miR-140-5p could suppress tumor proliferation and progression by targeting TGFBRI/SMAD2/3 and IGF-1R/AKT signaling pathways in Wilms’ tumor

The human nephroblastoma cell lines G401 and WT-CLS1 were matained in our labs and both were cultured in McCoy’s 5A medium containing 10% fetal bovine serum, 100 IU/ml penicillin and 100 mg/ml streptomycin. HEK-293 T cell line was maintained in DMEM supplemented with 10% fetal bovine serum, 100 IU/ml penicillin and 100 mg/ml streptomycin. All cells were cultured in a humidified atmosphere containing 5% CO₂ at 37 °C.

Nephroblastoma tissue and adjacent non-cancerous tissue (ANT) samples were obtained from nephroblastoma children undergoing tumor resection at the Department of Surgery in the Affiliated Children’s Hospital of the Capital Institute of Pediatrics. The patients were recruited from September 2010 to April 2013. The tissue samples were immediately frozen in liquid nitrogen, and stored at − 80 °C until further analysis [16]. All the patients did not receive chemotherapy before surgical resection. The study was approved by the Ethics Committee for clinical research of the Capital Institute of Pediatrics.

miRNA expression profile of tumor tissue samples and ANT were detected by miRCURY LNA miRNA chips 16.0 (Exiqon, Vedbaek, Denmark). The assay was conducted following the protocol of the manufacturer. Image analysis was processed by using the image analysis software Genepix Pro 6.0 (Axon Instruments) as described [17].

Total RNA was isolated from cells and tissue specimens with TRIzol reagent (Invitrogen, USA) as performed by the manufacturer’s instructions [18]. Quantitative real-time RT-PCR analysis was used to determine the level of mature miR-140-5p. One microgram of total RNA sample was reverse-transcribed to first-strand cDNA with the PrimeScript™ RT reagent kit as described by the manufacturer (Takara, Dalian, China). Real-time -PCR was conducted in triplicate, using SYBR Premix Ex Taq™ (Takara). The amplification was carried out on a 7900HT system with the SYBR Premix Ex Taq™ (Takara). The primer sequences used for quantitative real-time -PCR analyses of miRNA-140-5p were as follows: forward, 5’CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCA3’ and reverse, 5′ ACACTCCAGCTGGGCAGTGGTTTTACCCTATG3’. The primer sequences used for small nuclear RNA (U6) were as following: forward, 5′-CAAATTCGTGAAGCGTTCCATAT-3′ and reverse 5′-GTGCAGGGTCCGAGGT-3′. The 2-∆∆Ct method was used to examine the relative expression levels of miRNAs. Specific siRNAs used to silence IGF-1R and TGFBRI gene were obtained from CST (CST, USA).

Oligonucleotides of miRNA-140-5p were synthesized, based on the sequence of human miRNA-140-5p (5′- cagugguuuuacccuaugguag − 3′, MIMAT0000431) from the miRBase database. The oligonucleotides were introduced into a pGCSIL-GFP plasmid (GeneChem Co. Ltd. Shanghai, China). pHelper 1.0 and pHelper 2.0 vector used for lentiviral construction were also obtained from Shanghai GeneChem Co. Ltd.. The generation of lentiviruses and the evaluation of the viral titration were conducted as described previously [19]. Lentiviruses carrying miR-140-5p and/or negative control sequences were packaged following the instructions of the manufacturer (Shanghai Genechem Co., Ltd., Shanghai, China).

The plasmids used for firefly luciferase reporter assay were packaged by Genechem (Shanghai Genechem, China). And the plasmids designated IGF1R-WT, TGFBRI-WT (wild-type of miR-140-5p, targeting to IGF1R 3′-UTR and TGFBRI 3′-UTR), IGF1R-MU and TGFBRI-MU (mutated miR-140-5p, targeting to IGF1R 3′-UTR and TGFBRI 3′-UTR) were used. The mimic and the mimic negative control of miR-140-5p were purchased from Ribobio (Guangzhou RiboBio, Guangzhou, China). HEK293 cells were cultured in complete medium for 24 h before transfection. 0.05 μg firefly luciferase reporter, 0.05 μg IGF1R/TGFBRI plasmid, and 0.01 μg Renilla luciferase control vector were co-transfected into HEK293 cells by lipofectamine 2000 (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. At 48 h post-transfection, luciferase activity was detected by using the Dual-Glo luciferase reporter system (Promega Corp., Madison, WI, USA) in accordance with the protocols of manufacturer [20]. The relative luciferase activity value was achieved against the renilla control.

