Over-expression of lysophosphatidic acid receptor-2 in human invasive ductal carcinoma

In the first part of the study, mRNA expression for each LPA receptor was evaluated in 25 cases of invasive ductal carcinoma, which were surgically resected in the Department of Surgery, University of Tokyo, from 1998 to 2003, and in six samples of adjacent normal gland tissue. In the next part of the study, protein expression of LPA2 was evaluated by immunohistochemical staining in the 25 cases and an additional 59 cases of invasive ductal carcinoma, which were resected from 1992 to 1997, also in the Department of Surgery, University of Tokyo.

All of the resected primary tumours and regional lymph nodes were histologically examined by haematoxylin–eosin staining, in accordance with the International Union Against Cancer TNM classification. Several discrete histological parameters and lymph node metastasis were also examined. Oestrogen receptor levels were evaluated using enzyme immunoassay of frozen tumour specimens with cutoff levels for positivity of 5 fmol/mg protein.

The tumour tissue resected from the primary lesion and paired nontumour tissue (taken 10 cm away from the neoplasm) were immediately frozen in liquid nitrogen and kept at -80°C until extraction of RNA. Total RNA was extracted from each sample using the acid guanidine isothiocyanate/phenol/chloroform extraction method. One microgram of total RNA was reverse transcribed using a SuperScript First-Strand Synthesis System (Invitrogen Co., Carlsbad, CA, USA). The reverse transcription reaction was carried out in a total volume of 20 μl, in accordance with the manufacturer's instructions. The cDNA was stored at -20°C until use.

We used pcDNA3 vector (Invitrogen) containing LPA1, LPA2, or LPA3 as the standard cDNA for each LPA receptor [14]. cDNA for human β-actin was prepared using human colon cDNA as the template DNA and the following oligonucleotides: CCATCGAATTCACCACCATGGATGATGATATCGCCGCGCTC and AAGGTGCGGCCGCCTAGAAGCATTTGCGGTGGACGAT. The resulting DNA fragments were digested by EcoRI/NotI and ligated into pBlueScript (Strategene, La Jolla, CA, USA). The DNA sequence of cDNA prepared by RT-PCR was confirmed by DNA sequencing and used to calibrate for β-actin.

The primers used in the analysis of LPA1, LPA2, LPA3 and β-actin gene expression are given in Table 1. All the primers were designed using Primer Express software (Applied Biosystems, Foster, CA, USA). Real-time PCR reactions were conducted in an ABI PRISM 7000 (Perkin-Elmer/Applied Biosystems, Foster, CA, USA) using SYBR Green I (Perkin-Elmer) with the following profile: one step at 50°C for 2 min, one step at 95°C for 10 min, and 40 cycles at 95°C for 30 s and 60°C for 1 min. Thermocycling was done in a final volume of 20 μl containing 1 μl of cDNA sample. The ABI PRISM software constructed the calibration curve by plotting the crossing point against the logarithm of the number of copies for each calibrator. The number of copies in unknown samples was calculated by comparing their crossing points with the calibration curve. To correct for differences in both RNA quality and quantity between samples, data were normalized using the ratio of the target cDNA concentration to that of β-actin. Both RT and PCR reactions were performed in triplicate, and the mean values were calculated against against β-actin.

A peptide consisting of the carboxyl-terminal 17 amino acids of human LPA2 (335–351) was conjugated with keyhole limpet haemocyanin. The conjugate was injected into the hind foot pads of WKY/Izm rats using Freund's complete adjuvant. The enlarged medial iliac lymph nodes from the rats were used for cell fusion with mouse myeloma cell line PAI. The antibody-secreting hybridoma cells were selected by screening with enzyme-linked immunosorbent assay, immunofluorescence and Western blotting. Several clones were established. In this study, monoclonal antibody from clone 10D5 (rat IgG₁) was used for immunohistochemical staining.

Specificity of the monoclonal antibody against human LPA₂ used in the present study (clone 10D5) was confirmed as follows. HeLa cells were transfected with LPA₁-pcDNA3, LPA₂-pcDNA3, LPA₃-pcDNA3, or empty pcDNA3 vector using lipofectamine 2000 (Invitrogen). Twenty-four hours after transfection, the cells were rinsed with phosphate-buffered saline (PBS) and recovered using a cell scraper. Protein (10 μg) was separated on SDS-PAGE (12.5% polyacrylamide) and transferred onto nitrocellulose transfer membrane (Schleicher & Schuell, Einbeck, Germany). Using the enhanced chemiluminescence (ECL) method, the expression of each receptor was confirmed using anti-LPA1, anti-LPA2, or anti-LPA3 antibodies (Fig. 1).

