Background
Lung cancer, known as one of the most common occurring cancers worldwide, has been shown to be so deadly that it causes many millions of deaths per year [
1,
2]. When discussing lung cancer, there are three main kinds of lung cancers that are prevalent to patients worldwide. These three types of lung cancer are; lung adenocarcinoma (LAC), squamous-cell carcinoma and small-cell carcinoma, among which LAC has been found to be the most common type of lung cancers. It has been found that LAC accounts for 40% of all lung cancers, with the morbidity rate increasing in the west and Asia [
3]. Because it is the most frequent subtype of non-small cell lung cancer (NSCLC), LAC causes more than 500,000 deaths each year worldwide, carrying with it a poor survival rate of about 15% within five years of the initial diagnosis [
4]. In terms of treatment options, computed tomography (CT) screening has been extensively used in order to diagnose early-staged LAC. Furthermore, it is very typical for complete resection to be accompanied by follow-up, with surveillance monitoring usually being adopted thereafter. Nevertheless, majority of patients still suffer from the reoccurring LAC [
5]. Moreover, cisplatin has been shown to be essential when treating LAC, with its sensitivity to cisplatin being directly associated to the prognosis [
6]. In previous studies, by inhibiting contactin-1, the sensitivity levels of LAC increase, thereby affecting the chemotherapeutic efficacy related to cisplatin based regimens among patients suffering from LAC [
7].
Checkpoint kinase 1 (CHEK1) is implicated in regulating and identifying DNA damage [
8]. CHEK1 has been shown to be highly expressed in lung cancer cells, and importantly, miR-195 has been demonstrated to inhibit the progression and development of NSCLC by targeting CHEK1 [
9]. MicroRNAs (miRNAs) and long noncoding RNAs (lncRNAs) have been shown to have the ability to regulate the ability of regulating each other’s biological progression, particularly, the sponge-like function of lncRNAs, which can lead to complex miRNA interactome [
10]. The low expression of miR-195 has an effect on patients suffering from LAC [
11]. Furthermore, the noncoding genome elements are involved in normal physiology and human diseases [
12]. Among other potential tumor suppressors, differentially expressed lncRNAs have been reported to be among them, when discussing LAC [
13]. Moreover, miR-326 has been shown to regulate chemoresistance in LAC cells by binding to specificity protein 1 [
14]. Furthermore, miR-195 has been shown to be correlated to chemotherapy sensitivity to cisplatin in gastric cancer cells [
15]. Based on the aforementioned findings, we proposed a hypothesis that the LINC00485/miR-195/CHEK1 may be implicated in LAC. And we explored the mechanisms LINC00485 regulating CHEK1 through competitively binding to miR-195 in cisplatin sensitivity of LAC.
Materials and methods
Microarray analysis
The profiles of LAC related genes and miRNAs were from the Cancer Genome Atlas (TCGA) database (
http://cancergenome.nih.gov/), and analyzed via the R language software. The differential gene analysis used edgeR package in R [
16]. False positive discovery (FDR) correction was applied on
p value with package multi-test. FDR < 0.05 and |log2 (fold change)| > 2 were considered as the screening criteria to select differentially expressed genes (DEGs) and differentially expressed miRNAs.
Study subjects
The normal human lung epithelial cell line Beas-2B, along with the LAC cell lines A549, H1299, GLC-82 and 95D, were all purchased from Shanghai Cell Bank, Chinese Academy of Sciences (Shanghai, China) and cultured in Roswell Park Memorial Institute (RPMI) 1640 medium containing 10% fetal bovine serum (FBS) at 37 °C with 5% CO2. The culture medium was changed every 2–3 days according to cell growth. When cell confluence reached 80%–90%, cells were passaged. The two cells with the highest expression of LINC00485 were screened out by reverse transcription quantitative polymerase chain reaction (RT-qPCR) for the subsequent experiments.
Cell treatment
The sequences of LINC00485 and miR-195 were retrieved from Genbank. The following plasmids were all constructed by Shanghai Sangon Biotech Company (Shanghai, China), and used to transfect LAC cells; the empty plasmid, LINC00485 plasmid, LINC00485 negative control (NC) plasmid, si-LINC00485 plasmid, miR-195 NC plasmid, miR-195 plasmid, anta-miR-195 NC plasmid and anta-miR-195 plasmid. CHEK1 vectors were purchased from Abcam Inc. (Cambridge, MA, USA).
