Background
Nephroblastoma is one of the most common solid tumours in children, with an annual incidence rate of 1 case per 100,000 children. This disease comprises 8–10% of all neoplasms in that group [
1,
2]. The peak incidence occurs in children, between 1 to 5 years of age [
1,
2]. Although the pathogenesis of nephroblastoma remains undiscovered, increasing evidence has suggested that multiple signalling pathways, such as microRNAs, and epigenetic mechanisms play pivotal roles in its progression.
MicroRNAs (miRNAs) are endogenously produced, small (17~25-nucleotides long), non-coding single-stranded RNAs that play important roles in the regulation of crucial biological processes including cell apoptosis, metabolism, inflammation and tumorigenesis, primarily by inhibiting gene expression [
3]. MiRNAs regulate the expression of mRNA molecules by binding to the complementary sequence in 3′-untraslated regions (3′UTRs) or the open reading frames of target genes [
4,
5]. It has been studied that altered expression of miRNAs contributes to the initiation, invasion and metastasis of various types of cancer [
6,
7]. miRNA 140–5p (miR-140-5p) has been shown to participate in various tumor processes. Yang et al. demonstrated that miR-140-5p could suppress tumor progression by targeting TGFBRI and FGF9 in hepatocellular carcinoma [
8]. Yunfeng et al. demonstrated that miR-140-5p suppressed tumor growth and metastasis of non-small cell lung cancer by targeting IGF1R [
9]. However, the function of miR-140-5p in the progression of nephroblastoma has not been explored.
TGFBRI and IGF1R can participate in the regulation of cell proliferation, differentiation, invasion and migration of cancer cells [
10]. IGF1R is a tyrosine kinase receptor, which binds to IGF1 and IGF2. Following binding, the receptor auto-phosphorylates on the corresponding tyrosine residues [
11,
12]. TGFBRI is a serine/threonine kinase receptor that is a member of the TGF-β signaling pathway, and exhibits metastatic properties by invading surrounding cells [
13]. Previous reports have indicated that the TGF-β and IGF signaling pathways are associated with the development of nephroblastoma [
14,
15]. However, the roles of TGFBRI and IGF1R in the progress of nephroblastoma require further investigation.
The purpose of the present study was to detect the potential role of miR-140-5p in the development of nephroblastoma, and the regulatory mechanism of this interaction.
Methods
Cell culture and clinical tissue specimens
The human nephroblastoma cell lines G401 and WT-CLS1 were matained in our labs and both were cultured in McCoy’s 5A medium containing 10% fetal bovine serum, 100 IU/ml penicillin and 100 mg/ml streptomycin. HEK-293 T cell line was maintained in DMEM supplemented with 10% fetal bovine serum, 100 IU/ml penicillin and 100 mg/ml streptomycin. All cells were cultured in a humidified atmosphere containing 5% CO2 at 37 °C.
Nephroblastoma tissue and adjacent non-cancerous tissue (ANT) samples were obtained from nephroblastoma children undergoing tumor resection at the Department of Surgery in the Affiliated Children’s Hospital of the Capital Institute of Pediatrics. The patients were recruited from September 2010 to April 2013. The tissue samples were immediately frozen in liquid nitrogen, and stored at − 80 °C until further analysis [
16]. All the patients did not receive chemotherapy before surgical resection. The study was approved by the Ethics Committee for clinical research of the Capital Institute of Pediatrics.
miRNA Array
miRNA expression profile of tumor tissue samples and ANT were detected by miRCURY LNA miRNA chips 16.0 (Exiqon, Vedbaek, Denmark). The assay was conducted following the protocol of the manufacturer. Image analysis was processed by using the image analysis software Genepix Pro 6.0 (Axon Instruments) as described [
17].
RNA purification and quantitative Real-Time PCR (qRT-PCR)
Total RNA was isolated from cells and tissue specimens with TRIzol reagent (Invitrogen, USA) as performed by the manufacturer’s instructions [
18]. Quantitative real-time RT-PCR analysis was used to determine the level of mature miR-140-5p. One microgram of total RNA sample was reverse-transcribed to first-strand cDNA with the PrimeScript™ RT reagent kit as described by the manufacturer (Takara, Dalian, China). Real-time -PCR was conducted in triplicate, using SYBR Premix Ex Taq™ (Takara). The amplification was carried out on a 7900HT system with the SYBR Premix Ex Taq™ (Takara). The primer sequences used for quantitative real-time -PCR analyses of miRNA-140-5p were as follows: forward, 5’CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCA3’ and reverse, 5′ ACACTCCAGCTGGGCAGTGGTTTTACCCTATG3’. The primer sequences used for small nuclear RNA (U6) were as following: forward, 5′-CAAATTCGTGAAGCGTTCCATAT-3′ and reverse 5′-GTGCAGGGTCCGAGGT-3′. The 2-∆∆Ct method was used to examine the relative expression levels of miRNAs. Specific siRNAs used to silence IGF-1R and TGFBRI gene were obtained from CST (CST, USA).
