Background
Lung cancer is one of the most common malignancies in the world that responsible for a considerable proportion cancer death [
1]. The high mortality of lung cancer is largely due to the common diagnosis at advanced stages that impedes the curative treatment [
2]. Without effective measures for early diagnosis where the tumors are still operable, and the lack of therapeutic options when the tumor is inoperable. These are the reasons why the five-year survival rate of NSCLC patients is less than 20% [
3]. Cisplatin (DDP) is used as a first-line agent in the treatment of those postoperative or inoperable NSCLC patients [
4]. The cancer-related death was previously demonstrated to decrease in the NSCLC patients who received DDP chemotherapy for 5 years compared to those untreated patients [
5]. Nevertheless, individuals differently respond to DDP therapy and continuous DDP administration usually results in the occurrence of chemo-resistance, which frequently failed the clinical treatment [
6]. Nowadays, DDP resistance is considered to be one of the most important impediments to the therapy of NSCLC patients.
MicroRNA (miRNA), featured by the short sequence (approximately 18–23 nucleotides), is a common subtype of endogenous non-coding RNA molecules [
7]. The implication of miRNAs in modulating tumor-related gene expression have been well documented by numerous researches, showing it may function as a tumor repressor or an oncogene [
8]. Accumulating data suggest that the tumor DDP-resistance could be modified by miRNAs [
9], lighting up a novel research direction for tumor cell chemo-resistance. MiR-133a was revealed to be downregulated in NSCLC, and its expression level was negatively correlated with the lymphatic metastasis, tumor volume and clinical TNM stages [
10]. In functional level, miR-133a was demonstrated to repress NSCLC cell proliferation and invasion in vitro [
11,
12], however, up to now, there still has no study is performed to investigate whether miR-133a involves in the emergence of NSCLC chemo-resistance. Our preliminary bioinformatics experimental results predicted that HOXB13 could be targeted by miR-133a. Furthermore, HOXB13 is a specific transcription factor of prostate-lineage that predominately existed in the tail bud in the development of embryonic stage [
13]. Recently, HOXB13 was reported to confer the DDP-resistance to lung cancer cells through networking with ABCG1/EZH2/Slug [
14]. However, the molecular mechanisms of HOXB13 in DDP-resistance of NSCLC cells involved are still unclear.
As another important subtype of non-coding RNAs, long non-coding RNA (lncRNA) with more than 200 nucleotides has also revealed to affect the chemo-resistance of NSCLC through multiple mechanisms [
15,
16]. Recently, lncRNA SNHG14 silencing was reported to repress NSCLC progression and enhance the NSCLC cell sensitivity to DDP [
17]. According to bioinformatics prediction, lncRNA SNHG14 was a target of miR-133a.Therefore, we aimed to investigate whether lncRNA SNHG14 involves in the DDP-resistance of NSCLC cells by interacting with miR-133a/HOXB13 axis.
Methods
NSCLC cell lines and transfection
The parental NSCLC cell (A549) and DDP-resistant NSCLC cell (A549/DDP) were purchased from Cell bank of Chinese Academy of Sciences (Shanghai, China). Both A549 and A549/DDP cells were maintained in DMEM supplemented with fetal bovine serum (10%, Sigma, USA), penicillin (100 U/ml, Sigma) and streptomycin (100 mg/ml, Sigma) under 5% CO2 and 95% air. Thee specific sh-SNHG14, miR-133a mimics, miR-133a inhibitor, pcDNA3.1-HOXB13 (pc-HOXB13), and corresponding negative control (NC) were obtained from GenePharma (Shanghai, China). All these oligonucleotides were transfected into A549/DDP cells using Lipofectamine 3000 (Invitrogen, USA) following the instructions of manufacturers. After 48 h of transfection, cells were harvested for further research.
