 and MDA-MB-435) that show little chemotactic response to CXCL12 on their own, we find that expression of CXCR7 alone does not enhance chemotactic responses to CXCL12. However, coexpression of CXCR7 and CXCR4 resulted in increased chemotaxis towards CXCL12 compared with cells expressing CXCR4 alone. These data agree with a recent study showing that increased expression of CXCR7 in MDA-MB-231 cells results in enhanced chemotaxis to CXCL12 [
36]. AMD3100, a CXCR4 selective inhibitor, inhibited CXCL12-induced chemotaxis and invasion of both MTLn3 CXCR4 and MTLn3 CXCR4-CXCR7 cells, while inhibition of CXCL12 binding to CXCR7 using I-TAC, CCX733 or CCX771 had no effect on CXCL12-induced chemotaxis. This indicates that CXCL12 binding to CXCR4 is needed for the chemotactic response but that binding of CXCL12 to CXCR7 is not necessary. The potentiation of the chemotactic response by CXCR7 is potentially through regulation of downstream signaling by CXCR4. CXCR7 has been shown to heterodimerize with CXCR4 [
33‐
35] and to regulate recruitment of β-arrestin 2, as well as enhance ERK and p38 signaling in response to CXCL12 stimulation [
36,
48]. Our results suggest that although CXCR7 has been shown to alter G
αi coupling to CXCR4 [
34], the enhancement of β-arrestin signaling by CXCR7 [
36] is more significant, resulting in enhanced chemotactic responses. It has been shown that CXCR7 can act as a scavenger receptor that internalizes CXCL12 and in that way decreases binding of CXCL12 to CXCR4 [
49,
50], therefore downregulating CXCR4 signaling. This has been proposed as a mechanism for suppression of chemotaxis to CXCL12 at low concentrations of CXCL12 [
34]. Under our chemotaxis conditions, the double overexpressors showed increased chemotactic behavior
in vitro to CXCL12 compared with the CXCR4 overexpressors even at low CXCL12 concentrations, suggesting that the scavenging function was not reducing chemotaxis
in vitro. It is possible that under our
in vitro conditions (in which there is a large volume in the attractant well, which is unlikely to be depleted during the time scale of the experiment) the scavenging function could actually increase chemotactic responses by reducing the amount of CXCL12 that leaks past the cells into the buffer side, and thereby maintaining a steeper gradient [
51].
However, we found that coexpression of CXCR7 with CXCR4 did impair CXCL12-induced invasion
in vitro of MTLn3 CXCR4 cells. CXCR7 potentially could modulate CXCR4 regulated gene expression by signaling through β-arrestin 2 [
30,
32,
34]. This might result in decreased ability to degrade extracellular matrix, which could translate into a defect in invasion but not chemotaxis. Indeed this seems to be the case as the double overexpressors showed significantly reduced matrix degradation in response to CXCL12 treatment compared with the CXCR4 overexpressors. Evaluation of MMP expression in the MTLn3 transductants showed increased MMP12 mRNA expression upon CXCL12 stimulation in the MTLn3 CXCR4 cell line compared with the other transductants including the CXCR4-CXCR7 double expressor. Although MMP3 has been reported to be induced by CXCR7 [
52], we did not observe that in the MTLn3 lines. Examination of breast cancer studies in the Oncomine database supports the possibility that CXCR4 can regulate MMP12 expression: MMP12 expression correlated significantly with CXCR4 expression, and not with CXCR7 expression. In summary, we propose that stimulation of CXCR4 can induce expression of MMP12 to increase invasiveness, and simultaneous expression of CXCR7 may suppress this induction.
The control cell line MTLn3 JP, although failing to chemotax or invade
in vitro in response to CXCL12 stimulation, showed enhanced invasion
in vivo at high concentrations of CXCL12. In addition, expression of CXCR7 alone reduced the invasion seen at high concentrations of CXCL12. As MTLn3 JP did not show chemotaxis to CXCL12 at any concentration
in vitro and we did not observe upregulation of CXCR4 expression
in vivo in this control cell line, we believe that the
in vivo invasion at high concentration is a result of stimulating macrophages (which express CXCR4 [
44‐
46]) within the tumor microenvironment, which can promote cancer cell invasion through the paracrine loop [
21]. The reduced
in vivo invasion of the CXCR7 expressing cells could be due to the scavenger function of CXCR7. For the
in vivo invasion assay, CXCL12 diffusion would be constrained in the compact microenvironment to the spaces between cells. CXCR7 expressed on the tumor cells could then scavenge CXCL12, resulting in suppression of the activation of the invasion response.