Biotin-coupled miRNA and mRNA pull-down assays were carried out as described in detail elsewhere [21]. Briefly, Biotinylated miRNA-140-5 probe were generated: (cagugguuuuacccuaugguag-biotin and control biotinylated probe: cuaccauaggguaaaaccacug-biotin, Generay,Shanghai,China). Biotin-coupled RNA probe and G401 cell total RNA were incubated in RNA buffer without RNAase at 4 °C overnight. Then the biotin-coupled RNA complexes were pulled down by using M-280 Streptavidin Dynabeads (Invitrogen, Carlsbad, CA). TGFBR I and IGF1R abundance in the bound fractions was calculated by RT-PCR analysis.

Cell proliferation viability was measured using the cell counting kit-8 assay kit (Dojindo Laboratories, Japan) as described. Cells were seeded in 96-well plates, and incubated for 48, 72 and 96 h at 37 °C after transfection. The CCK-8 solution was added to each well at the end of incubation, and then cells were further cultured at 37 °C for an additional 1.5 h. Subsequently, the absorbance (450 nm) value of each well was estimated by a microplate reader.

Flow cytometry was used for cell cycle analysis with a Propidium Iodide (PI) cell cycle detection kit following the manufacturer’s protocols (Transgen Biotech, Beijing, China).

The Ibidi cell migration (gap closure/cell-exclusion zonemigration assays) technology (Ibidi, Martinsried, Germany) was used for the migratory assay. Briefly, G401 or WT-CLS1 cells were cultured, and then miRNA was transfected into the cells. Subsequently, the cells were collected with trypsin and washed with PBS, and then resuspended in DMEM containing 10% FBS (~ 7.0 × 10⁵ cells/ml). Next, 70 μl cell suspension was added to the wells of the culture-insert on a 35-mm dish, cultured in a incubator with 5% CO₂ atmosphere at 37 °C. At 24 h after incubation, the culture-insert was removed using sterilized tweezers. Then cell migration was observed over time. At 12 h after culture, the increase of the area was calculated using ImageJ.

The cells or nephroblastoma tissue were homogenized and lysed in ice-cold RIPA lysis buffer (Kangwei, Beijing, China) including protease and phosphatase inhibitors. The cell debris was removed by centrifuging at 14,000×g for 20 min at 4 °C. The protein samples were prepared and separated by 12% SDS-PAGE, and then electrophoretically transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA) [16]. Subsequently, the membranes were incubated for 12 h at 4 °C with primary antibodies, including anti-IGF1R, anti-p-AKT, anti-Smad2/3 anti-GAPDH (CST, USA) and anti-TGFBRI (R&D, USA) antibodies following by incubation with secondary antibodies. The binding of all antibodies was visualized using enhanced chemiluminescence (ECL) western blotting detection system (Amersham Life Science, Piscataway, NJ, USA) following the manufacturer’s protocol. GAPDH was utilized as a loading control.

miRCURY LNA microRNA chips from Exiqon was used to analyze three cases of nephroblastoma and adjacent normal tissue (ANT) obtained by surgical removal. miRNA microarray analysis revealed that miR-140-5p was significantly downregulated in nephroblastoma tissues compared with the corresponding levels of expression in ANT. qRT-PCR was performed in 23 cases of nephroblastoma tissues and 23 ANTs. qRT-PCR analysis revealed that the expression of miRNA-140-5p was significantly decreased in nephroblastoma tissues compared with that of the control group (Fig. 1a). To assess the feasibility of miR-140-5p expression in nephroblastoma prognosis, we analyzed the correlation between the clinicopathological characteristics of Wilms’ tumor patients and the miRNA-140-5p levels. The data suggested that patients with higher tumor stage and unfavorable histology exhibited lower levels of miRNA-140-5p (Fig. 1b). The results indicated that miRNA-140-5p may participate in Wilms’ tumor progression.

