Skip to main content
Erschienen in: BMC Infectious Diseases 1/2017

Open Access 01.12.2017 | Research article

High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil

verfasst von: Liliana Cruz Spano, Keyla Fonseca da Cunha, Mariane Vedovatti Monfardini, Rita de Cássia Bergamaschi Fonseca, Isabel Christina Affonso Scaletsky

Erschienen in: BMC Infectious Diseases | Ausgabe 1/2017

Abstract

Background

Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas.

Methods

A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns.

Results

DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates.

Conclusion

The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

Background

Diarrheal disease caused by Escherichia coli is a major public health concern around the world [1]. Diarrheagenic Escherichia coli (DEC) strains comprise the most common bacterial pathogens worldwide [2, 3]. DEC strains are classified into six groups based on clinical, epidemiological and virulence traits: enteropathogenic Escherichia coli (EPEC), enteroaggregative E. coli (EAEC), diffusely adherent E. coli (DAEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC) and enterohemorrhagic E. coli (EHEC) [2]. EPEC, EAEC, and DAEC show characteristics adhesion patterns (localized, aggregative and diffuse, respectively) to epithelial cells. EPEC is characterized by the presence of intimin (eae) gene causing attachment and effacement on intestinal epithelial cells and the bundle-forming pili (bfp) gene encoded in the EPEC adherence factor (EAF) plasmid. Typical EPEC is characterized by the presence of both eae and bfp genes, while atypical EPEC possess the eae gene alone. EAEC is characterized by the virulence factors that is present in the 60 MDa plasmid, which includes aggregative adherence factors (AAFs), the transcriptional activator aggR, anti-aggregation protein (aap) gene, and anti-aggregation protein transporter (aatA) gene. DAEC is characterized by the presence of Afa/Dr. adhesin genes. ETEC is characterized by the presence of heat labile (elt) and/or heat-stable (est) toxin genes. EIEC is characterized by the presence of an invasion plasmid, which encodes a number of genes for invasion that includes the ipaH gene. STEC is characterized by the presence of toxin genes (stx1 and stx2) [3].
Diarrheal disease remains an important public health problem for children in developing areas of Brazil, including peri urban and rural areas. In these regions, the poor quality or absence of sanitization and of a clean water supply for the population introduce risk factors for the mortality and morbidity of childhood diarrhea. In a previous study conducted in the city of Vitória (same geographical region of the present investigation), DEC strains, especially EAEC, DAEC, and EPEC were found in 45% of cases of diarrhea in children from rural communities [4]. We conducted a survey of causative agents of diarrhea among children and adults living in peri urban areas of Brazil with poor hygiene and sanitization conditions.

Methods

Study subjects

The study was conducted between January 2008 and February 2009 in the city of Vitória, Espírito Santo. The study was part of a study with the aim of identifying risk factors for diarrhea in rural and peri urban areas with poor hygiene and sanitation conditions in southeastern Brazil [4]. Thirty-one different health centers provided stool samples. All enrolled patients (children and adults) were outpatients visiting the clinical health with acute diarrhea as reported by the physicians. The diarrhea was characterized by the occurrence of three or more loose, liquid or watery stools or at least one blood loose stool in a 24 h period [5]. The patients had no taken antibiotics in the week preceding the sampling. Clinical symptoms, including fevers, vomiting, abdominal pain, or dehydration were reported by the physicians.
Stool samples were collected and placed in Cary-Blair transport medium, and transported in iced boxes within 4 h to the laboratory at the Universidade Federal do Espírito Santo. Samples were inoculated onto the surface of MacConkey and Hektoen plates (Oxoid, Hampshire, UK) for the selection of E. coli, Shigella, and Salmonella isolates. After incubation for 24 h at 37 °C, four lactose-fermenting colonies with typical E. coli morphology, and two non-lactose-fermenting colonies were subjected to biochemical tests for identification. All E. coli strains were maintained in nutrient agar (Kasvi, Italy) slants at room temperature. Investigation of stool samples for parasites was performed by direct examination of stools after sedimentation in Lugol’s iodine solution [6].

Detection of diarrheagenic E. coli by multiplex PCRs

All E. coli isolates were subjected to two multiplex PCRs, as previously described, with some modifications [7]. PCR1 assay contained a primer mix for the detection of the following virulence markers: E. coli attaching and effacing (eae) gene (for detection of typical and atypical EPEC), EAF plasmid (for detection of typical EPEC strains), and the antiaggregation protein transporter gene (aatA; previously referred to as CVD432 or the AA probe) (for detection of EAEC strains). Primers specific for the detection of DAEC Afa/Dr. (afaB-C) strains were subsequently included into this multiplex PCR. PCR2 assay contained primers specific for elt and est. (enterotoxins of ETEC), ipaH (invasion plasmid antigen H found in EIEC and Shigella), and stx1 and stx2 (Shiga toxins 1, 2 and variants of STEC). PCR1 assay identified EAEC, DAEC, and tEPEC by the presence of eae and bfpA, and aEPEC by the presence of only eae. PCR2 assay identified ETEC, EIEC, and STEC.
Three to six bacterial colonies from each stool sample were pooled for template DNA preparation immediately prior to PCR testing, suspended in 300 μL of sterile water, and boiled for 10 min. A 5-μL aliquot of this suspension was added to 50 μL of the PCR mixture (50 mM KCl, 10 mM Tris-HCl [pH 8.3], 1.5 mM MgCl2, 2 mM of each deoxynucleoside triphosphate), 1.5 U of AccuPrime Taq DNA polymerase, and 5 μM of each set of primers except for the ipaH primers, which used 10 μM. The reactions were run in a thermal cycler (model system 2400; Perkin-Elmer Corporation, Norwalk, Conn.) with the following cycling conditions: 94 °C for 5 min, 40 cycles of denaturation at 95 °C for 1 min, annealing at 58 °C (assay 1) or 50 °C (assay 2) for 1 min and primer extension at 72 °C for 2 min followed by a final extension at 72 °C for 7 min. PCR products (10 μL) were visualized after electrophoresis in 2% agarose gels in Tris-borate-EDTA buffer and ethidium bromide staining. In all assays, a mixture of DNA from the prototype EPEC E2348/69, EAEC 042, DAEC C1845, ETEC H10407, EIEC EDL1284, and STEC EDL931 strains [2] served as the positive control, while E. coli K-12 DH5α was the negative control [8].
All DEC strains were submitted to slide agglutination with polyvalent and monovalent antisera (PROBAC, São Paulo, Brazil) against O antigens of EPEC serogroups (O26, O55, O86, O111, O114, O119, O125, O126, O127, O128ab, O142, O158), and EHEC O157. All E. coli strains were kept in nutrient agar slants at room temperature.

