Background
Merkel cell polyomavirus (MCPyV) causes Merkel cell carcinoma (MCC) [
1], an aggressive skin cancer that is highly unusual before age 50 [
2,
3]. The elderly, immunosuppressed individuals and post-transplant patients, and Caucasians exposed to excessive UV light, are at increased risk [
4,
5]. MCPyV infection, defined by serology or detection of viral DNA, is prevalent [
6‐
10]. The presence of MCPyV DNA at high copy number and tumor-specific mutations in MCPyV genomes appear in tumor tissue but not in healthy tissue [
11]. Interestingly, similar truncating mutations have been described in chronic lymphocytic leukemia (CLL) [
12].
Ubiquitous presence of MCPyV DNA has become apparent in cutaneous swabs from clinically healthy subjects at prevalences of 40 to 60% [
13,
14]. Besides in skin, viral DNA has been detected at lower frequencies also in respiratory secretions, on the oral and anogenital mucosa, and in the digestive tract [
9]. Furthermore, by examining fetal autopsy samples, we obtained data to rule out MCPyV vertical transmission [
15]. Therefore, the exact mode of transmission remains to be elucidated and could involve cutaneous, fecal-oral, mucosal, or respiratory routes. Moreover, the presence of the MCPyV genome has also been reported in peripheral blood mononuclear cells (PBMC) from adult HIV/AIDS patients without MCC and from healthy blood donors at low DNA copy numbers [
16,
17]. Among healthy subjects, MCPyV exposure as measured by serum antibodies to viral capsid proteins appears to be wide [
18,
19]. Tolstov et al. showed seroprevalences of 43% among children aged 2 to 5 years, and 80% among adults older than 50 [
18]. We and others also observed frequent primary exposure to MCPyV during childhood and a trend toward increasing seroprevalence among adults [
20,
21].
Trichodysplasia spinulosa-associated polyomavirus (TSPyV)
, the eighth human polyomavirus, was detected by rolling circle amplification (RCA) after the identification of human polyomaviruses 6 and 7 in 2010 [
14,
22]. Trichodysplasia spinulosa (TS) is a rare, disfiguring skin condition that affects immunocompromised solid organ transplant patients and lymphocytic leukemia patients, universally involving the central face [
23‐
25]. Its discoverers further showed the presence of TSPyV DNA in eyebrow hairs of 4% of 69 renal transplant patients without TS and a lack of TSPyV DNA in human pilomatricomas [
22,
26]. High prevalence (100%) and load (∼10
6 copies/cell), of TSPyV DNA in TS lesions, and abundant expression of TSPyV VP1 in the affected hair follicle cells evidenced that active TSPyV infection is associated with TS and apparently essential in its pathogenesis [
27]. Two recent serology studies showed that TSPyV circulates widely in the human population (prevalences of 10% in small children to 80% in adults), and primary exposure is extensive in childhood, beginning at age 1 or 2 years [
28,
29]. TSPyV positivity of nasopharyngeal and fecal samples from an immunosuppressed child (heart transplant recipient) without TS suggests respiratory or fecal–oral route of transmission [
30].
Data regarding MCPyV, TSPyV and aging are scarce. Additional epidemiological deta on elderly persons, regarding serum antibody responses and genome prevalence is needed. To our knowledge the present collection of sera is the first sizeable material that has been studied for the presence of MCPyV and TSPyV in aging individuals in order to determine whether and to what extent these viruses appear in this population at elevated risk of MCC. We studied a large number of serum samples from aging (≥65 years) representatives of the general population by real-time quantitative (q) PCRs for the DNAs of MCPyV and TSPyV by using primer sets directed against the genes encoding large-T antigen 1 (LT1) and viral protein 1 (VP1). In addition, the IgG antibodies for the two viruses were measured with EIAs by using as an antigen the corresponding VP1 virus-like particles (VLPs).
Methods
Study populations
For determination of MC and TS polyomavirus DNAs and IgG antibody seroprevalences, 621 blood samples were collected from 394 hospitalized senior citizens with respiratory symptoms or suspected pneumonia, cardiovascular, and other diseases in the city hospital of Turku, Finland, between July 2007 and April 2009. The criteria for sampling were age 65 years or older, disease requiring hospitalization, and a written assignment from the patient or trustee. Patients who came for a short elective operation were excluded from the study. The study protocol was approved by the Ethics Committee of Turku University Hospital.
Sample collection
Eligible patients were informed of this study at hospital entry. After signing the consent, the patients or trustees were interviewed, and hospital records reviewed for clinical history. Nasopharyngeal swab samples (flocked swab, 520CS01, Copan, Brescia, Italy) and serum samples were collected at hospital entry and after two weeks or at discharge for detection of acute infections. The swabs in dry tubes and serum samples were stored at -80°C. Disposable gloves were used to prevent contamination.