The day before transfection, the cells were seeded into a 6-well plate. When the density reached 30% to 50%, the transfection was conducted according to the instructions of the lipofectamine 2000 kit. Afterwards, 100 pmol plasmid (final concentration: 50 nM) was diluted with 250 μL serum-free medium (Opti-minimal essential medium [MEM], 51985042, Gibco, Gaitherburg, MD, USA) and mixed slightly and incubated for 5 min, with 5 μL lipofectamine 2000 being diluted with another 250 μL of serum-free medium and mixed gently and incubated for 5 min. Following the incubation period, the plasmid (100 pmol) and the transfection regent (5 μL) were diluted with 250 μL Opti-MEM and incubated for 5 min. The two solutions were mixed, incubated for 20 min, and added to the cells. The two solutions were then mixed together and added to culture wells after 20 min of incubation. Cells were then cultured for 6–8 h, with the medium being changed and continuing to be cultured for 24–48 h.
RNA fluorescent in situ hybridization (FISH)
The subcellular localization of LINC00485 in LAC cells was identified by FISH according to the instructions of Ribo™ lncRNA FISH Probe Mix (Red) (RiboBio Company, Guangzhou, China). The cover glass was placed in a 24-well plate, and the cells were seeded at a density of 6 × 104 cells/well. The cover glass was fixed with 1 mL 4% polyformaldehyde. Following treatment with protease K (2 μg/mL), glycine, and acetylation reagents, 250 μL of pre-hybridization solution was added to the cells for 1 h of incubation at 42 °C. The pre-hybridization solution was removed, and the cells were incubated with 250 μL of hybridization solution, which contained 300 ng/mL, and was probed at 42 °C overnight. Cells were then added with phosphate-buffered saline/Tween (PBST), and diluted with 4′,6-diamidino-2-phenylindole (DAPI) (1:800) in order to stain the nucleus. Following the staining period, cells were then seeded into a 24-well plate for a staining period which lasted 5 min. Cells were then sealed with anti-fluorescence quencher, observed and photographed under a fluorescence microscope (Olympus, Tokyo, Japan) with 5 different fields.
Dual luciferase reporter gene assay
In order to predict the target genes of miR-195, a bioinformatics prediction website was used. The 3′-untranslated region (3′ UTR) sequence of CHEK1 and LINC00485 was obtained via PCR amplification. The target segments were digested via the Xho I and Not I restriction endonuclease, and cloned into the pmirGLO vector (3577193, Promega, Madison, WI, USA) on the downstream of the luciferase reporter gene. The vectors were labeled as pCHEK1-wide-type (Wt) and pLINC00485-Wt, with the plasmids being purified following the sequencing period. The sequence of LINC00485-Wt was 5′-TCCACTTTTTCACATTGCTGTTT-3′ and that of CHEK1-Wt was 5′-AATATAGTGCTGCTATGTTGACA-3′. After that, pCHEK1-mutant-type (Mut) and pLINC00485-Mut were constructed. The sequence of LINC00485-Mut was 5′-TCGGCTTAATCACACGATGATGT-3′ and the sequence of CHEK1-Mut was 5′-AATATAGTGCAATGTTGTTGACG-3. The plasmids were co-transfected with miR-195 mimic or miR-195 NC into LAC cells, respectively. The cells were lysed for 24 h following transfection, and centrifuged at 25,764×g for 1 min in order to collect the supernatant. The Dual-Luciferase® Reporter Assay System (E1910, Promega, Madison, Wisconsin, USA) was applied in order to measure the luciferase activity. Each sample was added with 100 μL of firefly luciferase working solution in order to detect the activity of firefly luciferase. Another 100 μL of renilla luciferase working solution was also added in order to detect the renilla luciferase activity. The firefly luciferase activity rate to renilla luciferase activity rate was used as the relative luciferase activity.