Detection of virulence markers by PCR

Primers and PCR conditions for detecting sequences encoding 17 putative virulence genes are described in Table 1. A DNA template was prepared by boiling a suspension of 5 colonies in 100 μl distilled water. The following E. coli strains where used as controls for detection of target genes: 042 (aggR, aap, aafA, pet, astA, pic) [9], 17–2 (aggA) [10], RN785–1 (agg3A, irp2) [11], EDL933 (hdaA, chuA), FBC114 (sat) [12], iucA [13], C1845 (afaE, daaE) [14], 2787 (aida/aah) [15], and HSP7–1 (paa) [16].
Table 1
Primers used in polymerase chain reaction analysis
Gene
Description
Primer Sequence (5′- 3′)
PCR product
Reference
aggR
Transcriptional activator
CTAATTGTACAATCGATGTA
ATGAAGTAATTCTTGAAT
308 bp
[37]
aap
Antiaggregation protein
CTTTTCTGGCATCTTGGGT
GTAACAACCCCTTTGGAAGT
232 bp
[37]
aggA
AAF/I fimbria subunit
TTAGTCTTCTATCTAGGG
AAATTAATTCCGGCATGG
450 bp
[37]
aafA
AAF/II fimbria subunit
ATGTATTTTTAGAGGTTGAC
TATTATATTGTCACAAGCTC
518 bp
[37]
agg-3A
AAF/III fimbria subunit
GTATCATTGCGAGTCTGGTATTCAG
GGGCTGTTATAGAGTAACTTCCAG
462 bp
[38]
had
AAF/IV fimbria subunit
TCCATTATGTCAGGCTGCAA
GGCGTTAACGTCTGATTTCC
411 bp
[41]
paa
Porcine AE/associated adhesin
ATGAGGAACATAATGGCAGG
TCTGGTCAGGTCGTCAATAC
357 bp
 
aida/aah
AIDA-I adhesin
TCGATACCGAAACGCATACGCAGA
ACGCCGATCGGTGATGATGAAGAT
204 bp
 
afaE
Afa-I afimbrial adhesin
CGAAAACGGCACTGACAAG
AGGCTTTCCGTGAATACAACC
230 bp
[34]
daaE
F1845 fimbrial adhesin
TGACTGTGACCGAAGAGATGC
TTAGTTCGTCCAGTAACCCCC
380 bp
[34]
sat
Secreted autotransporter toxin
CTCATTGGCCTCACCGAACGG
GCTGGCAGCTGTGTCCACGAG
299 bp
 
pic
Serine protease precursor
ACTGGCGGACTCATGCTG T
AACCCTGTAAGAAGACTGAGC
387 bp
 
pet
Plasmid-encoded toxin
GACCATGACCTATACCGACAGC
CCGATTTCTCAAACTCAAGACC
600 bp
 
astA
EAST1 heat-stable toxin
CCATCAACACAGTATATCCGA
GGTCGCGAGTGACGGCTTTGT
111 bp
 
chuA/ shuA
Heme receptor
ATCTGCTGCGTCATGTTCCT
GTAGTGGTCATACCTTTGAGC
1700 bp
 
iucA
Aerobactin sintase
AGTCTGCATCTTAACCTTCA
CTCGTTATGATCGTTCAGAT
1100 bp
 
irp2
Iron chelating
AAGGATTCGCTGTTACCGGAC
TCGTCGGGCAGCGTTTCTTCT
264 bp
 

HEp-2 adherence assay

E. coli isolates were subjected to HEp-2 adherence tests by the method originally described by Scaletsky et al. [17], with slight modifications. Briefly, monolayers of 105 HEp-2 cells were grown in Dulbecco modified Eagle medium containing 10% fetal bovine in 24-well tissue culture plates (Falcon Becton Dickinson). Bacterial strains were grown statically in 2 ml of brain heart infusion for 16–18 h. The monolayers were infected with ~3 X 107 bacteria (20 μl of bacterial cultures added to 1 ml of DMEM) and incubated at 37 °C for 3 h. The infected monolayers were washed with sterile PBS, fixed with methanol, stained with Giemsa stain, and examined by light microscopy for adherence pattern.

Antimicrobial susceptibility testing

Antimicrobial susceptibility tests were performed employing the disc diffusion method on Mueller-Hinton agar, following recommendations of the Clinical and Laboratory Standards Institute [18]. One colony of each E. coli isolate taken from a nutrient agar culture was inoculated into 10 mL of sterile water. The resulting suspension was applied to the surface of a 14-cm plate of Muller Hinton agar (Difco) and spread evenly with a sterile cotton-tipped applicator. The plates were incubated at 37 °C for 30 min before the application of antibiotic discs. The antibiotic discs (6 mm; all obtained from Oxoid) were amikacin (30 μg), ampicillin (10 μg), amoxicillin-clavulanic acid (30 μg), cefotaxime (30 μg), choramphenicol (30 μg), ciprofloxacin (5μg), gentamicin (10 μg), imipenem (10 μg), cotrimoxazole (25 μg); tetracycline (30 μg), and trimethoprim (5 μg). The inhibition zone diameters were measured in millimeters and interpreted in accordance with manufacturers´ recommendations. E. coli NCTC10418 and E. coli K-12 C600 were used as controls.

Statistical analysis

The statistical analyses were performed using the SPSS version 17.0 (SPSS Inc., Chicago, IL). Statistical differences were evaluated by chi-square or Fisher’s exact tests. A p value <0.05 was considered statistically significant.

