Skip to main content
Erschienen in: Gut Pathogens 1/2017

Open Access 01.12.2017 | Research

Multi-drug resistant pathogenic bacteria in the gut of young children in Bangladesh

verfasst von: Shirajum Monira, Syeda Antara Shabnam, Sk. Imran Ali, Abdus Sadique, Fatema-Tuz Johura, Kazi Zillur Rahman, Nur Haque Alam, Haruo Watanabe, Munirul Alam

Erschienen in: Gut Pathogens | Ausgabe 1/2017

Abstract

Background

The gut of human harbors diverse commensal microbiota performing an array of beneficial role for the hosts. In the present study, the major commensal gut bacteria isolated by culturing methods from 15 children of moderate income families, aged between 10 and 24 months, were studied for their response to different antibiotics, and the molecular basis of drug resistance.

Results

Of 122 bacterial colonies primarily selected from Luria–Bertani agar, bacterial genera confirmed by analytical profile index (API) 20E® system included Escherichia as the predominant (52%) organism, followed by Enterobacter (16%), Pseudomonas (12%), Klebsiella (6%), Pantoea (6%), Vibrio (3%), and Citrobacter (3%); while Aeromonas and Raoultella were identified as the infrequently occurring genera. An estimated 11 and 22% of the E. coli isolates carried virulence marker genes stx-2 and eae, respectively. Antimicrobial susceptibility assay revealed 78% of the gut bacteria to be multidrug resistant (MDR) with highest resistance to erythromycin (96%), followed by ampicillin (63%), tetracycline (59%), azithromycin (53%), sulfamethoxazole-trimethoprim (43%), cefixime (39%), and ceftriaxone (33%). PCR assay results revealed 56% of the gut bacteria to possess gene cassette Class 1 integron; while 8, 17.5 and 6% of the strains carried tetracycline resistance-related genes tetA, tetB, and tetD, respectively. The macrolide (erythromycin and azithromycin) resistance marker genes mphA, ereB, and ermB were found in 28, 3 and 5% of bacterial isolates, respectively; while 26, 12, 17, 32, 7, 4 and 3% of the MDR bacterial isolates carried the extended spectrum β-lactamase (ESBL)-related genes e.g., bla TEM, bla SHV, bla CMY-9, bla CTX-M1, bla CTX-M2, bla CMY-2 and bla OXA respectively. Majority of the MDR gut bacteria harbored large plasmids [e.g., 140 MDa (43%), 105 MDa (30%), 90 MDa (14%)] carrying invasion and related antibiotic resistance marker genes.

Conclusions

Our results suggest gut of young Bangladeshi children to be an important reservoir for multi-drug resistant pathogenic bacteria carrying ESBL related genes.

Background

The gut of human harbors diverse microbial community including 400–500 different species of bacteria performing an array of important metabolic functions for the host namely production of short-chain fatty acids and vitamins (vitamin k and biotin), nutrient absorption, and fighting against invading pathogens [1, 2]. Diarrhea and poor child health are longstanding problems for many developing countries where sanitation is poor and the source of safe drinking water is scarce. In Bangladesh, a child under 5 years of age frequently suffers from moderate to severe diarrhea, on an average 3–4 times a year [3]. The hospitalized patients suffering from severe diarrhea (cholera) undergo rehydration therapy and a 3 day course of effective antibiotic to shorten the hospitalization and to prevent the spread of infectious bacteria into the environment [4, 5]. Although antibiotic therapy prevents people from death due to severe infection and related dehydration, the effect of antibiotics on the gut flora in acute diarrhea remains an important area to explore.
Our culture-independent metagenomic studies provided evidence that acute diarrhea (cholera) results in the expulsion of most of the commensal gut microbiota, and drug therapy allows the drug-resistant pathogenic microbiota to colonize the gut [7]. Our metagenomic studies also revealed that the members of the phyla Proteobacteria including pathogenic genera were predominant in the gut of malnourished children compared to their healthy counterparts [6]. In Bangladesh, infectious diseases due to multidrug resistant (MDR) bacteria are at rise, although the reservoir for such MDR bacteria is not well defined. This study, a follow up, was designed to analyze gut microbiota from 15 children aged between 10 and 24 months, who did not have immediate past history of diarrhea for last 2 months, and were from moderate income families living in moderate hygiene condition in Dhaka city. We confirmed the gut of children under 5 years of age as an important reservoir for MDR bacterial genera belonging to the family Enterobacteriaceae, which included surface water bacteria, including important human pathogens carrying major virulence plasmids and related genetic elements responsible for multidrug resistance.

Methods

Study subjects

This study was conducted in Dhaka city during February 2011–July 2012 on gut bacteria of 15 non-diarrheal children from moderate socioeconomic status. The age of the children ranged between 10 and 24 months and their weight for height was >100% according to the National Centre for Health Statistics Median [8]. All children were residing in their home, without any sign of ailments, and none had any history of taking any antibiotics during the past 2 months. Their baseline characteristics are presented in Table 1. For sample collection, health workers visited the house-holds of the children to get mothers’ consents and to demonstrate the sample collection procedure by providing them pots for stool collection. Fresh stool samples collected in the following morning were transferred to the laboratory maintaining cold chain.
Table 1
Baseline characteristics of study children
Criteria
Healthy children (n = 15)
Age, month
20.9 ± 6.4
Weight, kg
11.8 ± 1.0
Height, cm
74.9 ± 2.9
Weight/height, %
114.5 ± 5.9
Weight/age, %
101.3 ± 3.1
Male/female
9/6
Socio-economic status
Moderate
Values are expressed as mean ± SD

Enrichment, plating and identification of bacteria

Stool samples were inoculated for enrichment in 3 ml of Luria Broth (Difco, USA) using sterile cotton swabs and incubated overnight at 37 °C in a shaking water bath. The enriched samples were diluted six folds and streaked onto Luria Agar (Difco, USA) plates; and the growth of the colonies were observed after overnight incubation at 37 °C. Twenty colonies of various morphological types (viz., size, shapes, elevation, opacity) representing bacterial community were randomly selected from each samples and identified by culturing over night in the Analytical Profile Index (API 20E®) test kit (bioMerieux Inc., Hazelwood, MO).