RNA immunoprecipitation (RIP)
The binding of LINC00485 and argonaute 2 (AGO2) protein was verified and conducted according to the instructions of the RIP kit (Millipore Inc., Bedford, MA, USA). Part of the cell extract was used as the input, and the other part was incubated with the antibodies and magnetic beads. The magnetic beads-antibody complexes were re-suspended in 900 μL of RIP wash buffer. In order to collect the magnetic bead-protein complexes, the samples were put on to a magnetic base. RNAs in the samples and input were separately extracted after the detachment by protease K for the subsequent PCR detection. The antibodies for RIP included AGO2 (ab32381, 1:50, Abcam Inc., Cambridge, MA, USA), and immunoglobulin G (IgG) (1:100, ab109489, Abcam Inc., Cambridge, MA, USA) was used as the NC.
RNA pull down
By following the instructions of the Magnetic RNA–Protein Pull-Down Kit (Pierce, Rockford, IL, USA), the biotinylated RNA was mixed with the structural Buffer at 1:500. After that, it was bathed in water at 95 °C for 2 min and on the ice for 3 min, with the magnetic beads being fully re-suspended after. The magnetic bead-RNA complex was washed with 500 μL of washing buffer 3 times and 10 μL of cell lysate was added. By adding 500 μL of RNA pull down washing buffer, the incubated magnetic bead-RNA–protein complex was washed. 10 μL of cell lysate was added in order to serve as the protein input. Following the measurement of the protein concentration, western blot analysis was performed in order to determine the protein expression.
RNA isolation and quantitation
Total RNA was extracted with the miRNeasy Mini Kit (217004, QIAGEN, Duesseldorf, Germany). The primers of LINC00485, miR-195 and CHEK1 were designed and synthesized by Takara (Tokyo, Japan) (Table
1). After the primers were designed and synthesized, the RNA was reversely transcribed into complementary DNA (cDNA) in accordance to the instructions found in the PrimeScript RT kit (RR036A, Takara, Tokyo, Japan. By following the instructions in the SYBR
® Premix Ex TaqTM II kit (RR820A, TaKaRa, Tokyo, Japan), the fluorescence quantitative PCR was able to be carried out by using the ABI 7500 quantitative PCR appliance (7500, ABI, Thermo Fisher Scientific, Waltham, MA, USA). With glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 being used as the internal reference, the mRNA expression of target genes (LINC00485, miR-195, CHEK1) were calculated by using the relative quantitative method (2
−ΔΔCT method):
$${\Delta \Delta \text{Ct} = \Delta \text{Ct}}_{{\text{(experiment group)}}} - {\Delta \text{Ct}}_{{\text{(control group)}}} \text{,}\;{\Delta \text{Ct} = \text{Ct}}_{{\text{(target}\;\text{gene)}}} - \text{Ct}_{{\text{(internal reference)}}} \text{,}\;\text{mRNA expression of target gene = 2}^{{ - {\Delta \Delta \text{Ct}}}}.$$
Table 1
Primer sequences for RT-qPCR
LINC00485 | F: CTCCAAGCAGGGGCTACAAA |
R: CCAGGAGCTCAGAAAGCCAA |
miR-195 | F: CGTAGCAGCACAGAAATATTGGC |
R: CCAGTCTCAGGGTCCGAGGTATTC |
CHEK1 | F: GACTGGGACTTGGTGCAAAC |
R: TGCCATGAGTTGATGGAAGA |
GAPDH | F: CCCACTCCTCCACCTTTGAC |
R: ATGAGGTCCACCACCCTGTT |
U6 | F: ATTGGAACGATACAGAGAAGATT |
R: GGAACGCTTCACGAATTTG |
Western blot analysis
The total protein of cells was extracted using the radioimmunoprecipitation assay (RIPA) lysis buffer (R0010, Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) containing phenylmethylsulfonyl (PMSF). Following the extraction period, 50 μg of protein was dissolved in 2× sodium dodecyl sulfate (SDS) loading buffer, and boiled 100 °C for 5 min. The protein was subjected to SDS–polyacrylamide gel electrophoresis and then transferred to a polyvinylidene fluoride (PVDF) membrane. This membrane was blocked by 5% skimmed milk for 1 h and incubated with diluted mouse anti-human primary antibodies CHEK1 (ratio of 1:10,000, ab40866), Bcl-2-associated X protein (Bax) (ratio of 1:5000, ab32503), B-cell CLL/lymphoma 2 (Bcl-2) (ratio of 1:1000, ab32124), HIF-1α (ratio of 1:2000, ab113642), and vascular endothelial growth factor (VEGF) (ratio of 1:5000, ab32152) overnight at a constant temperature of 4 °C. All the antibodies above were purchased from Abcam Inc. (Cambridge, MA, UK). The membrane was then incubated for 1 h with the secondary antibody horseradish peroxidase (HRP) labeled goat anti-mouse IgG (1:100, HA1003, Shanghai Yan Hui Biotechnology, Inc., Shanghai, China). After the 1 h incubation period, the membrane was then treated with the enhanced chemiluminescence (ECL) solution (ECL808-25, Biomiga, San Diego, CA, USA) for 1 min. The solution was abandoned, and the membrane was covered with plastic wrap and developed by using X-rays (36209ES01, Qcbio Science and Technologies Co., Ltd, Shanghai, China). GAPDH was used as the internal reference, and the ratio of the gray value of target band to the internal reference band was relative to the amount of protein.
