Background
Mutations in the
LRRK2 gene, originally described in 2004, have now emerged as the most important genetic finding in Parkinson’s disease (PD) [
1,
2]. Incredibly, the most common mutation LRRK2 G2019S accounts for up to 40% of Parkinsonism in populations of certain ethnic descent [
3‐
5].
LRRK2 mutations also account for around 2% of sporadic Parkinsonism and two risk factors have been identified in Asian populations [
6‐
9].
LRRK2-associated PD is a late onset disease and in general the disease resembles idiopathic PD both clinically and pathologically.
LRRK2 has been linked to neurite outgrowth, vesicular trafficking, protein translation and autophagy [
10]. Analysis of mutant transgenic and knock-in models expressing physiological levels of LRRK2 has led to an emerging theme that aberrant LRRK2 leads to subtle alterations in dopamine neurotransmission, albeit in the absence of dopaminergic neuronal loss [
11]. Imaging studies in asymptomatic PD patients show the earliest detectable changes occur in the dopamine transporter and the same holds true for asymptomatic
LRRK2[
12,
13] and
SNCA (
alpha-synuclein) patients [
14‐
16]. Neurotransmission alterations in mutant LRRK2 models may be similar to early preclinical events, suggesting an early involvement in dopamine dysfunction.
The expression profile of
LRRK2 mRNA suggests that LRRK2 is unlikely to be an essential developmental protein [
17]. In adult rodent brain,
LRRK2 mRNA is found at highest levels in dopamine receptive areas particularly the striatum [
18‐
22]. However, protein expression of LRRK2 is abundant throughout the brain including the substantia nigra, striatum, hippocampus, thalamus, cerebellum and cortex [
23] suggesting it may have a role in multiple brain functions (i.e. memory, sensory, emotion) and not just those involved in motor control.
To further study the role of LRRK2 in the brain, we have developed LRRK2 knockout mice by ablating exon 41 in the kinase domain of LRRK2. We have performed a comprehensive analysis to study the effect of loss of LRRK2; this includes a thorough investigation of the dopaminergic system, extensive behavioral tests to examine motor, co-ordination and emotional behavior, as well as neuropathological analyses. We find little evidence that loss of LRRK2 impacts dopaminergic neurotransmission or striatal behaviors, however we present data showing changes in the exploratory and motor co-ordination behaviors in these mice. These findings may be an important consideration for future anti-LRRK2 therapies.
Discussion
In this report we present dopaminergic, behavioral and pathogenic characterization of mice lacking LRRK2 to 20 months of age. Our most significant findings are observed at the behavioral level, which reveal normal motor gait but altered open field and motor co-ordination behavior in
LRRK2 KO mice. In the open-field test KO mice displayed an increased thigmotaxic behavior, walking along the wall of the apparatus, which resulted in reduced path tortuousity. This phenotyping profile was characteristic both at 7 and 16 month of age, with no indication of progressing deterioration in this phenotype. It has been reported that the measures obtained in the open-field test are variable and labile [
45], which could account for the lack of significant interactions between age and genotype in our study. Increased thigmotaxic behavior is often attributed to an increase in anxiety during the exploration of new environment [
35,
41] or lack of flexibility in changing ongoing behavior [
46]. Follow up studies to examine progression of these behaviors in KO mice will require larger cohort sizes and will focus on complementary to the open-field tests evaluating anxiety in mice, including rescue with anxiolytic agents. Interestingly, we have previously reported very similar open field behaviors in our mutant G2019S BAC mice [
47] which formulates the idea this phenotype could be a loss of function behavior. While current thinking favors a gain of function role for aberrant LRRK2, the phenotype reported in
LRRK2 KO kidneys [
34,
43] has somewhat challenged this, leading to speculation of cell-specific LRRK2 roles.
