Background
Systemic lupus erythematosus (SLE) is a systemic autoimmune disease. Renal involvement, namely lupus nephritis, is a common and potentially lethal complication of SLE. It involves the production of pathogenic autoantibodies, hypocomplementemia, deposition of immune complexes, inflammation and renal damage [
1]. The morphologic changes in lupus nephritis include a spectrum of vascular, glomerular and tubulointerstitial lesions. Glomerular injury comprises mesangial hypercellularity and matrix accumulation as the mesangial pattern, with leukocyte accumulation, endothelial cell injury and endocapillary proliferation as the endothelial pattern, and a nonexudative, nonproliferative capillary wall lesion as the epithelial pattern [
2]. Although the pathogenesis of lupus nephritis has yet to be determined, increasing lines of evidence have indicated a potential role of cytokines in the development and progression of lupus nephritis [
3].
MRL/MpJ-lpr/lpr (MRL/lpr) mice develop spontaneous autoimmune diseases and the main histopathological features of the glomerular lesions resemble those shown in human lupus nephritis. These serious glomerular diseases that develop spontaneously in MRL/lpr mice are commonly associated with cytokine abnormalities. FKN is a unique member of the CX3C superfamily of chemokines [
4] and acts as a chemotatic agent. It also functions as an adhesion molecule and mediates immune injury and is involved in the occurrence and development of renal diseases [
5‐
7], including lupus nephritis [
8]. FKN can be synthesized by a variety of progressive glomerular diseases [
9‐
11] in lupus-prone MRL/lpr mice [
8,
11,
12]. It is produced as an intracellular precursor protein and transported to the cell surface as a mature protein after being N-glycosylated [
13]. FKN is significantly expressed in the glomeruli of 12-week-old MRL/lpr mice [
14]. N-terminal-truncated analogs acting as FKN antagonists can reduce glomerular damage and interstitial mononuclear cell infiltration [
14]. FKN is produced secondary to the deposition of immune complexes [
14]. These results indicate that FKN may be able to modify the progression of renal damage in MRL/lpr mice.
NF-κB also has been shown to be involved in lupus nephritis [
15]. LPS can induce moderate albuminuria and aggravate glomerular nephritis in MRL/lpr mice [
16]. LPS induces expression of inflammatory cytokines and activation of the NF-κB pathway [
17], FKN mRNA and protein expression and these have been shown to increase in mesangial cells stimulated with LPS [
18]. FKN has also been shown to induce proliferation of mesangial cells [
19]. NF-κB may thus be an important target for an anti-inflammatory approach to treat LPS-induced alterations of FKN expression.
Current induction therapy for some severe forms of lupus nephritis such as Class III/IV are various combinations of glucocorticoids with other agents [
20] because of their important anti-inflammatory and immunosuppressive effects [
21,
22]. In human lupus nephritis, the expression of FKN in glomeruli correlates with the histopathologic activity index whereby the glomerular FKN expression has a tendency to decrease with glucocorticoid therapy [
8]. MP is one of the glucocorticoids used as an initial starting point of treatment for lupus nephritis. In respiratory epithelial cells, the NF-κB pathway regulates the expression of FKN, and glucocorticoids have been shown to inhibit FKN expression in a glucocorticoid receptor-dependent (RU486 sensitive) manner [
23]. The mechanisms by which MP inhibits inflammation and the signaling pathways in lupus nephritis, such as the FKN and NF-κB pathways, are not fully understood.
This study uses a molecular biology-based approach to demonstrate the expression of FKN and activation of NF-κB in MRL/lpr mice treated with LPS. In addition, the molecular mechanisms and the pathways involved in LPS-induced FKN expression in lupus nephritis and the molecular mechanisms by which MP modulates lupus nephritis are explored.
Methods
Animals
MRL/lpr mice weighing 18-21 g were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). Mice were fed under conditions free of specific pathogens at 22-25 °C and kept in an environment of 40-60 % relative humidity in the Animal Research Institute of Youjiang Medical University for Nationalities. All procedures involving mice were approved by the Committee on the Ethics of Animal Experiments of Youjiang Medical University for Nationalities and were carried out in accordance with the National Institute of Health guidelines.
Experimental protocol
Forty-eight female MRL/lpr mice at 12 weeks of age were randomly distributed into six groups that received intraperitoneal injections as follows:
(1)
twice weekly injections for 8 weeks of MP (25 mg/kg body weight, Pfizer, Belgium) - MP-treated mice
(2)
twice weekly injections for 8 weeks of SC-514 (25 mg/kg body weight, SML0557 from Sigma-Aldrich, USA). SC-514 is a cell-permeable, potent and selective ATP competitive inhibitor of NF-κB kinase-2 that specifically blocks NF-κB-dependent gene expression. - SC514-treated mice
(3)
twice weekly injections for 8 weeks of normal saline and a single injection of LPS (5.0 mg/kg body weight, L2880, Sigma-Aldrich, USA) 8 h prior to sacrifice as described previously [
24] - LPS-induced mice
(4)
twice weekly injections for 8 weeks of MP and a single injection of LPS 8 h prior to sacrifice - LPS + MP mice
(5)
twice weekly injections for 8 weeks of SC-514 and a single injection of LPS 8 h prior to sacrifice - LPS + SC mice
(6)
twice weekly injections for 8 weeks of normal saline - control mice.
