Background
Since December 2019, several cases of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection were first reported the virus has caused an outbreak in a short time by human-to-human transmission throughout China, especially in Hubei Province. The severe contagiousness and rapid disease progression of the 2019 coronavirus disease (COVID-19) have drawn significant global public health attention. As of March 30, 2020, more than 600,000 confirmed cases were reported worldwide, of which Hubei Province is the most affected area with greater than 80,000 cases and thousands of deaths confirmed from COVID-19.
Like severe acute respiratory syndrome (SARS) [
1] and Middle East respiratory syndrome (MERS) [
2], COVID-19 not only causes infections in the respiratory tract but also in the digestive tract, liver, and heart [
3‐
5]. A considerable proportion of COVID-19 patients develop severe pneumonia, pulmonary edema, acute respiratory distress syndrome, and even multiple organ failure within a short time. The mortality rate of patients in Wuhan was as high as 4.3% at the time of writing this report [
5], but may be slightly lower in other areas. The clinical characteristics of COVID-19 patients in non-Wuhan areas of Hubei Province have not previously been described. In this study, we conducted a comprehensive exploration of the epidemiology and clinical features of 91 patients with confirmed COVID-19 admitted to Jingzhou Central Hospital in Jingzhou, one of the most severely affected cities in Hubei Province.
Methods
Patients
We retrospectively analyzed patients diagnosed with COVID-19 hospitalized from January 16, 2020 to February 10, 2020. Patients suspected of having COVID-19 were admitted and quarantined, and throat swab samples were collected and tested for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) by quantitative polymerase chain reaction assay (qPCR). Patients diagnosed with COVID-19 were enrolled in this study and asked to sign a written informed consent form during hospitalization. This study was approved by the ethics committee of Jingzhou Central Hospital. The patients have not been reported in any other submission by anyone else. The final date of follow-up was February 10, 2020.
Data collection
Clinical data [age, previous chronic disease, epidemiological history, symptoms, vital signs, computed tomography (CT) images, virus load, laboratory tests, complications, and treatment process] of the 91 patients involved in this study were collected. Acute respiratory distress syndrome was defined according to the Berlin definition [
6]. Liver injury was judged by alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels. Acute kidney injury was identified according to elevated creatinine (Cr) and uric acid levels. The presence of cardiac injury was confirmed if the serum levels of cardiac biomarkers [cardiac troponin i (CTnI), creatine kinase (CK), creatine kinase isoenzyme (CK-MB)] were elevated. The diagnosis of COVID-19 was made by the comprehensive evaluation of epidemiological exposure, symptoms, laboratory tests, chest CT scan, and qPCR analysis.
QPCR assay for SARS-CoV-2
RNA for further tests was extracted from the throat swab samples, which were collected in virus preservation solution. Next, 5 μl of RNA was added in a PCR reaction tube with 12 μl of nucleic acid amplification reaction solution, 4 μl of enzyme mixture, and 12 μl of ORF1ab/N reaction solution (BioGerm, Shanghai, China). The cycle parameters for PCR amplification assay were set as follows: reverse transcription at 50 °C for 10 min; predenaturation at 95 °C for 5 min; 40 cycles of denaturation at 95 °C for 10 s; and annealing, extending, and collection of fluorescence at 55 °C for 40 s. The open reading frame 1ab (ORF1ab) and nucleocapsid protein (N) gene regions of SARS-CoV-2 were simultaneously tested. Primers for ORF1ab were as follows: forward primer CCCTGTGGGTTTTACACTTAA, reverse primer ACGATTGTGCATCAGCTGA, and the probe 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1–3′. Primers for N were as follows: forward primer GGGGAACTTCTCCTGCTAGAAT, reverse primer CAGACATTTTGCTCTCAAGCTG, and the probe 5′-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3′. A cycle threshold value (Ct value) of less than 37 suggested a positive result, while a Ct value of higher than 40 indicated a negative result. And a Ct value between 37 and 40 required retesting.
Statistical analysis
The Mann–Whitney U test was used to compare continuous variables, while the chi-square test was adopted to compare categorical variables. The statistics were prepared using Excel (Microsoft Corp., Redmond, WA, USA) and GraphPad Prism 5 software (GraphPad Software, La Jolla, CA, USA), and analyzed using SPSS (IBM Corp., Armonk, NY, USA). A p-value of less than 0.05 was considered to be statistically significant.