Surprisingly, our study revealed that
LRRK2 KO mice stayed persistently longer on the rotating rod, despite no obvious differences in their gait characteristics. Coincidentally, the Michael J Fox foundation recently posted online data detailing phenotypic testing of their
LRRK2 KO model being characterized at Wil Research and this data showed a trend for enhanced rotarod performance in 4 month old KO mice compared with WT controls
http://www.pdonlineresearch.org/sites/default/files/MJFF%20Animal%20Models%20Data%20-%20Oct%2031.pdf). The rotarod test is known to be sensitive to cerebellar function and deficits in cerebellar purkinje neurons generally result in a reduced rotarod performance. In the literature there are only a few reports of genetic mouse models exhibiting enhanced rotarod performance compared with their wild type/ non-transgenic littermates. Examples include a mouse model for Down’s syndrome (Ts65DN) [
48], heregulin (a ligand for tyrosine receptor kinase) mutant mice [
49], an epilepsy model deficient in a repair protein L-isoaspartate (d-aspartate)-
O-methyltransferase (
Pcmt1−/−) [
50] and Huntington triplet deletion mice
Hdh (∆Q/∆Q) mice [
51]. Both the Ts65DN and heregulin model had known cerebellar morphological changes [
48,
49]. Morphological and pathological analysis of the cerebellum in our
LRRK2 KO and HET mice did not reveal any obvious structural differences, however given the high expression of LRRK2 in the cerebellum, further studies examining cerebellar neurochemistry/function may be warranted. In the heregulin mutant and
Pcmt1 −/− models, enhanced rod performance was also accompanied by hyperactivity [
49,
50] which we did not observe. However, like our
LRRK2 KO mice, the
Pcmt1−/− mice also displayed significant thigmotaxic behaviors in addition to enhanced rotarod phenotype. Our rotarod result together with the results obtained in the open-field test might indicate inability of termination of ongoing behavior, which resulted in higher ceiling performance of KO mice in the rotarod test.
It is also important to note that aside from the cerebellum, enhanced rod performance could also be attributed to central (i.e. heart) and/or peripheral effects (i.e. muscle). Since LRRK2 is expressed in both heart and skeletal muscle [
17] a closer physiological examination of heart and muscle may also be revealing.
LRRK2 KO mice have normal lifespans and do not have any compensatory changes in
LRRK1 or other PD related mRNAs. In agreement with previous reports, and consistent with the lack of striatal-related motor phenotypes, we did not observe any changes in total striatal dopamine levels nor did we observe nigral neuronal loss. Given that several mutant
LRRK2 models have normal total dopamine levels, but still exhibit subtle defects in extracellular release, we extended on the studies of others [
34,
43] and performed
in vivo microdialysis in
LRRK2 KO, HET and WT mice. Endogenous extracellular levels of dopamine were found to be normal in KO and HET mice compared with WT, as were post-KCl stimulation levels. Taken together, our data suggest that the dopamine system is functionally intact in LRRK2 KO mice. Future studies to examine extracellular release of other neurotransmitters in
LRRK2 KO mice, for example serotonin in the hippocampus/amygdala may be more informative given the abnormal behaviors in the open-field.
Curiously, unlike the G2019S BAC mice,
LRRK2 KO mice do not appear to have any defect in neurogenesis, since proliferating cells and DCX counts were similar to WT mice. Dentate gyrus neurogenesis is thought to be involved in regulation of emotion [
52,
53] and we previously theorized that the impaired neurogenesis and anxiety phenotype may be linked in G2019S mice [
26]. However, in this instance the unaltered neurogenesis in
LRRK2 KO mice rules out this idea.