Cell counting kit-8 (CCK-8) assay
The cells were inoculated into a 96-well plate 48 h after transfection at a density of 2 × 103 cells/well. Following a 16 h period, the culture medium was replaced by a fresh culture medium containing different concentrations of cisplatin (0, 0.5, 1, 2, 3 μg/mL), with five replicated wells being set at each concentration. Following a 48-h period of drug treatment, the culture medium was replaced by 100 μL of fresh culture medium containing 10% CCK-8, and underwent cultural incubation for 1 h. By using a multi-functional micro plate reader, The absorbance (A) was able to be examined at a 450 nm wavelength, with the inhibitory rate (IR) of cisplatin, which was held at different levels of concentration, being calculated using the following formula: IR (%) = (1 − Ai/A0) × 100% (Ai was the average absorbance of cisplatin groups at each concentration, and A0 was the average absorbance in the group without cisplatin).
Cells were seeded into a 96-well plate at a density of 2.0 × 103 cells/well. After being seeded for a period of 16 h, the culture medium was replaced by a fresh culture medium containing different concentrations of cisplatin (0, 0.5, 1, 2, 3 μg/mL), with five replicated wells each being set at a different concentration. Following a 48-h period of drug treatment, the cells were detached by 0.25% trypsin and resuspended in Dulbecco’s modified Eagles medium (DMEM), which contained 10% FBS. The cells were seeded into a 6-well plate at a density of 1 × 103 cells per well, and then underwent incubation at a level of 5% CO2 at a temperature of 37 °C. Following the incubation period, the culture medium was discarded and the cells were fixed by 4% Polyoxymethylene and stained with Giemsa staining solution for a period of 10 min. Afterwards, the cells were slightly washed and air-dried. The clone cluster was counted directly with the naked eyes, and the rate of colony formation was calculated.
Flow cytometry
All cell groups were seeded into a 6-well plate at a density of 10 × 105 cells/well. Following a 16-h period, the culture medium was replaced by a fresh culture medium containing different concentrations of cisplatin (0, 0.5, 1, 2, 3 μg/mL), with five identical wells each being set at a different concentration. Following 48 h of drug treatment, the cells were centrifuged and re-suspended in 200 μL of binding buffer solution. After that, 10 μL of Annexin V-FITC (ab14085, Abcam Inc, Cambridge, MA, USA) and 5 μL of propidium iodide (PI) were gently mixed and underwent a 15-min period of incubation, while avoiding light. Afterwards, cells were added with 300 μL of binding buffer solution, and the cell apoptosis was detected via FCM at an excitation wavelength of 488 nm.
Statistical analysis
Data were analyzed using SPSS 21.0 software (IBM Corp. Armonk, NY, USA). The measurement data were presented as mean ± standard deviation. Differences between two groups were analyzed by independent t test, and differences among multiple groups were analyzed by one-way analysis of variance (ANOVA). The enumeration data were represented by percentage, and analyzed by Chi square test. p < 0.05 was statistically significant.