Antibiotic susceptibility testing

Antimicrobial susceptibility assay of the bacterial strains was performed using agar disc diffusion assay method recommended by the Clinical and Laboratory Standards Institute [9]. Commercially available antimicrobial discs (Mast Diagnostics, U.K) of erythromycin (15 µg), gentamicin (10 µg), sulfamethoxazole-trimethoprim (25 µg), tetracycline (30 µg), ciprofloxacin (5 µg), azithromycin (15 µg), ampicillin (10 µg), ceftriaxone (30 µg), cefixime (5 µg), and mecillinam (10 µg) were placed on Mueller–Hinton agar (Bio-Rad) seeded with bacteria cultured in their early log phase, as previously described CLSI [9]. Following incubation, the plates were examined, and the inhibitory zone diameters for individual antimicrobial agents were measured and recorded as susceptible and resistant based on the breakpoints for respective antibiotic susceptibility of CLSI (CLSI 2010). Organisms resistant to 3 or more classes of antibiotics are designated as MDR. Zone diameter, breakpoints (mm): erythromycin (15 μg) S-I-R: >26, 23–25, <2; gentamicin (10 μg): >15, 13–14, <12; sulfamethoxazole trimethoprim (25 μg): >26, 23–25, <22; tetracycline (30 μg): >26, 23–25, <22; ciprofloxacin (5 μg): >21, 15–20, <14; ampicillin (10 µg): >17,14–16, <13; ceftriaxone (30 μg): >16, 13–15, <12; cefixime (5 μg): >19, 16–18, <15; azithromycin (15 μg): >18, 14–17, <13; mecillinam (10 μg): >15, 12–14, <11.

Extraction of genomic DNA and plasmids from bacteria

Genomic DNA was extracted from 3.0 ml of cells cultured overnight in LB broth using alkaline lysis method followed by phenol–chloroform extraction, as described elsewhere [10]. The eluted DNA was stored at −20 °C.
Plasmid DNA was extracted according to the conventional simplified alkaline lysis method [11] and afterwards separated by horizontal electrophoresis in 0.8% agarose gels in a Tris–borate EDTA buffer at room temperature at 100 V (50 mA) for 3 h. Thirty microliters of plasmid DNA solution were mixed with 3 µl of tracking dye and was loaded into the individual well of the gel. The gel was stained with ethidium bromide (0.1 ng/ml) for 30 min at room temperature. DNA bands were visualized and photographed using Gel Documentation with UV Trans illuminator. The molecular weight of the unknown plasmid DNA was determined on the basis of its mobility through agarose gel and was compared with the mobility of the known molecular weight plasmids present in strains of E. coli PDK-9 of sizes 140, 105, 2.7 and 2.1 MDa.

PCR detection of genes associated with virulence and antibiotic resistance of E. coli

Escherichia coli strains isolated and confirmed by API 20E® were screened by PCR for the detection of virulence genes namely stx1, stx-2, lt, and eae by following methods as described elsewhere [12]. The gut bacteria isolated in present study were screened for macrolide resistance marker genes such as mphA, ereB and ermB [13]; tetracycline resistance genes e.g., tetA, tetB, and tetD [14]; β-lactam resistance gene in enteric bacteria e.g., bla TEM, bla SHV, bla OXA, bla CMY-9, bla CMY-2, bla CTX-M1, and bla CTX-M2 [14, 15]. The distribution of integrons in multi-drug resistant bacteria was determined by PCR primer targeted against the conserved regions of the integrin-encoded integrase genes, intl-1 [16]. SXT is a family of conjugative-transposon-like mobile genetic elements encoding multiple antibiotic resistance genes. Multi-drug resistant bacteria were analyzed for the presence of SXT- related genes by PCR targeting the integrase gene (int) of the SXT [17]. The PCR primers used in this study are listed in Table 2.
Table 2
PCR primers for screening virulence and antibiotic resistance genes in bacteria isolated from the gut of healthy children in Bangladesh
Primer
Primer sequence (5′ → 3′)
Target
Amplicon size (bp)
References
Stx2f
GGCACTGTCTGAAACTGCTCC
stx 2
225
[12]
Stx2r
TCGCCAGTTATCTGACATTCTG
eae1
CTGAACGGCGATTACGCGAA
eae
917
[12]
eae2
CCAGACGATACGATCCAG
INT-1U
GTTCGGTCAAGGTTCTG
intl1
923
[16]
INT-1D
GCCAACTTTCAGCACATG
mphA(F)
GTGAGGAGGAGCTTCGCGAG
mphA
403
[13]
mphA(R)
TGCCGCAGGACTCGGAGGTC
ereB(F)
TTGGAGATACCCAGATTGTAG
ereB
537
[13]
ereB(R)
GAGCCATAGCTTCAACGC
ermB(F)
GAAAAAGTACTCAACCAAATA
ermB
639
[13]
ermB(R)
AATTTAAGTACCGTTACT
INT1
GCTGGATAGGTTAAGGGCGG
Sxt-integrase
592
[17]
INT2
CTCTATGGGCACTGTCCACATTG
TEM(F)
ATTCTTGAAGACGAAAGGGC
bla TEM
1150
[14]
TEM(R)
ACGCTCAGTGGAACGAAAAC
OXA-F
ACACAATACATATCAACTTCGC
Bla OXA
813
[14]
OXA-R
AGTGTGTTTAGAATGGTGATC
SHV-F
CACTCAAGGATGTATTGTG
bla SHV
885
[14]
SHV-R
TTAGCGTTGCCAGTGCTCG
CMY-9(F)
TCAGCGAGCAGACCCTGTTC
bla CMY-9
874
[15]
CMY-9(R)
CTGGCCGGGATGGGATAGTT
CTX-M1(F)
AACCGTCACGCTGTTGTTAG
bla CTX-M1
766
[15]
CTX-M1(R)
TTGAGGCTGGGTGAAGTAAG
CTX-M2(F)
GGCGTTGCGCTGATTAACAC
bla CTX-M2
486
[15]
CTX-M2(R)
TTGCCCTTAAGCCACGTCAC
TetA (F)
GTAATTCTGAGCACTGTCGC
tetA
937
[14]
TetA (R)
CTGCCTGGACAACATTGCTT
TetB (F)
CTCAGTATTCCAAGCCTTTG
tetB
416
[14]
TetB (R)
CTAAGCACTTGTCTCCTGTT
TetD (F)
ATTACACTGCTGGACGCGAT
tetD
1104
[14]
TetD (R)
CTGATCAGCAGACAGATTGC