Neuropathological analysis of brains from
LRRK2 KO mice does not reveal any PD-related pathology or striatal dendritic spine alterations and tau regulation also appears to be normal in KO mice. In agreement with others [
34,
43] we do observe a marked kidney phenotype, which in our mice is characterized by discoloration, enlargement, inflammatory and degenerative changes. The phenotype occurs in
LRRK2 KO (but not HET) from both genders and some features are observed as early as 3–4 months including discoloration, inflammation, increased p62 immunopositive cells and pigmentation. What is curious is that we observe the opposing effect on autophagy reported by Tong el al, in that we see elevated, rather than a decreased levels of LC3 II, indicating increased autophagy in the oldest (18–20 months) mice, and no indication of a biphasic response. Herzig et al recently reported that they saw no changes in LC3-II in their KO line [
43], however the data presented suggests they only examined mice up to 14 months of age for this marker and we only saw quantifiable differences at the 18 month time point. Our data points toward a compensatory attempt to counteract the degeneration and pigment accumulation. Although one would expect all
LRRK2 knockout models to exhibit similar phenotypes, it is possible that subtle differences in strain background, targeting and breeding strategies may alter phenotypic progression, and perhaps if we were able to age our mice long enough, we may well observe a decrease in autophagy and alpha-synuclein accumulation in the kidney as the degenerative phenotype progresses.
Materials and Methods
Animals
All animal procedures were approved by the Mayo Clinic Institutional Animal Care and Use Committee and were in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80–23) revised 1996.
Generation of targeted LRRK2 knockout mice
LRRK2 knockout (KO) mice, generated at Ozgene PLC (Australia) were created utilizing a construct designed to ablate
LRRK2 exon 41. Regions of 5’ homology (4 kb) and 3’ homology (4.7 kb) were used to drive the homologous recombination event by standard gene targeting techniques in C57BL/6 Bruce4 embryonic stem (ES) cells [
54]. Following electroporation of the targeting construct, cells were selected for neomycin (Neo) resistance. Targeted ES cells were confirmed by Southern blotting and PCR. Euploid, targeted ES cells were then microinjected into Balb/cJ blastocysts and reimplanted into pseudopregnant dams. Resultant chimeras were bred to C57BL/6 J breeders to establish transmission. Black (i.e. those with the ES cell germline) progeny that were heterozygous for the gene-targeted allele were then bred to Cre recombinase “deleter” mice on C57BL/6 J background (Ozgene) to allow excision of the exon 41 and Neo selection cassette, which were flanked by lox P sites. Cre was then removed by breeding to C57BL/6 J wild type mice. Resultant mice were then transferred to our colony and bred to homozygosity, maintained on the C57BL/6 J background. Single nucleotide polymorphism analysis with 124 evenly spaced markers covering the mouse genome indicated that the strain was congenic on C57BL/6 with no evidence of any contaminating inbred strain.
Routine genotyping was performed by a PCR-based strategy utilizing intronic primers that span exon 41 (forward 5’CTACCAGGCTTGATGCTTTA’3, reverse 5’TCTGTGACAGGCTATATCTC’3) that yielded a 471 bp band in wild type (WT), ~220 bp band in KO and both bands in heterozygotes (HETS).
Northern Blotting
Total RNA was extracted using Trizol® reagent (Invitrogen) according to manufacturer’s instructions. Two mice from each genotype (WT, KO, HET) were used for analysis. Total RNA (12 μg) was prepared in 1X MOPS, 6.5% (v/v) formaldehyde and 50% (v/v) de-ionised formamide, denatured at 65°C. Samples were electrophoresed on a denaturing gel (1% (w/v) agarose 0.7%, (v/v) formaldehyde, 1X MOPS, 0.005% (v/v) ethidium bromide) for approximately 3–4 hours at 100 Volts. 0.5- 10 kb RNA ladder (Invitrogen) was used for size comparison. The RNA was then capillary transferred overnight onto Hybond-N+ nylon membrane (Invitrogen) and UV cross-linked. Membranes were probed with a 539 bp cDNA probe designed to exons 24–27 of mouse LRRK2 (generated by PCR using primers forward 5’ATGCCACGTATCACCAAC’3, reverse 5’TCTAAGGTGCTGATCTGATTC’3). Probes were labeled with [α-32P] dCTP (3000 Ci/mmole) (Perkin Elmer) using Ready to Go labeling beads (Invitrogen). Cross-linked membranes were pre-incubated at 42°C in hybridization buffer (1X Denhardt’s solution, 4X SSC, 50% (w/v) deionised formamide, 10% (w/v) dextran sulphate, 200 mg/μl herring sperm DNA) for at least 30 minutes and then hybridized with labeled probe overnight at 42°C. Membranes were washed with 1X SSC for 20 minutes at room temperature to remove excess probe and then 1–2 times in 1X SSC containing 0.1% SDS at 55°C for 15 minutes. To visualize bands, membranes were exposed to BioMax film (Kodak) at −80°C for 5–48 hours. A 214 bp histone cDNA probe was used as loading control (generated using primers forward 5’ GCGTGCTAGCTGGATGTCTT ‘3 and reverse 5’CCACTGAACTTCTGATTCGC ‘3).