To further assess the impact of miR-140-5p on tumor growth and metastasis, we performed cell proliferation and migration assays. Two nephroblastoma cell lines (G401 and WT-CLS1) were infected with lentivirus containing miR-140-5p sequence, or control lentivirus containing non-specific sequences at an MOI = 10. MiRNA-140-5p expression levels were higher in the miR-140-5p transfection group than those in the control group (data not shown). Cell proliferation and migration assays were performed. The proliferation assay indicated that lentiviral-induced ectopic miR-140-5p resulted in a significant decrease in cell proliferation in both G401 and WT-CLS1 cells (Fig. 2a). The migration assay indicated that overexpression of miR-140-5p significantly suppressed the migratory abilities of the nephroblastoma cell lines (Fig. 2b). We subsequently performed cell cycle analysis and revealed that overexpression of miR-140-5p decreased the percentage of cells in the S phase in G401 and WT-CLS1 cells, while it concomitantly increased the percentage of cells in the G1 phase (P < 0.05) (Fig. 2c).

To explore the underlying mechanism of miR-140-5p in nephroblastoma, we performed a bioinformatics search for candidate targets of miR-140-5p in genes that were involved in nephroblastoma pathogenesis using the TargetScan (http://​www.​targetscan.​org), PicTar (http://​www.​pictar.​org/​) and miRnada (http://​miranda.​org.​uk/​) databases. The analysis indicated that miR-140-5p possibly regulated the IGF1R and TGFBRI genes since their 3′-UTR included the binding sites for the seed region of miR-140-5p (Fig. 3a and b).

To verify this speculation, HEK293 cells were transfected with miR-140-5p, mimic control, the 3′-UTR wild type of the IGF1R/TGFBRI gene (WT-3′-UTR), and its mutant form (MU-3′-UTR). The results demonstrated that miR-140-5p mimic specifically reduced the activity of a reporter containing the IGF1R/TGFBRI-3′-UTR-WT(P < 0.05), while no effect was apparent in the miR-NC or IGF1R/TGFBRI-3′-UTR-MU groups, implying the inhibitory effect of miR-140-5p on the IGF1R and TGFBRI genes (Fig. 3a and b).

In order to investigate whether miR-140-5p could bind to IGF1R/TGFBRI, we used a miR-140-5p-specific probe to pull down its associated genes in G401 cells. RT-PCR results showed that IGF1R and TGFBRI were greatly enriched in the miR-140-5p precipitation complex (Fig. 3c). Thus, IGF1R and TGFBRI were identified as direct target genes of miR-140-5p. We also found that IGF1R and TGFBRI expression in nephroblastoma tissue were higher than that of adjacent normal tissues (Fig. 4a).

Based on the finding that miRNA-140-5p could suppress cell proliferative and metastatic activities, we further evaluated the function of the target genes IGF-1R and TGFBR1 in G401 and WT-CLS1 cells by specific siRNA-silencing. IGF-1R-siRNA and TGFBR1-siRNA could decrease cell proliferation and metastasis (data not shown). The expression levels of SMAD2/3 and p-AKT were further evaluated in siRNA-transfected cells. SMAD2/3 is a downstream mediator of TGFBR1 and the activation of AKT is considered the main downstream signal of IGF-1R, both SMAD2/3 and p-AKT participate in the process of cancer progression by promoting cell growth, anti-apoptotic effects, and cell invasion [22, 23]. To verify importance of both proteins in Wilms’ tumor, we detected expression of SMAD2/3 and p-AKT and found that both were highly expressed in the tumor tissues compared with adjacent normal tissue (Fig. 4a). We also found that SMAD2/3 and p-AKT were downregulated in TGFBR1- knockdown cells and IGF-1R-knockdown cells, respectively (Fig. 4b and c). Furthermore, SMAD2/3 and p-AKT levels were both downregulated in miR-140-5p-overexpressing G401 and WT-CLS1 cells (Fig. 4d and e).

Having shown that TGFBR1 and IGF-1R are direct targets of miR-140-5p and that they participate in cell proliferation, we further tested whether ectopic expression of TGFBR1 and IGF-1R could rescue the effect caused by miR-140-5p. Ectopic expression of TGFBR1 or IGF-1R in miR-140-5p-transduced G401 cells could abrogate inhibition of SMAD2/3 or p-AKT by miR-140-5p (Fig. 5 a, b), and partially attenuate the inhibitory effects of miR-140-5p on cell proliferation (Fig. 5 d). In contrast to these observations, overexpression of both TGFBR1 and IGF-1R could rescue SMAD2/3 and p-AKT expression and cell proliferation completely (Fig. 5 c and d). In summary, we propose that miR-140-5p can regulate oncogenic receptor-related cell invasiveness and proliferation in Wilms’ tumor.