Results

Subjects

From January 2008 and February 2009, a total of 327 cases of diarrhea were recruited in this study. They were divided into two groups, 141 children (< 18 years of age) and 186 adults (≥ 18 years of age), were recruited in this study. Of the 141 children, 75 (53.2%) were younger than 2 years, 49 (34.7%) were between 2 and 10 years, and 17 (12.1%) were younger than 18 years of age. Among adults, 51 (27.4%) were between 18 and 30 years, 66 (35.5%) were between 31 and 50, and 69 (37.1%) were older than 50 years of age.

Prevalence of DEC and enteropathogens

E. coli (n = 1200) strains isolated from 280 of 327 cases were categorized into different pathotypes of DEC based on the results of two multiplex PCRs. Strains negative for DEC markers were further examined for their HEp-2 cell adherence patterns. Tables 2 and 3 show the characteristics and isolation frequency of DEC strains. DEC pathotypes were detected in 56 (39.7%) diarrheagenic children and 74 (38.8%) diarrheagenic adults. None of the DEC strains belonged to a classical EPEC serogroup. EAEC and DAEC were most common, each detected in 23% and 13%, in both diarrheal groups. Atypical EPEC (only eae) was more frequently detected among diarrheagenic children (5.7%) than diarrheagenic adults (1.1%). LT-ETEC was found in two diarrheagenic adults (0.7%). Mix DEC infections were detect in five patients; two of them harbored EAEC and DAEC, one harbored EAEC and aEPEC, one DAEC and EPEC, and one EAEC and ETEC. No EIEC, EHEC or STEC were detected in this study. Other enteric pathogens isolated were Shigella (1.2%) and Salmonella (0.3%). Parasites (Ascaris, Giardia, Ancylostoma, Strongyloides or Taenia) were detected in 7% of stool samples. Mixed infections were presented in 22 (15.6%) cases and 12 (2.9%) controls (P < 0.05).
Table 2
Distribution of diarrheagenic E. coli (DEC) isolated from children and adults attending health centers in Southeastern Brazil
DEC (type and genes) n = 130
Number (%)
% of all patients (n = 327)
No. of strains (%)
p value
Children (n = 141)
Adults (n = 186)
EAEC
76
23.2
32 (22.6)
44 (23.6)
0,8952
aatA
15 (19.7)
4.6
12 (8.5)
3 (1.6)
0.0027
 AA phenotype
60 (78.9)
18.3
26 (18.4)
34 (18.3)
1.0000
 CLA phenotype
16 (21.1)
4.9
4 (2.8)
12 (6.5)
0.1952
DAEC
42
12.8
18 (12.8)
24 (12.9)
0.3215
afa/dr
25 (59.5)
7.6
14 (9.9)
11 (5.9)
0.2091
 DA phenotype
17 (40.5)
5.2
4 (2.8)
13 (7.0)
0.7628
EPEC
10
3.1
8 (5.7)
2 (1.1)
NDa
eae
10 (100)
3.1
8 (5.7)
2 (1.1)
ND
eae + bfpA
0
0
0
0
ND
ETEC
2
0.6
0
2 (1.1)
ND
elt
1 (50.0)
0
0
1 (0.5)
ND
est
1 (50.0)
0
0
1 (0.5)
ND
EIEC
0
0
0
0
ND
ipaH
0
0
0
0
 
EHEC
0
0
0
0
ND
stx1or stx2
0
0
0
0
 
Mixed infection
6
1.8
2 (1.4)
4 (2.2)
0.7024
 EAEC + DAEC
3
0.9
1 (0.7)
2 (1.1)
ND
 EAEC + ETEC
1
0.3
0
1 (0.5)
ND
 EAEC + aEPEC
1
0.3
0
1 (0.5)
ND
 DAEC + aEPEC
1
0.3
1 (0.7)
0
ND
aNot determined; p value in bold: significant (Fisher’s exact tests)
Table 3
Distribution of related-virulence genes among diarrheagenic E. coli (DEC) isolated from children and adults attending health centers in Southeastern Brazil
DEC group
Virulence gene
Number (%)
No. of strains (%)
p value
Children (n = 141)
Adults (n = 186)
EAEC
 
76
   
aatA
15 (19.7)
12 (8.5)
3 (1.6)
0.0027
aap
21 (27.6)
15 (10.6)
6 (3.2)
0.0107
aggR
20 (26.3)
14 (9.9)
6 (3.2)
0.0181
aggA
1 (1.3)
1 (0.7)
0
NDa
aafA
0
0
0
ND
agg3A
7 (9.2)
4 (2.8)
3 (1.6)
0.4698
hdaA
5 (6.6)
4 (2.8)
1 (0.5)
0.1696
pet
42 (55.3)
17 (12.1)
25 (13.4)
0.7416
astA
17 (22.3)
8 (5.7)
9 (4.8)
0.8040
pic
31 (40.8)
14 (9.9)
17 (9.1)
0.8502
sat
11 (14.5)
5 (3.5)
6 (3.2)
1.0000
irp2
29 (38.1)
11 (7.8)
18 (9.7)
0.6951
iucA
27 (35.5)
13 (9.2)
14 (7.5)
0.6858
chuA
14 (18.4)
6 (4.3)
8 (4.3)
1.0000
DAEC
 
42
   
afaB-C
25 (59.5)
14 (9.9)
11 (5.9)
0.2091
afaE
0
0
0
0
daaE
0
0
0
0
aida/aah
0
0
0
0
astA
6 (14.2)
4 (2.8)
2 (1.1)
ND
pic
3 (7.1)
1 (0.7)
2 (1.1)
ND
pet
23 (54.8)
6 (4.3)
17 (9.1)
0.1251
sat
11 (26.2)
3 (2.1)
8 (4.3)
0.3620
aEPEC
 
10
   
astA
10 (100.0)
8 (5.7)
2 (1.1)
ND
paa
4 (40.0)
4 (2.8)
0
ND
aND: Not determined; p value in bold: significant (Fisher’s exact tests)