Discussion
According to the data reported, the mortality rate in Wuhan (4.3%) [
5] is indeed higher than in other areas. As Jingzhou ranks among the top three cities that have the most immigrant population from Wuhan but does not confront the same challenges in Wuhan, we contend that the cases described in this paper are more representative of the course of COVID-19. There are two main reasons accounting for the higher mortality rate reported in Wuhan. Although all COVID-19 patients are treated in public hospitals and all expenses are borne by the government, patients in Wuhan could not obtain prompt and adequate treatment as a result of the area hospitals being overloaded with large numbers of patients in a short time. Further, we found that patients in the Jingzhou Central Hospital were often younger, with a median age of 46.0 years relative to that of 56.0 years in Wuhan. Also, there were fewer patients with coexisting chronic diseases in this study, which assisted in lowering the mortality rate [
5].
Not all of our patients were qPCR-positive after throat swab sampling during their first test. It took three times to obtain a positive qPCR result for 14.3% of the patients in our study. False negatives often exist during qPCR testing. All patients presented typical CT imaging changes during the study, thus we could establish a clinical diagnosis decision using CT before positive qPCR results were obtained. Hence, CT imaging is a favorable means for diagnosing COVID-19 as well as evaluating the severity of the disease. In sum, the confirmation of COVID-19 should be dependent upon the comprehensive analysis of epidemiological exposure, symptoms, laboratory tests, qPCR, and CT imaging.
Based on the symptoms and laboratory examinations of our patients, we found that, in addition to the respiratory tract, the digestive tract, liver, renal function, and cardiovascular system were affected. The mechanism of multiple organ damage in the context of COVID-19 infection is currently unclear. The virus enters into the host cells by the recognition of spike glycoproteins. Accumulated evidence has shown that ACE2 is the cell receptor of choice for SARS-CoV-2, same as in the SARS-CoV infection, which means that the virus infects cells expressing ACE2 [
8‐
11]. It was also reported that anti-ACE2 therapy blocked coronavirus replication during in vitro experiments [
11]. It is even proposed that angiotensin receptor 1 blockers might be a treatment option for SARS [
12,
13], but there remains a lack of practice basis in this regard at present. ACE2 was initially thought to be expressed only in the heart, kidneys, and testis, but has now been found to be widely expressed in the lungs, brain, and digestive tract [
8‐
10]. These results, together with the bioinformatics analysis in our study, might explain why the COVID-19 caused multiple organ damage. Other possible reasons, including hypoxia caused by respiratory failure and the immune response caused by virus, might also account for the multiple organ damage.
Due to the lack of effective antiviral drugs, some patients got worse and developed respiratory failure in seven to 10 days. Almost all the patients in this study received antibacterial agents, 89.01% received antiviral therapy and 86.81% received glucocorticoid therapy. Oseltamivir is used to treat the influenza virus by inhibiting neuraminidase. The use rate of oseltamivir varies across different studies from 35.8% in the study of Zhong et al. [
14] to 89.9% in that by Wang et al. [
5]. In our study, 26.4% of patients were treated with oseltamivir. At the beginning of the disease course, it can be difficult to distinguish the symptoms of patients with COVID-19 from those with influenza. Further, some patients tested positive for influenza virus antibodies, so oseltamivir antiviral therapy was used. In most cases, this drug was used in combination with other antiviral (lopinavir/ritonavir and umifenovir) and antibacterial agents. So far, there are no specific antiviral agents available to treat SARS-CoV-2, SARS, or MERS. More prospective studies on specific antiviral therapy might help overcome this challenge.
Although the use of glucocorticoids in virus pneumonia is still very controversial, these medications are widely used in clinical practice. The 86.81% frequency rate for use in our study is higher than in other reports [
3‐
5]. It is yet to be confirmed that the lower mortality in our study is correlated with the higher glucocorticoid utility ratio. Chen et al. retrospectively analyzed 401 patients, including 249 critically ill patients, showing that glucocorticoids were effective in controlling the inflammatory response caused by SARS [
15]. However, the multivariate analysis of another retrospective analysis suggested that corticosteroid therapy was significantly associated with a 20.7 times higher intensive care unit occupancy rate among patients with SARS relative to SARS patients who did not receive corticosteroids [
16]. Thus, further prospective investigations are required to explore the benefits and side effects of glucocorticoid treatments in patients with viral pneumonia.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.