Results

Isolation and identification of gut bacteria

Of 122 bacterial colonies primarily selected from the culture plates, nine different bacterial genera were identified by conventional microbiological culture methods coupled with the use of analytical profile index (API) 20E® system. As shown in Table 3, bacteria isolated from the gut of young children included important pathogenic bacteria along with the ones that are widely known as commensals, and were predominated by the members of the family Enterobacteriaceae. Escherichia was identified to be the dominant bacterial genera accounting for 52%, followed by Enterobacter (16%), Pseudomonas (12%), Klebsiella (6%), Pantoea (6%), Vibrio (3%), and Citrobacter (3%); while Aeromonas and Raoultella were also identified, but as infrequently occurring genera. Replicates of the bacterial colonies representing each of the genera were collected and stored in T1N1 soft agar (both at room temperature and −80 °C) for further use.
Table 3
Isolation of multi-drug resistant bacteria of the family Enterobacteriaceae, including the potential pathogens occurring in the gut of young children in Bangladesh
Sl.#
Bacteria
Total
Number of antibiotic resistant bacteria (%)
MDR
E
CN
SXT
TE
CIP
AMP
CRO
CFM
AZM
MEL
1
E. coli
63
52
61 (97)
9 (14)
26 (41)
45 (71)
16 (25)
42 (67)
18 (29)
28 (44)
34 (54)
7 (11)
2
Enterobacter spp.
19
15
19 (100)
2 (11)
13 (68)
12 (63)
0
17 (90)
10 (53)
9 (47)
8 (42)
1 (5)
3
Pseudomonas spp.
15
12
15 (100)
0
0
1 (7)
2 (13)
13 (87)
4 (27)
2 (13)
12 (63)
9 (60)
4
Klebsiella spp.
7
5
7 (100)
0
3 (43)
3 (43)
0
6 (86)
0
1 (14)
3 (43)
2 (29)
5
Pantoea spp.
7
4
7 (100)
1 (14)
4 (57)
5 (71)
0
5 (71)
3 (43)
3 (43)
3 (43)
1 (14)
6
Vibrio spp.
4
1
2 (50)
0
1 (25)
1 (25)
1 (25)
2 (40)
1 (25)
1 (25)
1 (25)
0
7
Citrobacter spp.
4
4
3 (75)
2 (50)
4 (100)
4 (100)
4 (100)
3 (75)
2 (50)
3 (75)
3 (75)
1 (25)
8
Aeromonas hydrophila gr. 1
2
1
2 (100)
0
1 (50)
1 (50)
0
0
2 (100)
1 (50)
0
0
9
Raoultella terrigena
1
1
1 (100)
0
0
0
0
0
0
0
1 (100)
1 (100)
10
Total
122
95 (78)
117 (96)
14 (11)
52 (43)
72 (59)
23 (19)
77 (63)
40 (33)
48 (39)
65 (53)
22 (18)
E erythromycin, 15 µg; CN gentamicin, 10 µg; SXT trimethoprim sulfamethoxazole, 25 µg; TE tetracycline, 30 µg; CIP ciprofloxacin, 5 µg; AMP ampicillin, 10 µg; CRO ceftriaxone, 30 µg; CFM cefixime, 5 µg; AZM azithromycin, 15; MEL mecillinam, 10 µg

Antimicrobial susceptibility assay of gut bacteria

Results of antimicrobial susceptibility assay by disc diffusion method revealed 78% of the gut bacteria to be resistant to multiple antimicrobial drugs (Table 3), and were thus multidrug resistant (MDR). Among them E. coli was the predominant MDR (55%) bacterium followed by Enterobacter spp. (16%), Pseudomonas spp. (13%), Klebsiella spp. (5%), Pantoea spp. (4%), Vibrio spp. (1%), Citrobacter spp. (4%), Aeromonas hydrophila (1%) and Raoultella terrigena (1%).
Ca. 96% of the commensal bacteria occurring in the gut of children were resistant to erythromycin, followed by ampicillin (63%), tetracycline (59%), azithromycin (53%), sulfamethoxazole-trimethoprim (43%), cefixime (39%), and ceftriaxone (33%) (Table 3).
Since E. coli was the predominant MDR bacterial lineage (54%) found in the gut of young children, this bacterium was investigated for detailed drug resistance profile. Overall results revealed 3% of the MDR E. coli to be resistant to 9 of the 10 antimicrobial agents tested. E. coli strains were highly resistant to commonly used antibiotics e.g., erythromycin (97%), followed by tetracycline (71%), ampicillin (67%), azithromycin (54%), and cefixime (44%) (Table 3).
As shown in Table 3, Enterobacter spp. constituted the second most largest group of bacteria in the gut of young children comprising E. cloacae, E. cancerogenus, and E. sakazakii. Results revealed 90, 53, and 42% of the Enterobacter isolates to be resistant to ampicillin, ceftriaxone, and cefixime, respectively.