Characterization of EAEC, DAEC and aEPEC isolates

Of a total of 76 EAEC isolates, 15 (19.7%) of EAEC were aatA positive. EAEC aatA-positive strains were isolated significantly more often from diarrheagenic children than diarrheagenic adults (p < 0.05) (Table 2). The majority of the EAEC isolates (79%) produced the characteristic AA pattern on HEp-2 cells. Sixteen (21%) EAEC isolates produced the chain-like adherence (CLA) pattern, characterized by bacteria attaching on both coverslip and HEp-2 cell surfaces forming long chain aggregates, concomitantly with the AA pattern [19]. All EAEC isolates were tested by PCR to detect genes for the proposed EAEC virulence factors, such as Aap, AggR, AAF/I, AAF/II, AAF/III, Hda, Pet, EAST1, Pic, Irp2, IucA, and ChuA. As shown in Table 3, pet was the most frequently detected (55.3%) followed by pic (40.8%), iucA (35.5%), irp2 (28.1%), aap (27.6%), aggR (26.3), and chuA (18.4%). One strain harbored AAF/I (aggA), seven strains harbored AAF/III (agg3A), and five strains harbored AAF/IV (hdaA). EAEC strains carrying the aagR-aap-aatA genes were isolated significantly more often from diarrheagenic children than diarrheagenic adults (p < 0.05) (Table 3).
There were a total of 42 DAEC, of which 25 (59.5%) harbored adhesins from the Afa/Dr. family (Table 2). DAEC strains possessing Afa/Dr. genes were detected in both children (10%) and adults (6%) groups, and none of these strains presented the adhesin-encoded genes afaE, daaE and aida (Table 3). All DAEC strains were tested by PCR to detect the toxin-encoding genes astA, pet, pic, and sat. As shown Tables 3, 23 (54.8%) of the strains were positive for pet. The sat gene was found in 11 (26.2%), while astA and pic were found in 6 (14.2%) and 3 (7.1%) of strains, respectively.
Atypical EPEC (only eae) was more frequently detected among diarrheagenic children (5.7%) than diarrheagenic adults (1.1%) (Table 2). All strains harbored the astA gene, and 40% of them also harbored the porcine AE-associated adhesin (paa) gene (Table 3). Strains were examined for adhesion to HEp-2 and none of them were adherent.
EAEC, DAEC, and aEPEC isolates were tested for their susceptibilities to 12 antimicrobial agents (Table 4). The EAEC isolates had low frequencies of antimicrobial resistance, while high-resistance rates were found among DAEC isolates, being ampicillin, cefotaxime and cotrimoxazole the most prevalent, each detected in 75%. Half of aEPEC isolates were resistant to at least 8 antimicrobial drugs. Since it is well-known that antibiotic resistance is apparently associated with plasmids, we examined plasmid carriage of 10 strains of DAEC and aEPEC. As shown in Figs. 1 and 2, different plasmid profiles were seen after DNA extraction by alkaline lyses method [20] in DAEC and aEPEC strains isolated from both children and adults (Figs. 1 and 2).
Table 4
Antimicrobial susceptibility of diarrheagenic E. coli isolated from children and adults attending health centers in Southeastern Brazil
DEC group
Susceptibility, n (%)
AMK
AMP
AMC
CTX
CHL
CIP
GEN
IPM
SXT
TET
TIC
EAEC
 Children (n = 30)
1 (3.3)
0
0
0
0
1 (3.3)
1 (3.3)
0
0
1 (3.3)
0
 Adults (n = 46)
1 (2.2)
2 (4.3)
3 (6.5)
4 (8.7)
2 (4.3)
3 (6.5)
2 (4.3)
2 (4.3)
2 (4.3)
5 (10.9)
2 (4.3)
DAEC
 Children (n = 18)
2 (11.1)
7 (38.9)
0
8 (44.4)
3 (16.7)
10 (55.5)
0
0
4 (22.2)
1 (5.5)
3 (16.7)
 Adults (n = 24)
5 (20.8)
11 (45.8)
2 (8.3)
14 (58.3)
4 (16.7)
14 (58.3)
0
4 (16.7)
5 (20.8)
2 (8.3)
4 (16.7)
aEPEC
 Children (n = 8)
4 (50.0)
6 (75.0)
3 (37.5)
6 (75.0)
5 (62.5)
5 (62.5)
5 (62.5)
5 (62.5)
6 (75.0)
5 (62.5)
5 (62.5)
 Adults (n = 2)
0
0
0
0
0
0
0
0
0
0
0
AMK Amikacin, AMP Ampicillin, AMC Amoxicillin-Clavulanic acid, CTX Cefotaxime, CLO Choramphenicol, CIP Ciprofloxacin, GEN Gentamicin, IPM Imipenem, SUT trimethoprim-sulfamethoxazole, TET Tetracycline, TIC Ticarcillin

