Microscopic and molecular evidence of the presence of asymptomatic Plasmodium falciparum and Plasmodium vivax infections in an area with low, seasonal and unstable malaria transmission in Ethiopia

This study was conducted in West Arsi Zone, Oromia Region, Ethiopia, located approximately at a distance of 251 km from the capital city, Addis Ababa. Malaria transmission is seasonal and unstable in this area. A cross-sectional study was conducted in 12 kebeles (the smallest administrative unit) of the Shalla District from November through December 2012. The kebeles have known population sizes and systematically registered households. Each kebele is sub-divided into villages. After obtaining informed consent from parents/guardians, all members of the randomly selected households were requested to give finger-prick blood samples. Inclusion criteria were that all volunteers must (1) be apparently healthy (defined as individuals with no complaints related to malaria symptoms), and (2) residing in the village for more than one year, and (3) consent to giving a blood sample. Members of a household who had contracted malaria and were treated within the previous month and/or were unwilling to participate in the study were excluded. Individuals with body temperature ≥37.5 °C as measured by digital thermometer were also excluded.

The study area has unique feature, there is a severe shortage of surface water bodies. To overcome shortage of water bodies in the surrounding, inhabitants dig ground and use it as a reservoir to store rain water. This man-made reservoir ground dries out after a few months of the termination of the rain seasons (Fig. 1).

A community-based cross-sectional study was conducted to determine the prevalence of asymptomatic Plasmodium spp. infections. Using 95 % confidence level, a design effect of 1.5, a margin of error of 4 %, and anticipated asymptomatic prevalence of 50 %, a total of 993 individuals were screened (using the formula N = (Zα/2)2P (1-P)*DEFF/ME2 where N is the sample size, Zα/2 is the critical α level, P is the anticipated asymptomatic malaria prevalence, DEFF is the design effect and ME is the marginal error). But to include 993 individuals in the sample, it was proposed that 1094 individuals were invited to participate, thus allowing for a 10 % non-response. Finger-prick blood samples were used for microscopy and RDT tests. For PCR analysis, blood samples were spotted onto Whatman 3MM filter paper. The filter papers were dried and stored individually in sealed plastic bags. Examination of the blood films was performed by experienced malaria microscopists. Participants tested malaria positive by RDT were treated according to the national treatment guideline: Artemether-lumefantrine for P. falciparum and chloroquine for P. vivax infected patients.

Thick and thin blood smears were made on the same slide, air dried and transported to the Adama Malaria Control Center. The slides were then stained with 10 % Giemsa for 15 minutes and screened for the presence of plasmodial infections. Two experienced microscopists read the slides blinded to individual’s RDT results and to each other. Fortunately, the agreement of the two microscopists was 100 % in species identification. Parasite density was determined from thick blood smears by counting the number of asexual parasites per 200 WBCs and calculated assuming a standard mean white blood cell count of 8,000 leukocytes per μl of blood [23]. A smear was considered negative if no parasites were seen after review of 100 high-powered fields. Later on, parasite densities were calculated and converted into the number of parasites per μl of blood.

The SD BIOLINE Malaria Ag P.f/P.v POCT test kit (Standard diagnostic, Inc, Germany, Lot No. 145021) was used to capture malaria antigens and was performed in accordance with the manufacturer’s instructions. The kit targeted malaria antigens HRP-2 specific for P. falciparum and Plasmodium lactate dehydrogenase (pLDH) specific for P. vivax.

Parasite DNA was extracted using the Chelex method [24]. PCR was done for samples tested positive by microscopy and/or RDT. The different Plasmodium species were identified by microscopy and species-specific nested-PCR [25]. Briefly, 3 mm² piece of filter paper with blood spot was cut with an automatic cutter and placed in 1 ml of phosphate buffered saline containing 0.5 % saponin and incubated overnight at 4 °C. The brown solution was removed and replaced with 1 x PBS and then incubated for 1 h at 4 °C. The solution was removed and 150 μl of DNAse free water was added followed by 50 μl of 20 % Chelex. The tubes were placed into a heated block (99 °C) for 10 mins and vortexed every two min. This was repeated 2–3 times. The solution was centrifuged at 13, 000 rpm for 10 min. The supernatant was carefully separated and centrifuged as before. The supernatant which contains DNA was collected carefully into 0.5 ml clean tube and used for PCR immediately or stored at −20 °C until use. The extracted DNA was amplified by nested-PCR (Bioer LifePro thermal cycler). Primer sequences (5’-3’) used for the primary PCR in P. falciparum (outer): CCGTTAATAATAAATACACGCAG and CGGATGTTACAAAACTATAGTTACC (reverse). For the nested PCR (outer): TGTGCTCATGTGTTTAAACTT and CAAAACTATAGTTACCAATTTTG (reverse) primer sequences were used. For P. vivax, primers for primary PCR (outer): CGCCATTATAGCCCTGAGCA and TCTCACGTCGATGAGGGACT (reverse). For the secondary PCR (outer): GGATAGTCATGCCCCAGGATTG and CATCAACTTCCCGGCGTAGC (reverse). Primary and nested PCR assays were performed in a 20 μl volume reaction mixture of DreamTaq buffer, 100 μM dNTPs, 0.05 μM of each primers and 1.25 units of Dream-Taq enzyme (Thermo Scientific). Two microliters (2 μl) of the sample DNA were used for outer amplification. DNA from P. falciparum strain 3D7 and sterile water were used as positive and negative controls, respectively. For P. vivax, microscopy and RDT known samples were used as positive control. Amplicons were resolved in ethidium bromide-stained 1.5 % agarose gel and observed under ultraviolet transillumination.

This protocol was reviewed and approved by the Institutional Review Boards (IRBs) of Aklilu Lemma Institute of Pathobiology, Addis Ababa University and of the Armauer Hansen Research Institute, as well as by the National Research Ethics Review Committee (NRERC). Information about the objective of the study was given to the head of each household. Written informed consent was obtained from all adults willing to participate in the study, with a parent/guardian giving consent for children. Malaria positive subjects were treated as per the national treatment guideline.

Data were checked for completeness and consistency, and double entered into a SPSS17.0 (SPSS Inc. Chicago, USA) database. Descriptive statistical analysis was done using STATA 11.0 (STATA Corp. Texas, USA). Fisher’s exact test was used to assess the difference in the prevalence of asymptomatic infections between variable of interest. The agreements between microscopy and RDT data were assessed using Cohen’s kappa coefficient (K), assuming microscopy as a ‘gold standard’. Bivariate and multivariate logistic regressions were performed to estimate the association between the presence of asymptomatic Plasmodium carriages and variables of interest. An error probability (P- value) of <0.05 was considered as statistically significant.