Antibodies
Antibody 1182E, raised to amino acids 841–960 of LRRK2 (1:200) was a gift from Dr. Benoit Giasson (Univ. Pennsylvania) was used for immunoblotting. LRRK2 immunohistochemistry was performed with MJFF2 at 1:4000 (Epitomics, c41-2) raised to amino acids 970–2527. Tyrosine hydroxylase (TH) (Affinity Bioreagents) was used to visualize dopamine neurons by immunohistochemistry (1:200) and on immunoblots (1:1000). Phospho-TH (Ser40) antibody was used for immunoblotting only (1:1000, Cell Signalling). Detection of α-synuclein was with a mouse monoclonal to α-synuclein (clone 42, 1:3500 for immunohistochemistry and 1:500 for immunoblots) from BD Transduction Labs and the phospho-Ser129 antibody (1:1000) was a gift from Dr. Takeshi Iwatsubo, University of Tokyo. Activated microglia were detected by Iba-1 (1:2000, Wako Chemicals). Tau antibodies were CP-13 (1:1000 immunohistochemistry, 1:200 immunoblots), Tau-5 (1:500 immunoblots) and PHF-1 (1:500 immunoblots) all gifts from Dr. Peter Davies, Albert Einstein College of Medicine, 12E8 (1:10,000 immunohistochemistry) a gift from Dr. Peter Seubert, Elan Pharmaceuticals and Tau-1 (1:500 immunoblots) from Millipore. For autophagy studies we used LC3 (1:500 immunoblots) from Novus and p62 (1:500 for immunoblots and 1:2000 for immunohistochemistry) from Progen. Neurogenesis studies utilized rat α-5-bromo-2-deoxyuridine (BrdU) 1:500 (Oxford Biotechnology) and goat α-doublecortin (DCX) 1:500, (Santa Cruz Biotechnology).
Immunoblotting
Analysis of LRRK2 and tau protein was performed as previously described [
47]. TH and pTH immunoblotting lysates were prepared in RIPA buffer with Triton X-100 containing protease inhibitors. 10 μg (for TH) or 50 μg (pTH) of protein was loaded onto 4-12% Bis-Tris gels (Invitrogen). For autophagy studies samples were prepared as previously described [
34], 60 μg of protein was loaded on 4-20% Tris-glycine gels for LC3 and 10% Tris-glycine gels for p62. ImageJ 1.42q (National Institutes of Health) was used to quantify blots. Densitometric values were analyzed statistically by either Student’s t-test or Mann Whitney non-parametric comparisons.
Stereology
Brains from 18–20 month old KO (n = 4) and littermate WT mice (n = 4) were post-fixed in 4% paraformaldehyde (PFA) for 24 hours followed by 30% sucrose cryoprotection for 48 hours. Brains were sectioned exhaustively at 50 μm thickness using a freezing sledge microtome. For dopamine neuron and dendritic estimates, after a random start, every third section was stained free floating with TH antibody. Free floating immunostaining was performed utilizing the VECTASTAIN® ABC System (Vector laboratories). Sections were mounted onto glass slides, allowed to dry overnight, lightly counterstained with cresyl-violet and then dehydrated and cover slipped. Quantification was performed at high magnification (400X) using the optical fractionator number and length probes in Stereo Investigator software (MicroBrightField). Data was plotted as mean ± SEM and statistically analyzed by Student’s t-test.