Quantitative real-time PCR (qRT-PCR) analysis
TRIzol reagent (Invitrogen) was adopted to extract RNAs from indicated cells were prepared following the manufacturers’ protocol. The RNA quality was determined via a NanoDrop 2000 instrument (Thermo Scientific, USA), and 5 μg RNA was used as template to synthesis cDNA using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, USA). SYBR Premix Ex Taq Kit (Takara, Tokyo) was adopted to conduct qRT-PCR on an ABI Prism 7700 system (PE Applied Biosystems, USA). Fold changes in RNA relative expression was counted through the 2
–ΔΔCt method. Primers were summarized as follows:
-
SNHG14: forward, 5′-GGGTGTTTACGTAGACCAGAACC-3′; reverse, 5′-CTTCCAAAAGCCTTCTGCCTTAG-3′
-
miR-133a: forward, 5′-CTGCAGCTGGAGAGTGTGCG-3′; reverse, 5′-GTGCTCTGGAGGCTAGAGGT-3′
-
HOXB13: forward, 5′-ATGGAGCCCGGCAATTATGCCACC-3′; reverse, 5′-TTAAGGGGTAGCGCTGTTCTT-3′
-
GAPDH: forward, 5′-GGCGTTCTCTTTGGAAAGGTGTTC-3′; reverse, 5′- GTACTCAGCGGCCAGCATCG -3′
-
U6: forward 5′-CTC GCT TCG GCA GCA CA-3′, reverse 5′-AAC GCT TCA CGA ATT TGC GT-3′
Cell proliferation viability analysis (CCK-8 and colony formation)
After 48 h of transfection, exponentially growing A549/DDP cells (1 × 105 cells/well) were harvested and plated into 96-well plates supplemented with DDP (0, 2, 4, 6, AND 8 μg/ml), and then the proliferation viability of A549/DDP cells were tested by the Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Japan) and colony formation assays after 24 h of DDP incubation. For CCK-8, the CCK-8 solution (200 μl) was added to the each well and then incubated at 37 °C for 2 h. The absorbance was measured by a microplate reader (Bio-Rad Laboratories, USA) at 450 nm. For colony formation assay, indicated A549/DDP cells (2000 cells/dish) were seeded into 35-mm culture dish and maintained at 37 °C. After 2 weeks, the visible colonies were fixed in 4% paraformaldehyde for 0.5 h, stained with 0.1% crystal violet solution for 10 min, and counted using a microscope.
Cell cycle and apoptosis analysis
The A549/DDP cell cycle and apoptosis were estimated using flow cytometry. In brief, 48 h after transfection, cells were harvested for DDP treatment for additional 24 h. For the cell cycle assay, A549/DDP cells were fixed in 75% alcohol for 30 min, and then stained with propidium idoide (Sigma, MO, USA) for 15 min in dark. For cell apoptosis analysis, A549/DDP cells were washed with PBS followed by staining with Annexin V/PI kit (Vazyme, Nanjing, China) following the instructions of manufacturer. Finally, a BD Biosciences FACSCalibur Flow Cytometer (BD Biasciences, USA) was applied to detect the cell cycle and apoptosis.
Dual-luciferase reporter assay
The wide type and mutant type miR-133a binding sequence of lncRNA SNHG14 and HOXB13 mRNA 3′-UTR were sub-cloned into the pmirGLO vector (Promega, Madison, USA) and named as SNHG14-WT, HOXB13-WT, SNHG14-MUT, and HOXB13-MUT, respectively. A549/DDP cells (1 × 106 cells/wel) seeded in 96-well plates were co-transfected with constructed recombinant luciferase vectors and miR-133a mimics or mimics NC using Lipofectamine 3000 (Invitrogen). Luciferase intensity of A549/DDP cell was examined using the Dual-Luciferase Reporter Assay System (Promega) after 48 h of co-transfection.
Western blot assay
Total proteins of indicated A549/DDP cells were isolated using the RIPA buffer (Beyotime, Beijing, China) contained protease inhibitors (Roche, Germany). Protein samples (50 μg) were isolated via 10% SDS-PAGE and then transferred into polyvinylidene difluoride (PVDF) membranes (Millipore, UK). After incubated in 5% skimmed milk for 2 h, the membranes were subjected for probe of primary antibodies that against Bcl-2 (1:2000, ab491583, Abcam), Bax (1:1000, ab199677, Abcam), cleaved-caspase-3 (1:1000, orb227889, Biorbyt) and HOXB13 (1:2000, ab53931, Abcam) overnight. Subsequently, the membranes were washed with PBS and then probed with corresponding secondary antibodies conjugated with horseradish peroxidase for 2 h. The signals were visible using an enhanced chemiluminescent reagent (ECL, Germany).