Discussion

Despite the abundance of reports on diarrheal disease in children under five years of age, this study is one of the few to include the identification of all six DEC pathotypes in all age individuals. Our study has shed light on the little-known issue of DEC infections in adult patients attending health centers. Adults rarely visit a health care when they have diarrhea, unless they perceive the diarrhea as being serious. We demonstrated that DEC pathotypes were commonly found in diarrheagenic adults (40%). EAEC (23%) and DAEC (13%) were the most prevalent DEC pathotypes in both diarrheal groups; whereas aEPEC strains were recovered more frequently from diarrheagenic children (6%) than from diarrheagenic adults (1%). ETEC accounted for 1.5% of DEC, and we did not find EIEC and EHEC strains, indicating their limited role in childhood diarrhea in Brazil. Our findings are in agreement with a previous study conducted in rural communities in the city of São Mateus (same geographical region of the present investigation), showing high prevalence of DEC (45%) in children with diarrhea, EAEC (21%) as the most frequent DEC, followed by DAEC (12%) and EPEC (9%) [4]. In another study, DAEC was significantly associated with diarrhea in children older than one year of age (18.3%) at the emergency room of Hospital de Pediatria in the city of Vitória [21]. Several other studies conducted in Brazil have also shown that EAEC and DAEC strains are frequently detected in children with diarrhea [2224]. aEPEC has been increasingly reported and was recently implicated as a cause of childhood diarrhea in different urban centers of Brazil [25, 26].
The terms typical EAEC and atypical EAEC have been suggested to refer to EAEC strains harboring or lacking the regulator AggR, respectively. Some studies have demonstrated an association of typical EAEC with diarrhea [25, 27, 28]. In our study, aggR-positive strains were isolated significantly more often from diarrheagenic children than from diarrheagenic adults (p < 0.05). Interesting, AA plasmid-positive EAEC was dominant among children and AA plasmid-negative EAEC was dominant among adults. Two hypotheses would be proposed: one is that there are different routes of infection to adults and children in the study area, another is that AA plasmid-negative strains could survive adaptively in adults, though children and adults are equally infected by both AA plasmid positive and negative EAEC. Twenty percent of our EAEC aatA-aggR positive strains simultaneously harbored the aap gene for dispersin. There appears to be a high conservation of the aatA-aagR-aap locus in the pAA plasmid, as has been shown for the prototype 042 strains [29]. Most tEAEC did not harbor the four variants of AAFs, similarly to previous studies in Brazil [11, 22, 30].
The pathogenic mechanisms of EAEC infection are only partially understood. The varying presence of the different virulent factors indicates heterogeneity of the EAEC isolates [30]. It has been hypothesized that the combination of these genes increases strain virulence. Several different combinations of the virulence markers were found among the EAEC isolates. The most prevalent combination was pet and pic, found at similar frequencies in both diarrheal groups.
The adhesins of Afa/Dr. family have been implicated in DAEC pathogenesis. The prevalence of DAEC possessing Afa/Dr. genes in diarrheagenic children and diarrheagenic adults was similar. Germani et al. [31] demonstrated that, among DAEC strains, only those that were Afa/Dr.+ were found in higher frequency in diarrheic patients than asymptomatic controls. However, in some studies, DAEC Afa/Dr.+ strains are isolated from cases of diarrhea and controls in similar frequencies [32, 33]. The afaE and daaE (F1845) genes were not found in any DAEC strains. In our study, a significant proportion of DAEC isolates carried a gene encoding for a toxin, such as Pet and Sat. In a recent Brazilian study, DAEC sat-positive strains were found to be associated with childhood diarrhea [34].
The porcine AE/associated adhesin (paa) gene has been found in a higher frequency among aEPEC from children with diarrhea than from controls [16, 35]. In addition, the EAST1 toxin (astA) has been found in association with diarrheal disease among Brazilian children [3638]. The analysis of the presence of those genes showed that all aEPEC isolates carried astA and 40% of them carried paa genes.
Our data show a high resistance rate in E. coli strains similar to those reported in previous studies [39, 40] and constitute a great concern in Brazil for public health. There was no significant difference in antibiotic resistance in E. coli strains isolated from children compared with strains from adults. Resistance to more than one antibiotic was found in approximately 60% of DAEC and aEPEC strains. The most commonly observed resistance was to ampicilin, cefotaxime and cotrimoxazole.

Conclusion

Our results show a high proportion of DEC, where EAEC and DAEC predominate among children and adults with diarrhea. In addition, our results suggest that DEC carrying toxin-encoding genes seem to play an important role in causing sporadic diarrheal diseases in Brazil. Moreover, the findings reinforce our previous communications regarding the importance of DEC strains in childhood diarrhea in endemic areas of Brazil.

Acknowledgments

The authors thanks to the Municipality Laboratory of Vitória for the access of the clinical specimens. KFC and MVM were both supported with scholarship by the Foundation for Research and Innovation of Espírito Santo, Brazil.

Funding

This study was supported by grants of the Foundation for Science and Technology of Victoria Municipality (FACITEC) of Espírito Santo State, Brazil. The funding body had no participation in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Availability of data and materials