HPLC with electrochemical detection was performed as previously described [
47] in striatal tissue punches from frozen brains from mice aged 10 months KO (n = 14; 6 males, 8 females) and WT (n = 13; 7 males, 6 females) and 16–18 months KO (n = 7; 4 males, 3 females) and WT controls (n = 8; 4 males, 4 females). The amounts of monoamines/metabolites in the tissue samples were determined by comparing peak area values with those obtained from external standards run on the same day. Neurochemical concentrations were determined by normalizing samples to protein concentrations obtained from the pellets (BCA method). Data was plotted (mean ± SEM) and statistically analyzed using Mann Whitney non-parametric comparisons.
Microdialysis
KO (n = 10 males), HET (n = 6 males) and WT littermates (n = 13 males) aged 3–4 months were anesthetized with 1-2% isoflurane. Guide cannulae (CMA Microdialysis) were surgically implanted into the striatum using a standard stereotaxic frame (Kopf Instruments, Tujunga, CA) utilizing coordinates (from Bregma anterior-posterior +0.1 cm, lateral-medial +0.2 cm, dorso-ventral −0.2 cm) according to the Mouse Brain Atlas [
55]. Mice were allowed to recover for at least 24 hours. Microdialysis experiments were carried out on conscious, freely moving mice with surgically implanted guide cannulae. On the day of the experiment, the stylet in the guide cannula was replaced with the microdialysis probe (CMA/7 with 2 mm membrane, CMA Microdialysis). The probe was perfused at 2 μl/min with artificial cerebrospinal fluid (aCSF; 145 mM NaCl, 1.2 mM CaCl
2, 3 mM KCl, 1.0 mM MgCl
2) for a two hour equilibration period before collection. Dialysate samples were automatically collected every 15 minutes into vials containing 2 μl perchloric acid (0.1%) to retard oxidation of monoamines. Four baseline collections were taken at 15 minute intervals, and then the perfusate was switched to high KCl aCSF (103 mM NaCl, 1.2 mM CaCl
2, 45 mM KCl, 1.0 mM MgCl
2). After 30 minutes the perfusate was switched back to the original aCSF and four subsequent samples were collected every 15 minutes. Samples were analyzed by HPLC for dopamine content. Data was plotted (mean ± SEM) and statistically analyzed using Mann Whitney non-parametric comparisons.
Pathological analysis
At least six mice from each genotype (KO, HET, WT) were analyzed per time point (3, 6, 12, 18 months). Formalin fixed, paraffin embedded tissue sections were dewaxed in xylene and rehydrated in descending alcohols and water. For antigen retrieval in paraffin sections, tissue was pressure cooked (10 minutes) in distilled water (all antibodies, except α-synuclein). Appropriate disease/tissue positive controls were included for each antibody (diffuse Lewy body disease for α-synuclein, Alzheimer for tau antibodies, Alzheimer/vascular dementia for Iba-1). Immunohistochemistry was performed using the Dako Autostainer. Tissue was quenched for endogenous peroxidases in 0.03% H2O2 and blocked in Dako All-purpose blocking solution for 30 minutes. Primary antibody was incubated for 45 min at room temperature. All secondary antibodies were from the Envision+ System Labeled Polymer HRP (Dako), followed with DAB substrate (Dako), with the exception of p62 immunostaining which utilized an anti-guinea pig secondary and DAB kit (both Vector Labs). Sections were lightly counter stained in Gills 3 hematoxylin. Standard histological staining was also used (haemotoxylin and eosin, Gomori's Prussian blue, Periodic acid-Schiff and Masson Fontana).