Polymerase chain reaction (PCR) for detection of virulence and related marker genes

Polymerase chain reaction assay results revealed 56% of the overall gut bacteria to harbor gene cassettes namely Class 1 integron. PCR assays also revealed 11 and 22% of the E. coli isolates to harbor important virulence and related marker genes such as stx-2 and eae, respectively. None of the isolates was positive for stx1, and lt. E. coli isolates showing resistance to tetracycline carried the resistance related genes namely tetA (8%; 5/63), tetB (17.5%; 11/63), and tetD 6.0% (4/63). None of the other bacteria isolated from the gut of young children had any of these genes.
Resistance markers against macrolide antibiotics (erythromycin and azithromycin) e.g., mphA, ereB and ermB were found in 28% (34/122), 3% (3/122), and 5% (6/122) different gut bacterial isolates, respectively. The gut bacterial isolates were positive for extended spectrum betalactamase-related genes such as, bla TEM (26%; 32/122), bla SHV (12%; 14/122), bla CMY-9 (17%; 21/122), bla CTX-M1(32%; 39/122), bla CTX-M2 (7%; 8/122), bla CMY-2 (4%; 5/122), and bla OXA (3%; 4/122) conferring resistance to β-lactam antibiotics.

Detection of virulence and related large plasmids

Results revealed that majority of the MDR bacterial isolates from the gut of children harbored large plasmids e.g., 140 MDa (43%), 105 MDa (30%), and 90 MDa (14%) carrying invasion and related antibiotic resistance marker genes (Fig. 1).

Discussions

Data presented in this study coupled with the data reported earlier in our culture-independent metagenomic studies provide important insights into the prevalence of MDR bacterial genera of the family Enterobacteriaceae in the gut of young children in Bangladesh. Our results appear concordant as drug resistant bacteria were reported from the gut of healthy children elsewhere [18, 19]. In Bangladesh, children suffer from frequent diarrhea and their gut can serve as an important reservoir for pathogenic bacteria of the family enterobacteriaceae, including genera that are naturally occurring in the aquatic environments [6]. The results of this culture-based gut microbiota study appear in agreement with the data obtained in our immediate past culture-independent metagenomic study showing the presence in the gut of pathogenic bacteria belonging to the family enterobacteriaceae, which included pathogenic bacteria occurring naturally in the aquatic environments [6]. Our subsequent culture-independent metagenomic studies also showed that the antimicrobial therapy in acute diarrhea results in dysbiosis, and selectively allows only the antibiotic resistant microbiota to enrich and settle in the gut of children [7]. As the course of medication ended, the prevalent antibiotic-guarded community declined, but did not disappear completely as floral restoration followed up to day 28 of our observation [7]. Thus, frequent diarrhea and related multiple doses of antibiotics likely enrich multi-drug resistant bacteria in the gut, as reflected by the observed predominance of extended-spectrum beta-lactamase (ESBL) positive Gram-negative bacterial genera including the recognized enteric and opportunistic pathogens in the gut of young children in Bangladesh. Thus, the data presented in this study might provide a basis for the widespread growth stunting related to the gut floral immaturity, as has been proposed for Bangladeshi children [20] reaching their adulthood as malnourished.
Escherichia coli was the most abundant bacteria as confirmed by our culture-based analysis of the gut microbiota of young children in Bangladesh. The most striking finding may be that 11% of the E. coli occurring in the gut of young children had genes encoding shiga toxin (stx)-2, and 22% possessed eae encoding an intimin adherence protein responsible for hemorrhagic colitis and hemolytic uremic syndrome caused by enterohemorrhagic E. coli (EHEC). Besides, a great majority (83%) of the E. coli isolated from the gut of children were MDR in Bangladesh. Drug resistant E. coli was reported from healthy children of USA, Venezuela, and China [2123]; however, to our knowledge, MDR gut bacteria carrying EHEC genes namely stx-2 and eae are unique in the present study, which indicate a potential health risk for the young children of Bangladesh.
Enterobacter cloacae, a commensal gut bacteria occurring widely in the environment, has the ability to cause opportunistic infections in human [24, 25]. The abundance of Enterobacter spp., namely E. cloacae and E. cancerogenus as commensal flora of the gut of young children might reflect the potential health risks related to these opportunistic pathogens. E. cloacae was shown to develop resistance to cephalosporins related to high frequency mutation in the resistance genes of extended-spectrum cephalosporins and ampicillin [2527]. In concurrence, almost half of the commensal Enterobacter spp. isolated from gut of young children were resistant to cephalosporin antibiotics (e.g., ceftriaxone and cefixime) in Bangladesh.