Statistical analysis
All experiments were performed at least three times. Data were presented as mean ± standard deviation (SD), and all statistical analyses were conducted on SPSS (19.0 vision, IBM). Student’s t test or one-way analysis of variance followed by Tukey post hoc test was applied for the analysis of the difference between two or more groups. P value less than 0.05 was considered significant.
Discussion
Although the exact mechanisms underlying DDP-resistance remain largely unclear, it is certain that this problem could not be conquered through targeting any single mechanism strategy [
18,
19]. Galuzzi et al. have proposed four distinct DDP-resistance mechanisms: (i), by reducing the cellular concentration of DDP to prevent its binding with DNA; (ii), repairing the DDP-DNA adducts; (iii), restoring the dysregulated signaling pathways in response to DNA damage caused by DDP; (iiii), through indirect mechanisms that do not involve DDP-related signals but confer resistance to DDP-induced death [
20]. Considering the substantial genes, proteins and signal cascades involved in the emergence of DDP-resistance [
21], it is likely to fail if we focus on any single mechanism-targeted strategy. Here, we demonstrated that lncRNA SNHG14, through miR-133a/HOXB13 pathway, played as a regulator during the development of DDP-resistance of NSCLC cells, providing a novel signal cascade that may be used as a promising therapeutic target for the overcome of DDP-resistance of NSCLC.
With the advancement of technologies in DNA sequencing and bioinformatics analysis, numerous of lncRNAs and miRNAs have been proven to be involved in the drug-resistance of NSCLC through multiple mechanisms [
16,
22]. For example, Ma LY et al. have shown the repressive effects of lncRNA TRPM2-AS knockdown on NSCLC cell DDP-resistance, moreover, they also demonstrated this effects was p53- p66shc pathway dependent [
23]. Moreover, miR-488 was revealed to repress NSCLC cell proliferation and reduce NSCLC cell sensitivity to DDP via the activation of eIF3a-mediated NER signaling cascade [
24]. LncRNA SNHG14 participates in the progression of various human tumors, such as glioma, cervical cancer and NSCLC [
25‐
27]. Recently, it was also involved in the drug-resistance of tumor cells. Dong H et al. reported that SNHG14 enhanced the trastuzumab resistance of breast cancer cells by modulating PABPC1 level trough H3K27 acetylation [
28]. Moreover, SNHG14 was proved to confer gefitinib resistance in NSCLC cell by increasing ABCB1 level through sponging miR-206-3p [
29]. In line with previous researches, our study found a significant upregulation of lncRNA SNHG14 in A549/DDP cell, and SNHG14 knockdown resulted in an enhancement of DDP-sensitivity of A549/DDP cell.
It was reported that miR-133a could increase the DDP-sensitivity of Hep-2 and vincristine resistant Hep-2v cell through reducing ATP7B level [
30]. Although miR-133a plays a role in the multiple biological processes of NSCLC cell, including proliferation, migration and invasion [
11,
12], its implication in NSCLC DDP-resistance remains no report. In this study, we found miR-133a was downregulated in DDP-resistant A549/DDP cells, and its overexpression increased the DDP-sensitivity of A549/DDP cells. Taken together, lncRNA SNHG14 and miR-133a were involved in the DDP-resistance of NSCLC.
The involvement of lncRNAs in tumor cell drug-resistance is largely mediated by miRNAs and thus affected their downstream target genes [
31]. For instance, LncRNA SNHG14 was demonstrated to increase gemcitabine resistance of pancreatic cancer cells by interacting with miR-101 [
32]. In the present study, lncRNA SNHG14 was firstly found to compete with HOXB13 for miR-133a binding. Functionally, miR-133a inhibition abolished the repressive effects of sh-SNHG14 on DDP-resistance and HOXB13 expression. Moreover, HOXB13 overexpression reversed the enhanced effects of miR-133a on the sensitivity of A549/DDP cell to DDP.
Conclusion
In conclusion, our findings provided evidences that lncRNA SNHG14 regulated the DDP-resistance of NSCLC cell in vitro by increasing HOXB13 expression through miR-133a. Thus, lncRNA SNHG14/miR-133a/HOXB13 regulatory network might be promising therapeutic target for NSCLC drug-resistance.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.