Transmission electron microscopy
18 month old KO and WT mice, were perfused transcardially with 2.5% gutaraldehyde-2% PFA in 0.1 M cacodylate buffer. Kidneys were removed, split in halves and immersed in the same fixative for two hours at room temperature. Small pieces of the cortex were further fixed in aqueous 2% OsO4 and 2% uranyl acetate, dehydrated in ethanols and propylene oxide, infiltrated and embedded in Epon 812 (Polysciences). Ultrathin sections were stained with uranyl acetate and lead citrate, and examined with a Philips 208 S electron microscope (FEI) fitted with a Gatan 831 Orius CCD camera (Gatan). Digital images were processed with Adobe Photoshop CS2 software.
Behavioral studies
Open-field (OF) test
Twenty eight littermate mice (N = 8 KO males KO; 8 KO females, and N = 6 WT males; 6 WT females) were used for the evaluation of the exploratory activity in the open-field test. Open-field behavior of the mice was evaluated in a longitudinal experiment, with the first test applied at the age of 7 months and the second at the age of 16 months. Mice were habituated to the behavioral room for one week before testing. The OF apparatus consisted of a circular arena, 120 cm in diameter, surrounded by a 30 cm high wall. The apparatus, build of white plastic, was elevated 86 cm off the floor level. The arena was illuminated by 4 sets of in ceiling fluorescent lights available in a testing room and no additional illumination was used. An object (a plastic water bottle, 10 cm in diameter, 25 cm high) painted with black and white horizontal stripes was placed in the centre of the arena. All mice were individually exposed to the arena in one 5-min session. At the onset of the session, a mouse was placed near the wall of the arena and its movement on the arena throughout the duration of the session was recorded by a video tracking system (HVS Image Advanced Tracker VP200, HVS Image, Buckingham, UK). The data were extracted off-line using a Wintrack program [
56].
XIn our analysis we focused on measures of motor activity in the arena and the exploration of a novel object. The following behavioral categories were used to evaluate the exploratory motor activity of mice in the open-field: walking path length (m) – the distance a mouse covered during the exploration of the arena, walking speed (m/s) – averaged speed of active walking, excluding period of rests, latency to move – the onset (s) of active locomotor exploration after placing a mouse in the arena, number of stops – a stop was defined as a period of inactivity lasting between 1 and 5 s which was separated by at least 1 s of locomotion, number of rests – a rest was defined as a period of inactivity lasting longer than 5 s which was separated by at least 1 s of locomotion, time spent resting – total time (s) spent by mice on resting, % time in the central zone – the percent of time spend in the central zone of the arena (50 cm radius from the centre), thigmotaxis – percent of time a mouse continuously walked within the close vicinity (7.5 cm) of the wall of the apparatus, path tortuosity (°/m) – the measure was derived by dividing the path into straight segments and curves with consistent change in direction. Following, absolute changes in direction of all curves were summed and divided by total path length. The novel object exploration was evaluated by the latency (s) of the first approach to the object, the total time of object exploration – a mouse was considered exploring an object if its nose was within a direct contact or 1 cm from an object and the body of a mouse was within a distance of 5 cm from the object perimeter, and by the number of crosses of an object zone – a 5 cm virtual zone surrounding an object.
A factorial model analysis of variance (ANOVA) with the genotype as between subject, and age of testing (7 and 16 months) as within subject (repeated measure) factors was used in the analysis of open-field data. While performing all repeated measures ANOVAs, departures from the assumption of compound sphericity were evaluated by Mauchly test [SPSS statistical package (SPSS Inc. Chicago) v. 19 run on a Macintosh computer] with α level set to 0.05. In cases when sphericity was significantly violated, degrees of freedom were adjusted by Greenhouse-Geisser ε-correction. Due to considerable variability of the measures obtained in the open-field [
45] and relatively small sample size of mice, the interaction effect in our 2 × 2 factorial design often did not reach significance at α = 0.05. Consequently, we followed the overall ANOVA
s by the
a priori identified analysis focused on genotype effect at each testing age, utilizing Student’s t-tests for independent and matched-pairs samples. Correlations between the variables obtained in the open-field test were done using Pearson product–moment correlation. The critical α level for all analyses was set to 0.05. Due to space limitation, only significant results pertaining to the hypotheses testing the effect of the genotype and age are reported.