The data is available upon request. Please contact the corresponding author Liliana Cruz Spano, E-mail: liliana.spano@ufes.br.
The study was approved by the Ethical Committee of the Universidade Federal do Espírito Santo, Brazil. Stool samples were obtained with the written informed consent from the adults and from the parents or guardians of the children.
Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Kotloff KL, Nataro JP, Blackwelder WC, et al. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the global enteric multicenter study, GEMS): a prospective, case-control study. Lancet. 2013;382:209–22.CrossRefPubMed Kotloff KL, Nataro JP, Blackwelder WC, et al. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the global enteric multicenter study, GEMS): a prospective, case-control study. Lancet. 2013;382:209–22.CrossRefPubMed
3.
Zurück zum Zitat Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev. 2013;26:822–80.CrossRefPubMedPubMedCentral Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev. 2013;26:822–80.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Lozer DM, Souza TB, Monfardini MV, et al. Genotypic and phenotypic analysis of diarrheagenic Escherichia coli strains isolated from Brazilian children living in low socioeconomic level communities. BMC Infect Dis. 2013;8:418.CrossRef Lozer DM, Souza TB, Monfardini MV, et al. Genotypic and phenotypic analysis of diarrheagenic Escherichia coli strains isolated from Brazilian children living in low socioeconomic level communities. BMC Infect Dis. 2013;8:418.CrossRef
6.
Zurück zum Zitat Murray PR 1999 Murray PR, Baron MA, Pfaller MA, Tenover FC, Yolken RH: Manual of Clinical Microbiology. Washington. ASM press;1999. Murray PR 1999 Murray PR, Baron MA, Pfaller MA, Tenover FC, Yolken RH: Manual of Clinical Microbiology. Washington. ASM press;1999.
7.
Zurück zum Zitat Aranda KR, Fagundes-Neto U, Scaletsky IC. Evaluation of multiplex PCRs for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp. J Clin Microbiol. 2004;42:5849–53.CrossRefPubMedPubMedCentral Aranda KR, Fagundes-Neto U, Scaletsky IC. Evaluation of multiplex PCRs for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp. J Clin Microbiol. 2004;42:5849–53.CrossRefPubMedPubMedCentral
8.
Zurück zum Zitat Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
9.
Zurück zum Zitat Baudry B, Savarino SJ, Vial P, Kaper JB, Levine MM. A sensitive and specific DNA probe to identify enteroaggregative E. coli, a recently discovered diarrheal pathogen. J Infect Dis. 1990;161:1249–51.CrossRefPubMed Baudry B, Savarino SJ, Vial P, Kaper JB, Levine MM. A sensitive and specific DNA probe to identify enteroaggregative E. coli, a recently discovered diarrheal pathogen. J Infect Dis. 1990;161:1249–51.CrossRefPubMed
10.
Zurück zum Zitat NataroJP DY, Maneval DR, German AL, Martin WC, Levine MM. Aggregative adherence fimbriar II, a second fimbrial antigen mediating aggregative adherence in enteroaggregative Escherichai coli. Infect Immun. 1992;60:2297–304. NataroJP DY, Maneval DR, German AL, Martin WC, Levine MM. Aggregative adherence fimbriar II, a second fimbrial antigen mediating aggregative adherence in enteroaggregative Escherichai coli. Infect Immun. 1992;60:2297–304.
11.
Zurück zum Zitat Zamboni A, Fabricotti SH, Fagundes-Neto U, Scaletsky IC. Enteroaggregative Escherichia coli virulence factors are found to be associated with infantile diarrhea in Brazil. J Clin Microbiol. 2004;42:1058–63.CrossRefPubMedPubMedCentral Zamboni A, Fabricotti SH, Fagundes-Neto U, Scaletsky IC. Enteroaggregative Escherichia coli virulence factors are found to be associated with infantile diarrhea in Brazil. J Clin Microbiol. 2004;42:1058–63.CrossRefPubMedPubMedCentral
12.
Zurück zum Zitat Taddei CR, Moreno AC, Fernandes Filho A, Montemor LP, Martinez MP. Prevalence of secreted autotransporter toxin gene among diffusely adhering Escherichia coli isolated from stools of children. FEMS Microbiol Lett. 2003;227:249–53.CrossRefPubMed Taddei CR, Moreno AC, Fernandes Filho A, Montemor LP, Martinez MP. Prevalence of secreted autotransporter toxin gene among diffusely adhering Escherichia coli isolated from stools of children. FEMS Microbiol Lett. 2003;227:249–53.CrossRefPubMed
13.
Zurück zum Zitat Okeke IN, Scaletsky ICA, Soars EH, MacFarlane LR, Torres AG. Molecular epidemiology of the iron utilization genes of enteroaggreagtive Escherichia coli. J Clin Microbiol. 2004;42:36–44.CrossRefPubMedPubMedCentral Okeke IN, Scaletsky ICA, Soars EH, MacFarlane LR, Torres AG. Molecular epidemiology of the iron utilization genes of enteroaggreagtive Escherichia coli. J Clin Microbiol. 2004;42:36–44.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Bilge S, Clausen C, Lau W, Moseley S. Molecular characterization of a fimbrial adhesin, F1845, mediating diffuse adherence of diarrhea-associated Escherichia coli to HEp-2 cells. J Bacteriol. 1989;171:4281–9.CrossRefPubMedPubMedCentral Bilge S, Clausen C, Lau W, Moseley S. Molecular characterization of a fimbrial adhesin, F1845, mediating diffuse adherence of diarrhea-associated Escherichia coli to HEp-2 cells. J Bacteriol. 1989;171:4281–9.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Benz I, Schmidt MA. Cloning and expression of an adhesin (AIDA-I) involved in diffuse adherence of enteropathogenic Escherichia coli. Infect Immun. 1989;57:1506–11.PubMedPubMedCentral Benz I, Schmidt MA. Cloning and expression of an adhesin (AIDA-I) involved in diffuse adherence of enteropathogenic Escherichia coli. Infect Immun. 1989;57:1506–11.PubMedPubMedCentral
16.
Zurück zum Zitat Scaletsky IC, Aranda KR, Souza TB, Silva NP. Adherence factors in atypical enteropathogenic Escherichia coli strains expressing the localized adherence-like pattern in HEp-2 cells. J Clin Microbiol. 2010;48:302–6.CrossRefPubMed Scaletsky IC, Aranda KR, Souza TB, Silva NP. Adherence factors in atypical enteropathogenic Escherichia coli strains expressing the localized adherence-like pattern in HEp-2 cells. J Clin Microbiol. 2010;48:302–6.CrossRefPubMed
17.