The DNA Mini kit (Qiagen, Crawley, UK) was used according to the manufacturer's instructions for nucleic-acid extraction. A negative control of molecular biology-grade water was extracted and included in the PCR between sets of 10 samples. MCPyV DNA is known to occur on virtually all environmental surfaces that have been in contact with human skin [
31]. During sample processing, in addition to routine PCR precautions, we always wore double disposable gloves and frequently changed them as well as avoided touching anything except pipettes and used aliquoted reagents.
Real-time PCR assay for detection of MCPyV and TSPyV
Two published primer sets targeting conserved sequences in the MCPyV genome, the large T antigen (LT) gene, and the viral capsid protein (VP1) gene (Table
1) were used according to Goh et al [
32]. PCR was done with the ABI PRISM 7700 Sequence Detector (Applied Biosystems) thermal cycler using the TaqMan universal PCR master mix (PE Applied Biosystems), and the settings were 52°C for 2 min, 95°C for 10 min, followed by 45 cycles of 95°C for 10 s and 60°C (LT assay) or 58°C (VP1 assay) for 1 min. For both assays, control plasmids were cloned from amplicons of PCR-positive tonsillar samples [
33] by means of the CloneJET™ PCR Cloning Kit (Thermo Scientific). Serial dilutions of the plasmids allowed determination of assay sensitivity. In each assay, five copies per reaction were reproducibly positive, corresponding to 200 copies/mL of serum. For contamination control, in addition to DNA extraction controls, we included 30 controls of molecular biology-grade water per run of 54 DNA extractions. The MCPyV qPCR products were purified for automated sequencing with the High Pure PCR product purification kit (Roche). The resulting DNA sequences were aligned by means of the Basic Local Alignment Search Tool (BLAST) against the MCPyV sequences in GenBank.
Table 1
Primers and probes used to detect TSPyV and MCPyV
MCPyV | FWD-CCACAGCCAGAGCTCTTCCT | LT | 140 |
REV-TGGTGGTCTCCTCTCTGCTACTG |
FAM-TCCTTCTCAGCGTCCCAGGCTTCA-TAMRA
|
MCPyV | FWD-TGCCTCCCACATCTGCAAT | VP1 | 59 |
REV-GTGTCTCTGCCAATGCTAAATGA |
6FAM-TGTCACAGGTAATATC-MGBNFQ
|
TSPyV | FWD-TGTGTTTGGAAACCAGAATCATTTG | LT | 140 |
REV-TGCTACCTTGCTATTAAATGTGGAG |
FAM-TTCTTCTTCCTCCTCATCCTCCACCTCAAT-BHQ1
|
TSPyV | FWD-AGTCTAAGGACAACTATGGTTACAG | VP1 | 140 |
REV-ATTACAGGTTAGGTCCTCATTCAAC |
FAM-ACAGCAGTGACCAGGACAAGCCTACTTCTG-BHQ1
|
Tail Sequence | AACTGACTAAACTAGGTGCCACGTCGTGAAAGTCTGACAAGTGTCTCTGCCAA TGCTAAATGA |
As the MCPyV VP1 PCR product was too short for direct sequencing, we added a 40 base pairs (bp) nonspecific nucleotide tail [
34] (Table
1) in addition to a poly(C) to the 5
′ end of the sequencing primers to accomplish a product of 110 bp. The neutral sequence is a randomly generated sequence not matching any sequence in a BLAST search.
For detection of TSPyV, we applied published qPCRs, with primer pairs targeting the VP1 and LT genes [
22] but changed the quenching dye TAMRA to BHQ1 on the 3
′ base of the probes (Table
1). While annealing was done for 15 s at 62°C, the cycling conditions were otherwise identical to those of the MCPyV protocol. For use as positive controls and to determine assay sensitivities due to the lack of known positive samples, the TSPyV LT and VP regions were synthesized and cloned into pUC57 by GenScript (Piscataway, NJ, USA). The detection limit of each assay was 5 target copies per reaction, corresponding to 200 copies/mL of serum.
MCPyV and TSPyV serology
MCPyV and TSPyV IgG antibodies in 481 serum samples from 326 subjects (available from the initial 621 samples from 394 subjects) were measured by in-house enzyme immunoassays (EIA) based on virus protein 1 (VP1) virus-like particles (VLPs) showing no antigenic cross-reactivity between the two viruses [
21,
29]. Briefly, recombinant baculovirus genomes containing the MCPyV and TSPyV VP1 gene sequence were generated by using the Bac-to-Bac expression system in
S. frugiperda (
Sf) 9 insect cells. The VLPs were biotinylated and used as antigens in an indirect EIA assay, as described [
21,
29]. The cut off values defining a positive IgG result were 0.150 and 0.240 OD units at 492 nm for MCPyV and TSPyV, respectively [
21,
29].