Environmental enteropathy (EE), also known as tropical enteropathy or environmental enteric dysfunction, is a condition of frequent intestinal infections [28]. There may be rare or no acute symptoms, but the chronic problem associated with the EE is the mal absorption of nutrients, which can lead to malnutrition and growth stunting in children [28]. In Dhaka city, municipal supply water was shown have multiple infectious agents, including bacteria [29]. The observed prevalence of the pathogenic member of the family Enterobacteriaceae in the gut of young children might reflect widespread environmental enteropathy in Dhaka city. Although boiling is an effective way to kill water-borne pathogens, this is often not practical due to poor or no access to fuel. A recent study revealed possible post-collection contamination of water at the household level, as the pathogen counts were much higher in the household drinking water than that of the supply water [29]. Such pathogenic bacteria causing frequent infections (3–5 episodes of diarrhea/year) can eventually settle down in the gut as a commensal microbiota [6], as we observed in the gut of children living in Dhaka city. This is plausible as the type of microbiota in the gut of cohort of European and rural African children was determined by their regular foods [30].
The observed multi-drug resistance in gut microbiota of young children of Bangladesh appeared concordant with results from studies reporting MDR bacteria from healthy fecal samples of adults [3133] and children [18, 19, 21, 22] from other countries of the world. Plasmids are known to carry and transmit drug resistance and related genes in bacteria [33, 34]. A 140 MDa plasmid is known to be associated with the invasiveness of Shigella flexneri [35]. In the present study, a significant proportion (48%) of the gut bacteria of young children harbored a 140 MDa plasmids. To the best of our knowledge this is the first report of the presence of such major plasmids in bacteria other than Shigellae occurring in the gut of young children, which can transfer resistance and related genes horizontally across different genera.
The gene cassettes such as classes 1 and 2 integrons are responsible for multidrug resistance in Gram-negative bacteria [14]. Class 1 integron was found from 57% (39/68) of the E. coli occurring in the gut of young children in Dhaka city. Our results appear in agreement, as intl–1 was reported from as high as 71% of MDR E. coli isolated from human, animal, and food in Spain [14]. The observed presence of tetracycline resistance-related genes tetA, tetB, and tetD encoding efflux proteins in the commensal E. coli was in agreement in the present study, as tetracycline resistant strains have been reported from the gut of infants in a previously study conducted elsewhere [36]. Tetracycline resistance-related genes tetA, tetB, and tetD were found only from the MDR E. coli strains, but not from any other commensal bacteria occurring in the gut of young children in Bangladesh. Our results appear in agreement as tetA and tetB were present in MDR E. coli isolated from human, animal, and food in Spain, but all carried a wide variety of other antibiotic resistance markers [14].
Bacteria producing enzymes beta-lactamases (β-lactamases; also known as penicillinase) can degrade β-lactam antibiotics such as penicillins, cephamycins, and carbapenems (ertapenem), but rarely carbapenems, are MDR. The emergence of β-lactam resistance in Enterobacteriaceae is related primarily to the production of novel enzymes such as TEM-, SHV-, and OXA-type β-lactamases. Ampicillin-resistant (AMPr) E. coli isolated from foods, fecal samples of human, and healthy animals were shown to harbor bla-TEM-type β-lactamase [37]. In this study, majority (91%) of the E. coli isolated from the gut of young children harbored bla- TEM type β-lactamases in Bangladesh. Although the remaining E. coli isolates possessed bla OXA in our study, this is a clear indication of the proliferation of ESBLs producing bacteria among the commensal gut bacteria of young children, which is alarming from public health standpoint. The OXA-type β-lactamases were reported earlier in 2008 from clinical samples in Swedish hospital [38]. Previously, E. coli isolated from fecal samples of domestic animals, retail ground meats, and urinary samples were shown to carry and spread bla CMY-2 in southern Taiwan [39]. In the present study, two each of Pantoea spp., E. cloacae, and one E. cancerogenus possessed bla CMY-2. Bla CMY-9 was identified as a novel plasmid mediated cephalosporinase in E. coli isolated from clinical samples in Japan [40]. Our results reveal 16% (20/122) of the bacteria occurring in the gut of young children possessed bla CMY-9 gene. In addition, six Klebsiella spp. isolated in the present study from the gut of young children harbored the bla SHV gene responsible for ESBL activity in Klebsiella spp. [41].
In our previous study in Bangladesh, we have documented that acute diarrhea expels the gut flora while antibiotic provision for the hospitalized diarrhea patients selectively allows only the MDR bacteria belonging to enterobacteriaceae to be restored in the gut of children [6]. The observed prevalence of pathogenic bacteria carrying a wide variety of drug resistance marker genes, especially the extended spectrum beta-lactamase (ESBL) suggests the gut of young (under five years) children to be an important reservoir for MDR-related genes. This is suggestive of an apparent havoc, which will make the clinical management of diarrhea and other opportunistic bacterial infections, especially in severely malnourished and immunocompromised children very challenging. It is therefore evident prudent that more children will suffer from diarrhea due to MDR bacteria in Bangladesh, a densely populated country where hygiene level is poor and the dearth of safe drinking water will invite more untreatable diseases than ever before.