Expression of LPA2 was examined by immunohistochemical staining using the anti-LPA2 antibody. Sections (3 μm thick) were deparaffinized in xylene, hydrated through a gradually diluted ethanol series, and heated in a microwave oven for two 7-min cycles (500 W). After being rinsed in PBS, endogenous peroxidase activity was inhibited by incubation with 0.3% hydrogen peroxide in 100% methanol for 30 min. After washing three times in PBS, nonspecific reaction was blocked by incubation with PBS containing 5% skimmed milk for 30 min at room temperature, and then the sections were incubated with normal rabbit serum for 30 min. The sections were incubated overnight at 4°C in humid chambers with the primary antibody to LPA2 at a dilution of 1/100. As negative control, anti-LPA1 monoclonal antibody (rat IgG₁), as well as control rat IgG (Nichirei, Tokyo, Japan), was used. After washing three times with PBS, the sections were incubated with biotinylated rabbit antirat immunoglobulin for 30 min. After washing again with PBS, the slides were treated with peroxidase-conjugated streptavidin for 30 min, and developed by immersion in 0.01% hydrogen peroxide and 0.05% diaminobenzidine tetrahydrochloride for 3 min, followed by light counterstaining with Mayer's haematoxylin. Immunoreactivity was assessed by two evaluators who had no knowledge of the background features. When more than half of the carcinoma cells in these fields exhibited significantly stronger staining intensity than the corresponding epithelium from normal mammary glands, these tumours were defined as having high expression of LPA2. In other tumours, most of the carcinoma cells exhibited only weak, if any, immunostaining, and, if present, the staining intensity was similar to that of normal epithelium; these tumours were thus defined as having low expression of LPA2.

The relative expression level of each LPA receptor's mRNA was quantitatively evaluated by real-time RT-PCR against that of β-actin (Fig. 2). A significant level of LPA1 mRNA was detected in both normal and carcinoma tissues, and expression levels did not differ significantly between tissues (1438.5 ± 425.5 versus 1675.3 ± 299.8). However, the expression level of LPA2 in cancer tissue was significantly greater than that in normal tissue (3479.0 ± 426.6 versus 1287.3 ± 466.8; P < 0.05). In comparison, LPA3 was weakly expressed in both normal and cancer tissue, although one cancer contained a relatively high level of LPA3 transcript. When the ratio of LPA2 to LPA1 was calculated, cancer tissue exhibited a threefold higher ratio than did normal gland tissue (3.69 ± 0.96 versus 1.12 ± 0.43; P = 0.0016).

The expression of LPA2 in the same tumours was also evaluated at the protein level by immunohistochemical staining (Fig. 3). In 15 out of 25 (60%) carcinomas, enhanced staining for LPA2 was clearly detected in comparison with normal tissue. In these carcinoma cells, LPA2 was detectable in the cytoplasm and in the cell membrane, but not in the nucleus. Some of the normal epithelium in the same specimens, as well as interstitial cells, also stained slightly, but the intensity was significantly weaker than that in carcinoma cells in the 15 tumours. Thus, these cases were categorized as tumours with high LPA2 expression. In the other 10 tumours, carcinoma cells exhibited apparently the same staining intensity as normal epithelium and were categorized as having low expression of LPA2.

When the immunoreactivity was compared with the relative ratio of LPA2 mRNA against β-actin, 11 out of the 12 tumours (92%) with ratios greater than 3000 had high expression of LPA2, whereas 10 out of 13 tumours with a ratio below 3000 had low expression (Table 1). Thus, the results of the immunohistochemical study exhibited significant correlation with the results of quantitative mRNA study in breast cancer tissue (P < 0.001).

Because LPA2 expression showed a strong correlation between mRNA and protein levels in 25 cases, we performed immunostaining of LPA2 in an additional 59 cases. The relations between LPA2 expression and clinical or pathological findings in these 84 cases are presented in Table 2. High expression of LPA2 was frequently detected in relatively old postmenopausal patients. High expression of LPA2 was detected in 17 out of 38 (45%) premenopausal patients and in 31 out of 46 (67%) postmenopausal women; this difference was statistically significant (P < 0.05). LPA2 expression did not correlate with oestrogen receptor expression. The frequency of nodal or distant metastasis tended to be higher in tumours with low expression of LPA2, although the difference was not statistically significant.