Zurück zum Zitat Scaletsky ICA, Silva MLM, Trabulsi LR. Distinctive patterns of adherence of Enteropathogenic Escherichia coli to HeLa cells. Infect. Immunity. 1984;45:534–6. Scaletsky ICA, Silva MLM, Trabulsi LR. Distinctive patterns of adherence of Enteropathogenic Escherichia coli to HeLa cells. Infect. Immunity. 1984;45:534–6.
18.
Zurück zum Zitat CLSI. Clinical and laboratory standards institute. Performance standards for antimicrobial susceptibility testing; twenty-fifth informational supplement. CLSI document M 100-S25. Clinical and Laboratory Standards Institute: Pensylvania; 2015. CLSI. Clinical and laboratory standards institute. Performance standards for antimicrobial susceptibility testing; twenty-fifth informational supplement. CLSI document M 100-S25. Clinical and Laboratory Standards Institute: Pensylvania; 2015.
19.
Zurück zum Zitat Gioppo NM, Elias WP Jr, Vidotto MC, et al. Prevalence of HEp-2 cell-adherent Escherichia coli and characterisation of enteroaggregative E. coli and chain-like adherent E. coli isolated from children with and without diarrhoea, in Londrina, Brazil. FEMS Microbiol Lett. 2000;190:293–8.CrossRefPubMed Gioppo NM, Elias WP Jr, Vidotto MC, et al. Prevalence of HEp-2 cell-adherent Escherichia coli and characterisation of enteroaggregative E. coli and chain-like adherent E. coli isolated from children with and without diarrhoea, in Londrina, Brazil. FEMS Microbiol Lett. 2000;190:293–8.CrossRefPubMed
21.
Zurück zum Zitat Spano LC, Sadovsky AD, Segui PN, et al. Age-specific prevalence of diffusely adherent Escherichia coli in Brazilian children with acute diarrhoea. J Med Microbiol. 2008;57:359–63.CrossRefPubMed Spano LC, Sadovsky AD, Segui PN, et al. Age-specific prevalence of diffusely adherent Escherichia coli in Brazilian children with acute diarrhoea. J Med Microbiol. 2008;57:359–63.CrossRefPubMed
22.
Zurück zum Zitat Piva IC, Pereira AL, Ferraz LR, et al. Virulence markers of Enteroaggregative Escherichia coli isolated from children and adults with diarrhea in Brasília. Brazil J Clin Microbiol. 2003;41:1827–32.CrossRefPubMed Piva IC, Pereira AL, Ferraz LR, et al. Virulence markers of Enteroaggregative Escherichia coli isolated from children and adults with diarrhea in Brasília. Brazil J Clin Microbiol. 2003;41:1827–32.CrossRefPubMed
23.
Zurück zum Zitat Regua-Mangia AH, Gomes TA, Vieira MA, Andrade JR, Irino K, Teixeira LM. Frequency and characteristics of diarrhoeagenic Escherichia coli strains isolated from children with and without diarrhoea in Rio de Janeiro, Brazil. J Inf Secur. 2004;48:161–7. Regua-Mangia AH, Gomes TA, Vieira MA, Andrade JR, Irino K, Teixeira LM. Frequency and characteristics of diarrhoeagenic Escherichia coli strains isolated from children with and without diarrhoea in Rio de Janeiro, Brazil. J Inf Secur. 2004;48:161–7.
24.
Zurück zum Zitat Rodrigues J, Thomazini CM, Morelli A, de Batista GC. Reduced etiological role for Enteropathogenic Escherichia coli in cases of diarrhea in Brazilian infants. J Clin Microbiol. 2004;42:398–400.CrossRefPubMedPubMedCentral Rodrigues J, Thomazini CM, Morelli A, de Batista GC. Reduced etiological role for Enteropathogenic Escherichia coli in cases of diarrhea in Brazilian infants. J Clin Microbiol. 2004;42:398–400.CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat Araujo JM, Tabarelli GF, Aranda KR, et al. Typical enteroaggregative and atypical enteropathogenic types of Escherichia coli are the most prevalent diarrhea-associated pathotypes among Brazilian children. J Clin Microbiol. 2007;45:3396–9.CrossRefPubMedPubMedCentral Araujo JM, Tabarelli GF, Aranda KR, et al. Typical enteroaggregative and atypical enteropathogenic types of Escherichia coli are the most prevalent diarrhea-associated pathotypes among Brazilian children. J Clin Microbiol. 2007;45:3396–9.CrossRefPubMedPubMedCentral
26.
Zurück zum Zitat Scaletsky IC, Souza TB, Aranda KR, Okeke IN. Genetic elements associated with antimicrobial resistance in enteropathogenic Escherichia coli (EPEC) from Brazil. BMC Microbiol. 2010;10:25.CrossRefPubMedPubMedCentral Scaletsky IC, Souza TB, Aranda KR, Okeke IN. Genetic elements associated with antimicrobial resistance in enteropathogenic Escherichia coli (EPEC) from Brazil. BMC Microbiol. 2010;10:25.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Okeke IN, Lamikandra A, Czeczulin J, Dubovsky F, Kaper JB, Nataro JP. Heterogeneous virulence of enteroaggregative Escherichia coli strains isolated from children in Southwest Nigeria. J Infect Dis. 2000;181:252–60.CrossRefPubMed Okeke IN, Lamikandra A, Czeczulin J, Dubovsky F, Kaper JB, Nataro JP. Heterogeneous virulence of enteroaggregative Escherichia coli strains isolated from children in Southwest Nigeria. J Infect Dis. 2000;181:252–60.CrossRefPubMed
28.
Zurück zum Zitat Sarantuya J, Nishi J, Wakimoto N, et al. Typical enteroaggregative Escherichia coli is the most prevalent pathotype among E. coli strains causing diarrhea in Mongolian children. J Clin Microbiol. 2004;42:133–9.CrossRefPubMedPubMedCentral Sarantuya J, Nishi J, Wakimoto N, et al. Typical enteroaggregative Escherichia coli is the most prevalent pathotype among E. coli strains causing diarrhea in Mongolian children. J Clin Microbiol. 2004;42:133–9.CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat Chaudhuri RR, Sebaihia M, Hobman JL, et al. Complete genome sequence and comparative metabolic profiling of the prototypical enteroaggregative Escherichia coli strain 042. PLoS One. 2010;5:e8801.CrossRefPubMedPubMedCentral Chaudhuri RR, Sebaihia M, Hobman JL, et al. Complete genome sequence and comparative metabolic profiling of the prototypical enteroaggregative Escherichia coli strain 042. PLoS One. 2010;5:e8801.CrossRefPubMedPubMedCentral
30.
Zurück zum Zitat Boisen N, Scheutz F, Rasko DA, et al. Genomic characterization of enteroaggregative Escherichia coli from children in Mali. J Infect Dis. 2012;205:431–44.CrossRefPubMed Boisen N, Scheutz F, Rasko DA, et al. Genomic characterization of enteroaggregative Escherichia coli from children in Mali. J Infect Dis. 2012;205:431–44.CrossRefPubMed