Authors’ contributions

MA conceived the study. SM designed and carried out the study involving SAS, SKIA, AS, FTJ, and KZR. MA, SM, HW, and NHA were involved in the overall study in its implementation, data analysis, and manuscript writing. All authors read and approved the final manuscript.

Acknowledgements

icddr,b acknowledges the commitment of NIID to its research efforts. MA Acknowledges the support of Richard Bradley Sack of the Johns Hopkins University, USA. icddr,b acknowledges with gratitude the Governments of Bangladesh, Canada, Sweden, and the UK for providing core/unrestricted support.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

Data sharing not applicable to this article.

Declaration

This research study was approved by the icddr,b institutional review board.
Prior informed consent was obtained from parents or legal guardians of the children who participated in this study.
This study was presented in the 49th US-Japan cholera panel meeting held in 2015 in Gainesville, Florida, USA.

Funding

This research was partially supported by the National Institute of Infectious Diseases (NIID), Japan and icddr,b.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Ramakrishna BS. The normal bacterial flora of the human intestine and its regulation. J Clin Gastroenterol. 2007;41:S2–6.CrossRef Ramakrishna BS. The normal bacterial flora of the human intestine and its regulation. J Clin Gastroenterol. 2007;41:S2–6.CrossRef
2.
Zurück zum Zitat Ann M, O’Hara FS. The gut flora as a forgotten organ. EMBO Rep. 2006;6:688–93. Ann M, O’Hara FS. The gut flora as a forgotten organ. EMBO Rep. 2006;6:688–93.
4.
Zurück zum Zitat Handbook of Integrated Management of Childhood Illness. 2005. Reference Guide, Appendix 3. WHO/UNICEF. Handbook of Integrated Management of Childhood Illness. 2005. Reference Guide, Appendix 3. WHO/UNICEF.
6.
Zurück zum Zitat Monira S, Nakamura S, Gotoh K, Izutsu K, Watanabe H, Alam NH, Endtz HP, Cravioto A, Ali SI, Nakaya T, et al. Gut microbiota of healthy and malnourished children in bangladesh. Front Microbiol. 2011;2:228.CrossRefPubMedPubMedCentral Monira S, Nakamura S, Gotoh K, Izutsu K, Watanabe H, Alam NH, Endtz HP, Cravioto A, Ali SI, Nakaya T, et al. Gut microbiota of healthy and malnourished children in bangladesh. Front Microbiol. 2011;2:228.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Monira S, Nakamura S, Gotoh K, Izutsu K, Watanabe H, Alam NH, Nakaya T, Horii T, Ali SI, Iida T, Alam M. Metagenomic profile of gut microbiota in children during cholera and recovery. Gut Pathog. 2013;5:1.CrossRefPubMedPubMedCentral Monira S, Nakamura S, Gotoh K, Izutsu K, Watanabe H, Alam NH, Nakaya T, Horii T, Ali SI, Iida T, Alam M. Metagenomic profile of gut microbiota in children during cholera and recovery. Gut Pathog. 2013;5:1.CrossRefPubMedPubMedCentral
8.
Zurück zum Zitat Measuring Change in Nutritional Status. Guide lines for Assessing the Nutritional Impact of Supplementary Feeding Programmes for Vulnerable Groups. Geneva: World Health Organization; 1983. Measuring Change in Nutritional Status. Guide lines for Assessing the Nutritional Impact of Supplementary Feeding Programmes for Vulnerable Groups. Geneva: World Health Organization; 1983.
9.
Zurück zum Zitat CLSI. Performance standards for antimicrobial susceptibility testing: twentieth informational supplement. Wayne: CLSI; 2010. CLSI. Performance standards for antimicrobial susceptibility testing: twentieth informational supplement. Wayne: CLSI; 2010.
10.
Zurück zum Zitat Chowdhury NR, Chakraborty S, Ramamurthy T, Nishibuchi M, Yamasaki S, Takeda Y, et al. Molecular evidence of clonal Vibrio parahaemolyticus pandemic strains. Emerg Infect Dis. 2000;6:631–6.CrossRefPubMedPubMedCentral Chowdhury NR, Chakraborty S, Ramamurthy T, Nishibuchi M, Yamasaki S, Takeda Y, et al. Molecular evidence of clonal Vibrio parahaemolyticus pandemic strains. Emerg Infect Dis. 2000;6:631–6.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Kado CI, Liu ST. Rapid procedure for detection and isolation of large and small plasmids. J Bacteriol. 1981;145:1365–73.PubMedPubMedCentral Kado CI, Liu ST. Rapid procedure for detection and isolation of large and small plasmids. J Bacteriol. 1981;145:1365–73.PubMedPubMedCentral
12.
Zurück zum Zitat Khan A, Das SC, Ramamurthy T, et al. Antibiotic resistance, virulence gene, and molecular profiles of Shiga toxin-producing Escherichia coli isolates from diverse sources in Calcutta, India. J Clin Microbiol. 2002;40:2009–15.CrossRefPubMedPubMedCentral Khan A, Das SC, Ramamurthy T, et al. Antibiotic resistance, virulence gene, and molecular profiles of Shiga toxin-producing Escherichia coli isolates from diverse sources in Calcutta, India. J Clin Microbiol. 2002;40:2009–15.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Nguyen MCP, Woerther P-L, Bouvet M, Andremont A, Leclercq R, Cannu A. Escherichia coli as reservoir for macrolide resistance genes. Emerg Infect Dis. 2009;15:1648–50.CrossRefPubMedCentral Nguyen MCP, Woerther P-L, Bouvet M, Andremont A, Leclercq R, Cannu A. Escherichia coli as reservoir for macrolide resistance genes. Emerg Infect Dis. 2009;15:1648–50.CrossRefPubMedCentral
14.