Rotarod
Motor co-ordination was measured using an automated rotarod system (Rotamex-5 Columbus instruments). Following a 3 day habituation period in the behavioral suite, littermate mice (7 months KO n = 9; HET n = 8 and WT n = 12) were trained for two days prior to testing. The spindle dimensions were 3.0 cm x 9.5 cm and the speed of the rod was set to 4-40 rpm acceleration, increasing 1 rpm every 5 seconds. The equipment was equipped with a sensor that automatically stops the timer if the mice cling and roll around on the rod. On the third day, mice were tested for 4 consecutive trials, allowing 10 minutes rest per trail. Data from the testing day was plotted as mean trail time and data was statistically analyzed using one way ANOVA followed by Tukey’s multiple comparisons.
Gait dynamics
Mice (KO n = 8; HET n = 8 and WT n = 9) were selected from the same group of animals described above for rotarod testing. Mouse gait dynamics were obtained using a motorized treadmill (with a transparent belt and digital video camera mounted underneath) by ventral plane videography [
57‐
59] and analyzed with DigiGait® Version 9 software (Mouse Specifics, Inc). Each mouse was individually placed in the treadmill compartment for a few seconds and then the belt was turned on at a low speed (4 cm/sec) just prior to testing [previous studies show that C57BL/6 J mice do not require extended acclimatization to the treadmill [
57‐
59]]. The motor speed was then set to 14 cm/s and at least 4 seconds of videography was collected for each mouse to obtain at least 8 sequential step images. The speed was then increased to 18 cm/s, and then 24 cm/sec, collecting an average 4 seconds of videography to obtain at least 12 or 15 sequential step images, respectively. Mice that did not have stride regularity indices (alternate step sequences) at 100% [
58,
60] were still included in the study to evaluate inter-limb coordination.
Each individual gait signal per limb consists of a stance duration (time in contact with surface) and swing duration (time not in contact with surface) which together are the stride duration. Stride frequency is calculated by measuring the number of strides over time. Stride length is calculated by dividing the belt speed over the stride frequency. Paw angles and step angles at full stance are determined by software geometry calculations (fitting ellipses to the paws) of ellipse centers, major axes and vertices. The left and right gait measurements were combined for all forelimb and hindlimb data analysis. Gait indices were plotted as mean ± standard deviation and analyzed by one way ANOVA.
Supplemental methodology is also available in Additional file
7.
Acknowledgements
We would like to thank Peter Ash, John Fryer, John Howard, Monica Castanedes-Casey, Linda Rousseau and Virginia Philips for technical assistance. Funding support was provided by the Mayo Clinic, NIH Grants NINDS NS065860 (HLM), NINDS NS40256 and NS072187 (DWD, MJF), Lundbeck A/S (MJF, HLM, JCD), the Michael J Fox Foundation (MJF, JCD, HLM) and Interdisziplinäres Zentrum für Klinische Forschung (BW).
Competing interests
HLM, SJL and MJF have received royalties from commercial licensing of LRRK2 KO mice. All other authors declare they have no competing interests.
Authors’ contributions
KMH and MY performed the bulk of the husbandry and technical (molecular characterization, behavior, microdialysis surgeries and collections, HPLC, DA uptake, receptor binding, immunoblotting etc) work and contributed to manuscript writing. HLM performed microdialysis and dialysate HPLC. BB and JEB performed tissue HPLC and dendrite stereology. JCD performed immunoblotting. BB and JCD provided intellectual input to experiments and manuscript. SJL contributed intellectually to targeting design and molecular characterization. EEB performed HPLC and Golgi impregnation and analysis. CBK performed immunohistochemistry. KN performed taqman studies. IP and BW performed neurogenesis studies. CJ performed and analyzed open-field behavior and contributed to manuscript writing. WLL and DWD performed EM and pathological interpretation. HLM and MJF conceived the study. HLM designed experiments, interpreted data and wrote the manuscript. All authors read and approved the final manuscript.