31.
Zurück zum Zitat Germani Y, Begaud E, Duval P, Le Bouguenec C. Prevalence of enteropathogenic, enteroaggregative, and diffusely adherent Escherichia coli among isolates from children with diarrhea in New Caledonia. J Infect Dis. 1996;174:1124–6.CrossRefPubMed Germani Y, Begaud E, Duval P, Le Bouguenec C. Prevalence of enteropathogenic, enteroaggregative, and diffusely adherent Escherichia coli among isolates from children with diarrhea in New Caledonia. J Infect Dis. 1996;174:1124–6.CrossRefPubMed
32.
Zurück zum Zitat Albert MJ, Faruque ASG, Faruque SM, Sack RB, Mahalanabis D. Case-control study of enteropathogens associated with childhood diarrhea in Dhaka, Bangladesh. J Clin Microbiol. 1999;37:3458–64.PubMedPubMedCentral Albert MJ, Faruque ASG, Faruque SM, Sack RB, Mahalanabis D. Case-control study of enteropathogens associated with childhood diarrhea in Dhaka, Bangladesh. J Clin Microbiol. 1999;37:3458–64.PubMedPubMedCentral
33.
Zurück zum Zitat Rajendran P, Ajjampur SS, Chidambaram D. Pathotypes of diarrheagenic Escherichia coli in children attending a tertiary care hospital in South India. Diagn Microbiol Infect. 2010;68:117–22.CrossRef Rajendran P, Ajjampur SS, Chidambaram D. Pathotypes of diarrheagenic Escherichia coli in children attending a tertiary care hospital in South India. Diagn Microbiol Infect. 2010;68:117–22.CrossRef
34.
Zurück zum Zitat Mansan-Almeida R, Pereira AL, Giugliano LG. Diffusely adherent Escherichia coli strains isolated from children and adults constitute two different populations. BMC Microbiol. 2013;13:22.CrossRefPubMedPubMedCentral Mansan-Almeida R, Pereira AL, Giugliano LG. Diffusely adherent Escherichia coli strains isolated from children and adults constitute two different populations. BMC Microbiol. 2013;13:22.CrossRefPubMedPubMedCentral
35.
Zurück zum Zitat Afset JE, Bruant G, Brousseau R, et al. Identification of virulence genes linked with diarrhea due to atypical enteropathogenic Escherichia coli by DNA microarray analysis and PCR. J Clin Microbiol. 2006;44:3703–11.CrossRefPubMedPubMedCentral Afset JE, Bruant G, Brousseau R, et al. Identification of virulence genes linked with diarrhea due to atypical enteropathogenic Escherichia coli by DNA microarray analysis and PCR. J Clin Microbiol. 2006;44:3703–11.CrossRefPubMedPubMedCentral
36.
Zurück zum Zitat Yatsuyanagi J, Saito S, Miyajima Y, Amano K, Enomoto K. Characterization of atypical enteropathogenic Escherichia coli strains harboring the astA gene that were associated with a waterborne outbreak of diarrhea in Japan. J Clin Microbiol. 2003;41:2033–9.CrossRefPubMedPubMedCentral Yatsuyanagi J, Saito S, Miyajima Y, Amano K, Enomoto K. Characterization of atypical enteropathogenic Escherichia coli strains harboring the astA gene that were associated with a waterborne outbreak of diarrhea in Japan. J Clin Microbiol. 2003;41:2033–9.CrossRefPubMedPubMedCentral
37.
Zurück zum Zitat Dulguer MV, Fabbricotti SH, Bando SY, Moreira-Filho CA, Fagundes-Neto U, Scaletsky IC. Atypical enteropathogenic Escherichia coli strains: phenotypic and genetic profiling reveals a strong association between enteroaggregative E. coli heat-stable enterotoxin and diarrhea. J Infect Dis. 2003;188:1685–94.CrossRefPubMed Dulguer MV, Fabbricotti SH, Bando SY, Moreira-Filho CA, Fagundes-Neto U, Scaletsky IC. Atypical enteropathogenic Escherichia coli strains: phenotypic and genetic profiling reveals a strong association between enteroaggregative E. coli heat-stable enterotoxin and diarrhea. J Infect Dis. 2003;188:1685–94.CrossRefPubMed
38.
Zurück zum Zitat Silva LE, Souza TB, Silva NP, Scaletsky IC. Detection and genetic analysis of the enteroaggregative Escherichia coli heat-stable enterotoxin (EAST1) gene in clinical isolates of enteropathogenic Escherichia coli (EPEC) strains. BMC Microbiol. 2014;14:135.CrossRefPubMedPubMedCentral Silva LE, Souza TB, Silva NP, Scaletsky IC. Detection and genetic analysis of the enteroaggregative Escherichia coli heat-stable enterotoxin (EAST1) gene in clinical isolates of enteropathogenic Escherichia coli (EPEC) strains. BMC Microbiol. 2014;14:135.CrossRefPubMedPubMedCentral
39.
Zurück zum Zitat Souza TB, Morais MB, Tahan S, Melli LC, Rodrigues MS, Scaletsky IC. High prevalence of antimicrobial drug-resistant diarrheagenic Escherichia coli in asymptomatic children living in an urban slum. J Inf Secur. 2009;59:247–51. Souza TB, Morais MB, Tahan S, Melli LC, Rodrigues MS, Scaletsky IC. High prevalence of antimicrobial drug-resistant diarrheagenic Escherichia coli in asymptomatic children living in an urban slum. J Inf Secur. 2009;59:247–51.
40.
Zurück zum Zitat Dias RC, Dos Santos BC, Dos Santos LF, et al. Diarrheagenic Escherichia coli pathotypes investigation revealed atypical enteropathogenic E. coli as putative emerging diarrheal agents in children living in Botucatu, São Paulo State, Brazil. APMIS. 2016;124:299–308.CrossRefPubMed Dias RC, Dos Santos BC, Dos Santos LF, et al. Diarrheagenic Escherichia coli pathotypes investigation revealed atypical enteropathogenic E. coli as putative emerging diarrheal agents in children living in Botucatu, São Paulo State, Brazil. APMIS. 2016;124:299–308.CrossRefPubMed
41.
Zurück zum Zitat Estrada-García T, Cerna JF. Paheco-Gil let al. Drug-resistant diarrheogenic Escherichia coli, Mexico. Emerg Infec Diseases. 2005;11:1306–8.CrossRef Estrada-García T, Cerna JF. Paheco-Gil let al. Drug-resistant diarrheogenic Escherichia coli, Mexico. Emerg Infec Diseases. 2005;11:1306–8.CrossRef
Metadaten
Titel
High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil
verfasst von
Liliana Cruz Spano
Keyla Fonseca da Cunha
Mariane Vedovatti Monfardini
Rita de Cássia Bergamaschi Fonseca
Isabel Christina Affonso Scaletsky
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
BMC Infectious Diseases / Ausgabe 1/2017
Elektronische ISSN: 1471-2334
DOI
https://doi.org/10.1186/s12879-017-2872-0

Weitere Artikel der Ausgabe 1/2017

BMC Infectious Diseases 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.