Discussion
Our results show the occurrence of MCPyV DNA rather commonly in sera from the elderly. The source of viral DNA in their blood is unknown. As the previously identified polyomaviruses JCV and BKV do occur at increased frequencies in blood and lymphoid tissue during host immunosuppression, and the same has been reported in some studies for the newly discovered KIPyV and WUPyV [
35‐
37], it is tempting to speculate that with increasing age MCPyV may reactivate more often, causing viremia, especially as hematolymphoid cells may harbour MCPyV [
38]. The potential in elderly individuals for MCPyV to replicate and be released into serum under special circumstances deserves further investigation.
A study of 840 serum samples for MCPyV revealed only one sample from a leukemic child to be PCR-positive; more often viral DNA was detected in tonsillar tissue of adults [
33]. In a study of 635 NPA samples with exactly the same primers and probes as ours, more adults (particularly the elderly) than children were MCPyV positive [
32]. Our high prevalence of MCPyV DNA among the elderly is in agreement with the findings of Goh et al. showing in NPAs MCPyV DNA more frequently among the elderly [
32].
As in several other studies, viral DNA was detectable in low copy numbers, however, making the interpretation of positive results challenging [
17,
32,
39,
40]. According to others’ positivity criteria concerning VP1 and LT PCRs [
32,
39,
40], we concluded six samples as being unequivocally positive for MCPyV. However, all 25 amplicons from the LT or VP PCRs contained the correct sequence, and the 437 negative controls (62 for DNA extraction plus 375 for qPCR) were always negative, suggesting that also the single-PCR positives were true positives. Divergent sequences among the circulating viruses could perhaps cause false negativity in the PCRs, or the low viral amounts could lead to stochastic variance in detection.
Among the 72 MCPyV PCR-positive patients 15 were MCPyV VP1 IgG negative. One possible explanation for this difference, in light of the ubiquitous presence of MCPyV DNA in superficial skin, is contamination of the needle piercing the skin during sampling. This deserves to be explored.
Of note, MCPyV detection rates by LT1, LT3, and VP1-region primers have invariably shown mutual discordance among samples of various entities [
1,
32,
39,
40]. We used primers from both the VP1 and LT regions of MCPyV and reasoned that the presence of both genes, capsid VP1 and oncogenic LT, would better indicate the presence of infectious virions, hence the stringent criterion of coupled LT and VP1 positivity for MCPyV detection by these assays. Interestingly, we found a positive association between MCPyV VP1-PCR but not LT1-PCR positivity and chronic respiratory disease. However, any conclusions about MCPyV pathogenicity in the respiratory tract cannot be drawn without epidemiologic support and further investigation with different sample types. Furthermore, it is difficult to resolve whether the higher prevalence by the VP1 assay was due to increased sensitivity or to a difference in genome identity sequences among the MCPyV strains.
The prevalence of MCPyV antibody positivity increases with age throughout life [
18‐
21,
41,
42]. Our MCPyV serology results also showed that the majority of the elderly have been exposed to MCPyV with similar seroprevalences in all subgroups.
Taken together, MCPyV DNA appeared in serum in low copy numbers in many aging individuals. Serological results have shown that MCPyV infection is common, but only rarely leads to MCC. The presence of the virus alone is insufficient for tumor development. While MCC tumors require specific mutations (both T antigen truncation and genomic integration) [
1], and in most cases immunosuppression, additional risk factors and viral changes are required before clinically apparent MCC emerges.
TSPyV is a ubiquitous virus that frequently infects the general population. To determine the exposure history and activity of infection among the aging, we conducted a survey by molecular and serologic tests. In contrast to MCPyV, no TSPyV DNA appeared in the elderly subjects’ sera. For one explanation of these negative PCR findings, TSPyV viremia may be of short duration. Whether TSPyV infections are able to persist is unknown, but likely, based on results for other polyomavirus infections. Our TSPyV IgG data confirmed two recent serologic reports showing TSPyV circulation in the general population [
28,
29]. The seroprevalence we found for TSPyV among the elderly was high (>60%) with no variation according to advancing age, and comparable with that for MCPyV.
Acknowledgements
This study was supported by the Helsinki University Central Hospital Research & Education and Research & Development Funds, the Helsinki University Research Fund, the Medical Society of Finland, the Kliinisen kemian tutkimussäätiön, the Ida Montinin Säätiön, the Oskar Öflundin säätiö, the Academy of Finland (project 1257964) and the Sigrid Jusélius Foundation. The authors wish to thank Kalle Kantola, Lea Hedman, and Arun Kumar for technical and statistical assistance. M.S. expresses his gratitude to the Ministry of Science, Research and Technology of Iran for a research scholarship as well as to Bu-Ali Sina University, Hamedan for the opportunity to advanced studies. For friendly help with language revision we are much indebted to Carolyn Brimley Norris from language services of Helsinki University.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
MS carried out the molecular and serological studies and drafted the manuscript. MA, LJ, TJ, and OR provided the study materials. TC produced the recombinant VLPS and participated in the serological study. MS-V and KH designed, coordinated, and participated in writing the manuscript. All authors read, revised, and approved the final version of the manuscript.