Lentiviral packaging of miR-140-5p
Oligonucleotides of miRNA-140-5p were synthesized, based on the sequence of human miRNA-140-5p (5′- cagugguuuuacccuaugguag − 3′, MIMAT0000431) from the miRBase database. The oligonucleotides were introduced into a pGCSIL-GFP plasmid (GeneChem Co. Ltd. Shanghai, China). pHelper 1.0 and pHelper 2.0 vector used for lentiviral construction were also obtained from Shanghai GeneChem Co. Ltd.. The generation of lentiviruses and the evaluation of the viral titration were conducted as described previously [
19]. Lentiviruses carrying miR-140-5p and/or negative control sequences were packaged following the instructions of the manufacturer (Shanghai Genechem Co., Ltd., Shanghai, China).
Luciferase Reporter Assay
The plasmids used for firefly luciferase reporter assay were packaged by Genechem (Shanghai Genechem, China). And the plasmids designated IGF1R-WT, TGFBRI-WT (wild-type of miR-140-5p, targeting to IGF1R 3′-UTR and TGFBRI 3′-UTR), IGF1R-MU and TGFBRI-MU (mutated miR-140-5p, targeting to IGF1R 3′-UTR and TGFBRI 3′-UTR) were used. The mimic and the mimic negative control of miR-140-5p were purchased from Ribobio (Guangzhou RiboBio, Guangzhou, China). HEK293 cells were cultured in complete medium for 24 h before transfection. 0.05 μg firefly luciferase reporter, 0.05 μg IGF1R/TGFBRI plasmid, and 0.01 μg Renilla luciferase control vector were co-transfected into HEK293 cells by lipofectamine 2000 (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. At 48 h post-transfection, luciferase activity was detected by using the Dual-Glo luciferase reporter system (Promega Corp., Madison, WI, USA) in accordance with the protocols of manufacturer [
20]. The relative luciferase activity value was achieved against the renilla control.
miRNA pull down assay
Biotin-coupled miRNA and mRNA pull-down assays were carried out as described in detail elsewhere [
21]. Briefly, Biotinylated miRNA-140-5 probe were generated: (cagugguuuuacccuaugguag-biotin and control biotinylated probe: cuaccauaggguaaaaccacug-biotin, Generay,Shanghai,China). Biotin-coupled RNA probe and G401 cell total RNA were incubated in RNA buffer without RNAase at 4 °C overnight. Then the biotin-coupled RNA complexes were pulled down by using M-280 Streptavidin Dynabeads (Invitrogen, Carlsbad, CA). TGFBR I and IGF1R abundance in the bound fractions was calculated by RT-PCR analysis.
Cell proliferation assay
Cell proliferation viability was measured using the cell counting kit-8 assay kit (Dojindo Laboratories, Japan) as described. Cells were seeded in 96-well plates, and incubated for 48, 72 and 96 h at 37 °C after transfection. The CCK-8 solution was added to each well at the end of incubation, and then cells were further cultured at 37 °C for an additional 1.5 h. Subsequently, the absorbance (450 nm) value of each well was estimated by a microplate reader.
Cell cycle analysis
Flow cytometry was used for cell cycle analysis with a Propidium Iodide (PI) cell cycle detection kit following the manufacturer’s protocols (Transgen Biotech, Beijing, China).
Migration assay
The Ibidi cell migration (gap closure/cell-exclusion zonemigration assays) technology (Ibidi, Martinsried, Germany) was used for the migratory assay. Briefly, G401 or WT-CLS1 cells were cultured, and then miRNA was transfected into the cells. Subsequently, the cells were collected with trypsin and washed with PBS, and then resuspended in DMEM containing 10% FBS (~ 7.0 × 105 cells/ml). Next, 70 μl cell suspension was added to the wells of the culture-insert on a 35-mm dish, cultured in a incubator with 5% CO2 atmosphere at 37 °C. At 24 h after incubation, the culture-insert was removed using sterilized tweezers. Then cell migration was observed over time. At 12 h after culture, the increase of the area was calculated using ImageJ.
Western Blot Analysis
The cells or nephroblastoma tissue were homogenized and lysed in ice-cold RIPA lysis buffer (Kangwei, Beijing, China) including protease and phosphatase inhibitors. The cell debris was removed by centrifuging at 14,000×g for 20 min at 4 °C. The protein samples were prepared and separated by 12% SDS-PAGE, and then electrophoretically transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA) [
16]. Subsequently, the membranes were incubated for 12 h at 4 °C with primary antibodies, including anti-IGF1R, anti-p-AKT, anti-Smad2/3 anti-GAPDH (CST, USA) and anti-TGFBRI (R&D, USA) antibodies following by incubation with secondary antibodies. The binding of all antibodies was visualized using enhanced chemiluminescence (ECL) western blotting detection system (Amersham Life Science, Piscataway, NJ, USA) following the manufacturer’s protocol. GAPDH was utilized as a loading control.