Assessment of urine protein and renal function
Urine samples were collected using metabolic cages for 24 h before sacrifice. Urine protein was measured as described previously [
25]. Blood serum levels of urea nitrogen (BUN) and creatinine (Cr) were determined at 20 weeks when all mice were subsequently sacrificed 8 h after the last injection of LPS or saline as described previously [
25]. Renal cortical samples were harvested at this time.
Histopathological analysis
Tissue samples were fixed with 10 % formalin in 0.01 mol/L phosphate buffer (pH 7.2) and then embedded in paraffin for histopathology. The slides were stained with periodic acid-silver methenamine (PASM) for examination under a light microscope. The examination of renal pathology was performed in a blinded fashion by a pathologist.
RNA isolation and real-time PCR assays
Total RNA of renal cortices was extracted using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instructions. First-strand cDNA was then made from the total RNA using M-MLV reverse transcriptase (C28025, Invitrogen, Shanghai, China) with random primers. The expression levels of FKN and p65 were measured by real-time qPCR using SYBR Green I (204143, Qiagen, Germany) through forced denaturation at 95 °C for 30 s and 40 cycles of denaturation at 95 °C for 10 s, annealing and extension at 60 °C for 30 s each. Primer sequences were designed using the Primer Premier 3.0 program. The optimal reference genes were EEF1A1 and GAPDH in MRL/lpr mice, determined by geNorm 3.5 software as described previously [
26]. Primer sequences (Invitrogen, USA) were as follows: mice FKN forward 5′- CGACAAGATGACCTCACGAA -3′, reverse 5′- CTGTGTCGTCTCCAGGACAA -3′(NM_009142.3); mice P65 forward 5′- TAAGCCGTACACAGCCACTG -3′, reverse 5′ - CCAGGTAAATGGCTGCAGAT -3′ (NM_010908.4); mice EEF1A1 forward 5′- TAGACGAGGCAATGTTGCTG -3′, reverse 5′ - AGCGTAGCCAGCACTGATTT -3′(NM_010106.2); mice GAPDH forward 5′- AACTTTGGCATTGTGGAAGG -3′, reverse 5′ - GGATGCAGGGATGATGTTCT -3′(NM_008084.2). The comparative gene expression was calculated by 2
-△△Ct method as described previously [
27].
Immunohistochemistry
For immunohistochemistry (IHC), formalin-fixed and paraffin embedded renal sections were prepared as described previously, and then incubated in 3 % hydrogen peroxide for 15 min and normal goat serum for 10 min to block endogenous peroxidase. The sections were incubated with either anti-FKN antibody (ab25088, Abcam Ltd, Hong Kong, 1:200 dilution) or anti-NFκB p65 antibody (ab31481, Abcam Ltd, Hong Kong, 1:100 dilution) overnight at 4 °C and then incubated with goat polyclonal secondary antibody to rabbit IgG-H&L (HRP) (ab6721, Abcam Ltd, Hong Kong, 1:500 dilution) for 30 min at 37 °C. Normal rabbit serum served as a negative control. To compare the expression levels of FKN and p65 in glomerular cells by IHC, staining intensity was evaluated semiquantitatively according to the previous paper [
10]. Forty or more glomeruli were examined on each slide and assigned values of staining intensity from 0 to 3+. An intensity score was calculated as: (% glomeruli intensity (negative) × 0) + (% glomeruli intensity (trace intensity) × 0.5) + (% glomeruli (1+) intensity × 1) + (% glomeruli (2+) intensity × 2) + (% glomeruli (3+) intensity × 3). The values typically ranged from 0 to a maximum of 300.
Western blot analysis
Aliquots of total kidney homogenate from individual animals were diluted in lysis buffer (50 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1 % Triton X-100, 0.1 % SDS, 2 mM EDTA, 0.1 mM EGTA, 5 mM NaF, 1 mM Na
3VO
4, 5 mM Na
2PO
4 and 1 × proteinase inhibitor cocktail (Beyotime Institute of Biotechnology, China) to a final protein concentration of 2 μg/μL. Western blot analysis was conducted and quantified as described by Müller et al. [
28]. The following antibodies were used: rabbit anti-FKN antibody (ab25088, Abcam Ltd, Hong Kong, 1:100 dilution) or anti-NFκB p65 antibody (ab31481, Abcam Ltd, Hong Kong, 1:200 dilution) or anti-NF-κB phospho p65 antibody (ab28810, Abcam Ltd, Hong Kong, 1:100 dilution) to evaluate the activity of NF-κB pathway, and mouse anti-beta actin monoclonal antibody (AA128, Beyotime Institute of Biotechnology, China, 1:500 dilution) followed by the goat polyclonal secondary antibody to rabbit IgG-H&L (HRP) (ab6721, Abcam Ltd, Hong Kong, 1:1000 dilution) or anti-mouse IgG-H + L (A0216, Beyotime Institute of Biotechnology, China, 1:1000 dilution). The image of western blots was scanned by Quantity One software and the original intensity of each specific band was quantified with freeware image analysis software, NIH Image (National Institute of Health, Bethesda, Md., USA).