Zurück zum Zitat Saenz Y, Brinas L, Dominguez E, Ruiz J, Zarazaga M, Vila J, Torres C. Mechanisms of resistance in multiple-antibiotic-resistant Escherichia coli strains of human, animal, and food origins. Antimicrob Agents Chemother. 2004;48:3996–4001.CrossRefPubMedPubMedCentral Saenz Y, Brinas L, Dominguez E, Ruiz J, Zarazaga M, Vila J, Torres C. Mechanisms of resistance in multiple-antibiotic-resistant Escherichia coli strains of human, animal, and food origins. Antimicrob Agents Chemother. 2004;48:3996–4001.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Chen S, Zhao S, White DG, Schroeder CM, Lu R, Yang H, McDermott PF, Ayers S, Meng J. Characterization of multiple-antimicrobial-resistant Salmonella serovars isolated from retail meats. Appl Environ Microbiol. 2004;70(1):1.CrossRefPubMedPubMedCentral Chen S, Zhao S, White DG, Schroeder CM, Lu R, Yang H, McDermott PF, Ayers S, Meng J. Characterization of multiple-antimicrobial-resistant Salmonella serovars isolated from retail meats. Appl Environ Microbiol. 2004;70(1):1.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Zhang H, Shi L, Li L, Guo S, Zhang X, Yamasaki S, Miyoshi S, Shinoda S. Identification and characterization of class 1 integron resistance gene cassettes among Salmonella strains isolated from healthy humans in China. Microbial Immunol. 2004;48(9):639–45.CrossRef Zhang H, Shi L, Li L, Guo S, Zhang X, Yamasaki S, Miyoshi S, Shinoda S. Identification and characterization of class 1 integron resistance gene cassettes among Salmonella strains isolated from healthy humans in China. Microbial Immunol. 2004;48(9):639–45.CrossRef
17.
Zurück zum Zitat Hochhut B, Lotfi Y, Mazel D, Faruque SM, Woodgate R, Waldor MK. Molecular analysis of antibiotic resistance gene clusters in Vibrio cholerae O139 and O1 SXT constins. Antimicrob Agents Chemother. 2001;45(11):2991–3000.CrossRefPubMedPubMedCentral Hochhut B, Lotfi Y, Mazel D, Faruque SM, Woodgate R, Waldor MK. Molecular analysis of antibiotic resistance gene clusters in Vibrio cholerae O139 and O1 SXT constins. Antimicrob Agents Chemother. 2001;45(11):2991–3000.CrossRefPubMedPubMedCentral
18.
Zurück zum Zitat Calva JJ, Sifuentes-Osornio J, Cerón C. Antimicrobial resistance in fecal flora: longitudinal community-based surveillance of children from urban mexico. Antimicrob Agents Chemother. 1996;40:1699–702.PubMedPubMedCentral Calva JJ, Sifuentes-Osornio J, Cerón C. Antimicrobial resistance in fecal flora: longitudinal community-based surveillance of children from urban mexico. Antimicrob Agents Chemother. 1996;40:1699–702.PubMedPubMedCentral
19.
Zurück zum Zitat Millar MR, Walsh TR, Linton CJ, Zhang S, Leeming JP, Bennett PM, The ALSPAC Study Team. Carriage of antibiotic-resistant bacteria by healthy children. J Antimicrob Chemother. 2001;47:605–10.CrossRefPubMed Millar MR, Walsh TR, Linton CJ, Zhang S, Leeming JP, Bennett PM, The ALSPAC Study Team. Carriage of antibiotic-resistant bacteria by healthy children. J Antimicrob Chemother. 2001;47:605–10.CrossRefPubMed
20.
Zurück zum Zitat Subramanian S, Huq S, Yatsunenko T, Haque R, Mahfuz M, Alam MA, Benezra A, DeStefano J, Meier MF, Muegge BD, et al. Persistent gut microbiota immaturity in malnourished Bangladeshi children. Nature. 2014;510:417–21.PubMedPubMedCentral Subramanian S, Huq S, Yatsunenko T, Haque R, Mahfuz M, Alam MA, Benezra A, DeStefano J, Meier MF, Muegge BD, et al. Persistent gut microbiota immaturity in malnourished Bangladeshi children. Nature. 2014;510:417–21.PubMedPubMedCentral
21.
Zurück zum Zitat Lester SC, Pilar M, Wang F, Schael IP, Jiang H, O’Brien TF. The Carriage of Escherichia coli resistant to antimicrobial agents by healthy children in boston, in Caracas, Venezuela, and in Qin Pu, China. NEJM. 1990;323:285–9.CrossRefPubMed Lester SC, Pilar M, Wang F, Schael IP, Jiang H, O’Brien TF. The Carriage of Escherichia coli resistant to antimicrobial agents by healthy children in boston, in Caracas, Venezuela, and in Qin Pu, China. NEJM. 1990;323:285–9.CrossRefPubMed
22.
Zurück zum Zitat Barreto A, Guimaraes B, Radhouani H, et al. Detection of antibiotic resistant E. coli and Enterococcus spp. in healthy growing children in Portugal. J Basic Microbiol. 2009;49:503–12.CrossRefPubMed Barreto A, Guimaraes B, Radhouani H, et al. Detection of antibiotic resistant E. coli and Enterococcus spp. in healthy growing children in Portugal. J Basic Microbiol. 2009;49:503–12.CrossRefPubMed
23.
Zurück zum Zitat Jannine KB, Pinyon JL, Anantham S, Hall RM. Commensal Escherichia coli of healthy humans: a reservoir for antibiotic-resistance determinants. J Med Microbiol. 2010;59:1331–9.CrossRef Jannine KB, Pinyon JL, Anantham S, Hall RM. Commensal Escherichia coli of healthy humans: a reservoir for antibiotic-resistance determinants. J Med Microbiol. 2010;59:1331–9.CrossRef
24.
25.
Zurück zum Zitat Keller RE, Pedroso MZ, Ritchmann R, Silva RM. Occurrence of virulence-associated properties in Enterobacter cloacae. Infect Immun. 1998;66:645–9.PubMedPubMedCentral Keller RE, Pedroso MZ, Ritchmann R, Silva RM. Occurrence of virulence-associated properties in Enterobacter cloacae. Infect Immun. 1998;66:645–9.PubMedPubMedCentral
26.
Zurück zum Zitat Sanders CC, Sanders WE. Emergence of resistance during therapy with the newer β-lactam antibiotics: role of inducible β-lactamase and implications for the future. Rev Infect Dis. 1983;5:639–48.CrossRefPubMed Sanders CC, Sanders WE. Emergence of resistance during therapy with the newer β-lactam antibiotics: role of inducible β-lactamase and implications for the future. Rev Infect Dis. 1983;5:639–48.CrossRefPubMed
27.
Zurück zum Zitat Then RL. Ability of newer beta-lactam antibiotics to induce beta-lactamase production in Enterobacter cloacae. Eur J Clin Microbiol. 1987;6:451–5.CrossRefPubMed Then RL. Ability of newer beta-lactam antibiotics to induce beta-lactamase production in Enterobacter cloacae. Eur J Clin Microbiol. 1987;6:451–5.CrossRefPubMed
28.
29.
Zurück zum Zitat Mondal D, Ganguli B, Roy SS, Halder B, Banerjee N, Banerjee M, Samanta M, Giri AK, Polya DA. Diarrhoeal health risks attributable to water-borne-pathogens in arsenic-mitigated drinking water in West Bengal are largely independent of the microbiological quality of the supplied water. Water. 2014;6:1100–17. doi:10.3390/w6051100.CrossRef Mondal D, Ganguli B, Roy SS, Halder B, Banerjee N, Banerjee M, Samanta M, Giri AK, Polya DA. Diarrhoeal health risks attributable to water-borne-pathogens in arsenic-mitigated drinking water in West Bengal are largely independent of the microbiological quality of the supplied water. Water. 2014;6:1100–17. doi:10.​3390/​w6051100.CrossRef