Discussion
Lung cancer represents a common cancer worldwide, and LAC is the most often histological type with the highest degree of diversity [
11]. Our study explored roles of LINC00485 as competitive endogenous RNA (ceRNA) of miR-195 in the chemotherapy sensitivity of LAC cells by regulating CHEK1. Consequently, we found that silencing of LINC00485 and restored miR-195 promoted the inhibitory roles of cisplatin on LAC cell proliferation, clone information and enhanced the apoptosis via decreased CHEK1.
To begin with, CHEK1 was found to be highly expressed, while miR-195 was poorly expressed in LAC. We also found that miR-195 targeted CHEK1. Consistent with our study, Liu et al. also demonstrate decreased miR-195 and increased CHEK1 in lung tumors and that CHEK1 is a target gene of miR-195, which down-regulates CHEK in lung cancers cells [
9]. Similarly, the reduced miR-195 expression has been demonstrated in NSCLC, and miR-195 targets cyclin D3 and survivin to mediate tumorigenesis of NSCLC [
17,
18]. In addition, miR-195 modulates response of NSCLC cells to microtubule-targeting agents (MTAs) through binding to CHEK1, and CHEK1 silencing synergized with MTAs suppressing the development of NSCLC [
19]. Therefore, overexpression of miR-195 and inhibited CHEK1 exerted their therapeutic potential in the LAC progression.
ceRNA is identified as an important class of post-transcriptional regulator altering gene expression by miRNAs [
20]. Recently, it is found that lncRNAs can act as ceRNAs to mediate gene expression, involving the tumor progression [
21]. In the subsequent experiments, it was reported that LINC00485 acted as a ceRNA of miR-195 and induced the cisplatin resistance in LAC. Another study, Wu et al. also demonstrate that silenced lncRNA plasmacytoma variant translocation 1 (PVT1) strengthens the radio-sensitivity in NSCLC through down-regulating miR-195 as a ceRNA [
22]. In addition, miR-137 and miR-27a also regulate cisplatin resistance in LAC [
23,
24]. Moreover, silencing of lncRNA urothelial cancer-associated 1 is reported to enhance the cisplatin chemosensitivity in tongue squamous cell carcinoma cells [
20].
Moreover, in this experiment, it was shown that the silencing of LINC00485 had the ability to elevate the expression of miR-195, and promote the inhibition that cisplatin had on cell proliferation, while at the same time, increasing the apoptosis rate in LAC cells. Another study, Ye et al, showed that the elevation of miR-195 levels played an important role in gastric cancer by promoting chemotherapy sensitivity of cisplatin, and by effectively upgrading the overall survival rate among patients with gastric cancer [
15]. In the experimentation process, it was shown that miR-195 had a suppressive effect on cell proliferation, migration and invasion by binding to MYB and HDGF in NSCLC [
25,
26]. Furthermore, the down-regulation of LINC00485 and the up-regulation of miR-195 could decrease the expression of CHEK1, and expression of apoptosis-related genes and angiogenesis-related genes Bcl-2, VEGF and HIF-1α, while also increasing the rate of apoptosis-related gene Bax in in LAC cells. In a previous study, it was shown that the inhibition of CHEK1 may reduce the progression rate of Lkb1-deficient LAC [
27]. Furthermore, Xiang et al. demonstrated that 125I seed irradiation promotes the apoptosis rate and suppresses angiogenesis through the down-regulation of the expression of HIF-1α and VEGF in LAC cells [
28]. Moreover, chronic exposure to exogenous matrilysin induces chemo-resistance and enhances Bcl-2 level in A549 LAC cells [
29]. Overall, the silencing of LINC00485 or the restoration of miR-195 enhanced the cisplatin chemotherapy in LAC cells. By up-regulation of LINC00485 or down-regulation of miR-195, CHEK1 increased cell proliferation, anti-apoptosis, invasion and angiogenesis [
30‐
32], while down-regulation of CHEK1 inhibited cell proliferation, anti-apoptosis, invasion and angiogenesis. Thus, CHEK1 plays an important role in LAC cell cycle, apoptosis and angiogenesis.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.