Statistical analysis
Data are reported as means ± SE for normally distributed data and median (range) for nonparametric data. The comparisons of gene expression levels between groups were performed by using the one-way ANOVA for parametric data, F-test for equality of variances and Newman-Keuls test for heterogeneity of variance. All analyses were conducted with SPSS software, version18.0. P value < 0.05 was considered statistically significantly.
Discussion
The results demonstrate that LPS induced the expression of FKN and activation of NF-κB in renal cortex of MRL/lpr mice and that MP significantly reduced proteinuria, ameliorated renal function, severity of renal pathology and LPS-induced kidney injury in MRL/lpr mice. MP downregulated the LPS-induced FKN expression and NF-κB activation in kidney of MRL/lpr mice, consistent with the role of the NF-κB inhibitor, SC-514.
Chemokines are known to be involved in the lupus disease process. CCL2 (also known as monocyte chemotactic protein-1, MCP-1) [
29] and CXCL10 are good biomarkers to indicate the activity of lupus nephritis [
30] and the potential flares in SLE [
31]. CCL2 and CXCL10 are known to be raised in the blood of SLE patients [
32]. Compared to treated patients, expression of CCL2 and CXCL10 mRNA in untreated SLE patients’ blood were significantly higher. This indicates that chemokines are potential therapeutic targets in SLE patients [
33]. Kulkarni et al. [
34] used the mNOX-E36 to inhibit CCL2 in MRL/lpr mice and found prolonged survival associated with the improvement of lupus nephritis. In addition, CCL2 antagonists have been shown to be beneficial in the treatment of lupus nephritis. Kassianos et al. demonstrated recently the role of FKN and its receptor CX3CR1 in the recruitment and retention of human kidney dendritic cells (DCs), and showed the TGF-β-producing, CX3CL1-expressing CD1c
+ DCs were recruited and retained within the tubuleinterstitium during fibrotic kidney disease via proximal tubular epithelial cell (PTEC)-derived FKN [
35].
Expression of FKN mRNA and protein significantly increased in the renal cortex of the LPS-induced group in lupus mice, which shows that LPS can induce FKN expression in MRL/lpr mice. These data are consistent with the results seen in mesangial cells
in vitro [
18]. MP inhibited significantly the expression of FKN mRNA and protein in renal cortex of MRL/lpr mice. These effects correlated with a reduction in proteinuria as well as amelioration of renal function and renal pathology. SC-514 is a selective and reversible inhibitor of IKKβ (IKK-2), affecting NF-κB nuclear import/export as well as the phosphorylation and transactivation of p65. SC-514 was used to suppress the NF-κB activity in this study. SC-514 also significantly inhibited expression of FKN mRNA and protein in renal cortex of MRL/lpr mice. The results suggest that MP as well as SC-514 can inhibit the increased expression of FKN induced by LPS in MRL/lpr mice. However, the effect of SC-514 was not paralleled to that of MP on proteinuria, renal function and glomerular proliferation in MRL/lpr mice. Therefore, in addition to NF-κB pathway, there may be some other mechanisms involved in the treatment of lupus nephritis that needs to be explored.
IκBs, which regulate the nuclear translocation of NF-κB, are critically associated to the differentiation of B cells and with the auto-antibodies produced during progression of SLE disease [
36]. Activation of NF-κB in renal cortex in MRL/lpr mice was detected in this study. The significant increase in expression of NF-κB p65 and activation of NF-κB induced by LPS probably contribute to the progression of glomerular lesions in the lupus nephritis model. MP treatment significantly inhibited expression of NF-κB p65 and activation of the NF-κB pathway, which was confirmed by the use of the NF-κB inhibitor, SC-514. These effects are likely to be associated with expression of FKN mRNA and protein. The other chemokine member, CXCL12 and its receptor CXCR4, have been shown to be markedly elevated in infected lupus mice via activation of the NF-κB signaling pathway [
37]. The data presented here are consistent with previous observations summarizing the cytokine-suppressing effects of NF-κB inhibitors resulting in a reduced FKN expression during inflammation-associated diseases [
38]. Accordingly, these results are consistent for a central mechanism of MP in modulation of FKN expression by suppressing the activation of NF-κB during lupus nephritis.
Acknowledgments
This study was supported by grants from the National Natural Science Foundation of China, No. 81160013/H0111, Science and Technique Research Projects of Guangxi, No.1140003B-93 and the Key Programs of Natural Science Foundation of Guangxi, No.2011GXNSFD018039.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
YY and YQ carried out the experimental work. YY and PL participated in the design of the study and together with FY performed the statistical analysis. PL, XL and JL conceived of the study and participated in its design and coordination. YY, SRS and PL helped to draft the manuscript. All authors read and approved the final manuscript.
Liao Pinhu is the corresponding author.