30.
Zurück zum Zitat De Filippo C, Cavalieri D, Di Paola M, Ramazzotti M, Poullet JB, Massart S, Collini S, Pieraccini G, Lionetti P. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proc Natl Acad Sci USA. 2010;107:14691–6.CrossRefPubMedPubMedCentral De Filippo C, Cavalieri D, Di Paola M, Ramazzotti M, Poullet JB, Massart S, Collini S, Pieraccini G, Lionetti P. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proc Natl Acad Sci USA. 2010;107:14691–6.CrossRefPubMedPubMedCentral
31.
Zurück zum Zitat London N, Nijsten R, Bogaard AVD, Stobberingh E. Carriage of antibiotic-resistant Escherichia coli by healthy volunteers during a 15-week period. Infection. 1994;22:187–92.CrossRefPubMed London N, Nijsten R, Bogaard AVD, Stobberingh E. Carriage of antibiotic-resistant Escherichia coli by healthy volunteers during a 15-week period. Infection. 1994;22:187–92.CrossRefPubMed
32.
Zurück zum Zitat Nys S, Okeke IN, Kariuki S, Dinant GJ, Driessen C, Stobberingh EE. Antibiotic resistance of faecal Escherichia coli from healthy volunteers from eight developing countries. J Antimicrob Chemoth. 2004;54:952–5.CrossRef Nys S, Okeke IN, Kariuki S, Dinant GJ, Driessen C, Stobberingh EE. Antibiotic resistance of faecal Escherichia coli from healthy volunteers from eight developing countries. J Antimicrob Chemoth. 2004;54:952–5.CrossRef
34.
Zurück zum Zitat Strahilevitz J, Jacoby GA, Hooper DC, Robicsek A. Plasmid-mediated quinolone resistance: a multifaceted threat. Clin Microbiol Rev. 2009;22(4):664–89.CrossRefPubMedPubMedCentral Strahilevitz J, Jacoby GA, Hooper DC, Robicsek A. Plasmid-mediated quinolone resistance: a multifaceted threat. Clin Microbiol Rev. 2009;22(4):664–89.CrossRefPubMedPubMedCentral
35.
Zurück zum Zitat Sasakawa C, Kamata K, Sakai T, Murayama SY, Makino S, Osikawa MI. Molecular alteration of the 140-megadalton plasmid associated with loss of virulence and Congo red binding activity in Shigella flexneri. Infect Immun. 1986;51:470–5.PubMedPubMedCentral Sasakawa C, Kamata K, Sakai T, Murayama SY, Makino S, Osikawa MI. Molecular alteration of the 140-megadalton plasmid associated with loss of virulence and Congo red binding activity in Shigella flexneri. Infect Immun. 1986;51:470–5.PubMedPubMedCentral
36.
Zurück zum Zitat Karami N, Nowrouzian F, Adlerberth I, Wold AE. Tetracycline resistance in Escherichia coli and persistence in the infantile colonic microbiota. Antimicrob Agents Chemother. 2006;50:156–61.CrossRefPubMedPubMedCentral Karami N, Nowrouzian F, Adlerberth I, Wold AE. Tetracycline resistance in Escherichia coli and persistence in the infantile colonic microbiota. Antimicrob Agents Chemother. 2006;50:156–61.CrossRefPubMedPubMedCentral
37.
Zurück zum Zitat Brinas L, Zarazaga M, Saenz Y, Ruiz-Larrea F, Torres C. Beta-lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob Agents Chemother. 2002;46:3156–63.CrossRefPubMedPubMedCentral Brinas L, Zarazaga M, Saenz Y, Ruiz-Larrea F, Torres C. Beta-lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob Agents Chemother. 2002;46:3156–63.CrossRefPubMedPubMedCentral
38.
Zurück zum Zitat Fang H, Ataker F, Hedin G, Dornbusch K. Molecular epidemiology of extended-spectrum beta-lactamases among Escherichia coli isolates collected in a Swedish hospital and its associated health care facilities from 2001 to 2006. J Clin Microbiol. 2008;46:707–12.CrossRefPubMed Fang H, Ataker F, Hedin G, Dornbusch K. Molecular epidemiology of extended-spectrum beta-lactamases among Escherichia coli isolates collected in a Swedish hospital and its associated health care facilities from 2001 to 2006. J Clin Microbiol. 2008;46:707–12.CrossRefPubMed
39.
Zurück zum Zitat Yan JJ, Hong CY, Ko WC, Chen YJ, Tsai SH, Chuang CL, Wu JJ. Dissemination of blaCMY-2 among Escherichia coli isolates from food animals, retail ground meats, and humans in southern Taiwan. Antimicrob Agents Chemother. 2004;48:1353–6.CrossRefPubMedPubMedCentral Yan JJ, Hong CY, Ko WC, Chen YJ, Tsai SH, Chuang CL, Wu JJ. Dissemination of blaCMY-2 among Escherichia coli isolates from food animals, retail ground meats, and humans in southern Taiwan. Antimicrob Agents Chemother. 2004;48:1353–6.CrossRefPubMedPubMedCentral
40.
Zurück zum Zitat Doi Y, Shibata N, Shibayama K, et al. Characterization of a novel plasmid-mediated cephalosporinase (CMY-9) and its genetic environment in an Escherichia coli clinical isolate. Antimicrob Agents Chemother. 2002;46:2427–34.CrossRefPubMedPubMedCentral Doi Y, Shibata N, Shibayama K, et al. Characterization of a novel plasmid-mediated cephalosporinase (CMY-9) and its genetic environment in an Escherichia coli clinical isolate. Antimicrob Agents Chemother. 2002;46:2427–34.CrossRefPubMedPubMedCentral
41.
Zurück zum Zitat Jones LA, McIver CJ, Kim MJ, Rawlinson WD, White PA. The aadB gene cassette is associated with blaSHV genes in Klebsiella species producing extended-spectrum beta-lactamases. Antimicrob Agents Chemother. 2005;49:794–7.CrossRefPubMedPubMedCentral Jones LA, McIver CJ, Kim MJ, Rawlinson WD, White PA. The aadB gene cassette is associated with blaSHV genes in Klebsiella species producing extended-spectrum beta-lactamases. Antimicrob Agents Chemother. 2005;49:794–7.CrossRefPubMedPubMedCentral
Metadaten
Titel
Multi-drug resistant pathogenic bacteria in the gut of young children in Bangladesh
verfasst von
Shirajum Monira
Syeda Antara Shabnam
Sk. Imran Ali
Abdus Sadique
Fatema-Tuz Johura
Kazi Zillur Rahman
Nur Haque Alam
Haruo Watanabe
Munirul Alam
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
Gut Pathogens / Ausgabe 1/2017
Elektronische ISSN: 1757-4749
DOI
https://doi.org/10.1186/s13099-017-0170-4

Weitere Artikel der Ausgabe 1/2017

Gut Pathogens 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.