Statistical Analysis
The experiments were performed in triplicate. The data were analyzed by GraphPad Prism 5 (La Jolla, CA, USA). Statistical analysis was performed by using SPSS Statistical Package (v. 13.0, SPSS Inc., Chicago, IL). The Mann-Whitney U test was used for the analysis of the expression data of miR-140-5p. The Student’s t-test was utilized for unpaired sample comparison. Statistical significance levels were set at P < 0.05.
Discussion
Nephroblastoma also called Wilms’ tumor, is one of the most common solid tumours in children. Increasing evidence has suggested that multiple signaling, epigenetic and miRNA pathways are involved in its progression [
24]. Aberrant miRNA expression is closely associated with various types of cancer [
25,
26], and numerous miRNAs have significant functions in cancer cell proliferation, apoptosis, migration and neoplastic transformation [
8,
27,
28]. In the present study, we investigated the miRNA expression profile of nephroblastoma specimens and concluded that miR-140-5p was downregulated in the tumor site of these samples.
MiR-140-5p levels have been shown to be decreased in multiple cancer types, such as hepatocellular carcinoma [
8], colorectal cancer [
29] and gastric cancer [
30]. MiR- 140-5p upregulation can inhibit cell proliferation. Yang et al. demonstrated that miR-140-5p levels were decreased in HCC tissues and that miR-140-5p could regulate the activity of ERK/MAPK signaling by directly targeting TGFBRI during the metastatic process of hepatocellular carcinoma [
8]. Yunfeng et al. demonstrated that miR-140-5p could suppress tumor growth and metastasis of non-small cell lung cancer by targeting IGF1R [
9]. However, the function of miR-140-5p in the proliferation of Wilms’ tumor has not been previously studied. In the present study, we proved that TGFBR I and IGF1R are direct target of mi-140-5p, whereas the data further indicated that overexpression of miR-140-5p could modulate their expression and the proliferation and metastasis of nephroblastoma cells.
TGF-β signaling regulates the growth, differentiation, and metastasis of various types of cells. It functions both as a tumor suppressor and tumor promoter [
31,
32]. In the early stages of cancer, TGF-β serves as a tumor suppressor [
31]. However, in the advanced stages of cancer, TGF-β facilitates the progression and metastasis of tumors. In the present study, we found that inhibition of TGFBRI by siRNA could suppress cell proliferation and invasion that was in accordance with previous studies that examined the function of miR-140-5p during the advanced stages of cancer.
Zhai et al. identified SMAD2 as a direct target of miR-140-5p in CRC cells [
33]. The data of the present study indicated that SMAD2/3 levels were reduced in WT-CLS1 and G401 cells when high levels of miR-140-5p were present. We further demonstrated that exogenous TGFBRI expression could recover the activity of SMAD2/3 in miR-140-5p-overexpressing WT-CLS1 and G401 cells. Considering that SMAD2/3 belongs to the TGF-β signaling pathway and that it is a downstream mediator of TGFBRI [
34], we reasoned that inhibition of SMAD2/3 could be attributed notably to TGFBRI reduction. This finding indicated that miR-140-5p was not a direct target in Wilms’ tumor and that its function in carcinogenesis may be disease-specific. This finding indicated that SMAD2/3 was not a direct target of miR-140-5p in Wilms’ tumor and that its function in carcinogenesis may be disease-specific.
Several studies have shown that overexpression of the IGF-1 receptor (IGF-1R) constitutes a typical hallmark of the majority of cancer types [
9]. Overexpression of IGF1R was associated with poor outcome in Wilms’ tumors, whereas the inhibition of IGF1R activity could decrease cancer malignancy [
35]. One of the main downstream signals of IGF1R is AKT, which acts as a key regulator in cancer progression by promoting cell growth, anti-apoptotic effects, and cell invasion [
36]. We demonstrated in the present study that miR-140-5p could inhibit IGF1R in G401 and WT-CLS1 cells, and that activation of p-AKT was also significantly decreased.
In the present study, we demonstrated that IGF-1R and TGFBRI were highly expressed in Wilms’ tumor tissues and that they participated in Wilms’ tumor progression. Overexpression of miR-140-5p inhibited cell progression via the IGF-1R/AKT and TGFBRI/SMAD2/3 pathways. We further demonstrated that both exogenous IGF-1R and TGFBRI in miR-140-5p overexpression cells could recover cell proliferation to normal levels, while ectopic either could not. Our data suggested that miR-140-5p regulated Wilms’ tumor progression and TGFBRI/SMAD2/3 and IGF-1R/AKT signaling pathways participate in this process.
Acknowledgements
We would like to thank all of our colleagues for their contribution to this study.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.