The CXCR4 overexpressing line showed a strong in vivo invasion response to CXCL12, consistent with its strong chemotaxis and invasion responses in vitro. The invasion response was mediated by the paracrine loop with macrophages, as demonstrated by inhibition of invasion by either blocking EGF or CSF1R signaling. The CXCR4-CXCR7 line showed a reduced in vivo invasion response, which could reflect a CXCR7-induced reduction in matrix degradation (as we demonstrated for in vitro invasion), scavenging of CXCL12 by CXCR7, or both.
Consistent with previous reports, overexpression of CXCR7 resulted in a small but statistically significant increase in primary tumor growth possibly due to increased angiogenesis [
22]. This was correlated with increased microvessel density and increased VEGFA expression. VEGFA has been shown to be upregulated by CXCR7 in a number of tumor cells [
23,
27,
53], and thus it is likely that the increase in VEGF in the CXCR7 expressing lines leads to increased angiogenesis and tumor growth. We did not see an effect of CXCR4 expression on primary tumor growth as previously reported in other breast cancer models [
11,
12], suggesting that this effect might be cell line specific.
The intravasation efficiencies of the various lines correlated with their
in vivo invasiveness, with the CXCR4 overexpressing lines showing significantly more intravasation than the other lines. This suggests that CXCL12 signaling could contribute to the intravasation process. Indeed, perivascular macrophages have been shown to express CXCL12 [
54], and thus a local gradient of CXCL12 leading towards blood vessels could stimulate directed invasion around vessels. Thus the CXCR7 lines, which show reduced invasion to CXCL12 gradients, would also be reduced in their intravasation capability.
A paradoxical result is our finding that CXCR4 overexpression did not result in increased spontaneous lung metastasis formation despite enhancing invasion and intravasation. This result disagrees with previous studies suggesting that wild-type or mutant CXCR4 mediates spontaneous metastasis of breast cancer cells to the lungs [
6,
55,
56]. However, in those studies, CXCR4 signaling was shown to have a significant effect on primary tumor growth (or primary tumor size was not provided), and metastasis was compared at equal times rather than equal primary tumor sizes, leaving open the possibility that the increased metastasis seen in those studies reflects the increased intravasation from a larger primary tumor. Alternatively, it is possible that the effects of CXCR4 expression on metastasis varies with the particular model used, similar to the varying effects on growth. Our results cannot be explained by impaired cell survival of intravasated cancer cells since the intravasation assay used in this study evaluated viable cells. One possibility is that there might be gene expression changes occurring in MTLn3 CXCR4 cells within the tumor microenvironment that provide an advantage in entering the circulation but impair the ability to extravasate or seed lung metastases. Indeed, MMP12, which we find upregulated in CXCR4 cells stimulated with CXCL12, has been shown to be antiangiogenic [
57‐
59]. Thus it is possible that although MMP12 is helpful in enabling tumor cells to invade, its antiangiogenic effects suppress the ability of tumor cells to extravasate and successfully seed metastases in the lung.
In summary, our studies provide insight into the complexity of the contributions of CXCR4 and CXCR7 to tumor cell invasion and metastasis. CXCR4 can enhance local invasion and intravasation due to CXCL12-induced chemotaxis and matrix degradation. The ligand scavenging function of CXCR7 may have contrasting effects on chemotaxis and invasion depending upon the diffusion constraints imposed upon CXCL12. CXCR7 can affect tumor growth through increased angiogenesis. We have identified MMP12 as a potential mediator of CXCR4-enhanced invasion, and further work will be needed to test its contributions to the different steps of metastasis.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
LH generated the cell lines, performed the in vitro chemotaxis, invasion and FACS analyses as well as all the in vivo assays and contributed to the writing of the manuscript. MM and JC performed the in vitro analysis of matrix degradation. SJC performed Western blotting for MMP12. JS contributed to the design of the experiments and writing of the manuscript. All authors read and approved the final manuscript.