Background
Bacterial meningitis remains an important cause of mortality and morbidity worldwide despite advances in antimicrobial chemotherapy and supportive care. The mortality and morbidity vary depending on the geographic location and patient age, and those living in low-income countries and newborns have a higher risk of mortality and morbidity [
1‐
3].
Escherichia coli is the most common Gram-negative bacillary organism that causes meningitis, in particular during the neonatal period [
4].
E. coli entry into the central nervous system (CNS) elicits the release of many factors from host cells including microglia, astrocytes, and infiltrating inflammatory cells, which exacerbates host cellular responses, leading to neuronal injury. Among all host cells, astrocytes are now emerging as those that can recruit, instruct, and retain leukocytes at sites of CNS insults [
5]. Astrocytes can produce a variety of pro-inflammatory molecules such as cytokines, chemokines, growth factors, and small molecules. Our previous study showed that
E. coli can colonize the brain and cause neuroinflammation [
6]. A proper inflammatory response is beneficial to the host, whereas an excessive inflammatory response might result in damage. Therefore, the duration and intensity of the inflammatory response are vital to the host and should be maintained at an appropriate level.
MicroRNAs (miRNAs) play a vital role in posttranscriptional gene regulation by targeting 3’-untranslated regions (UTRs), which leads to translational tuning, repression, or degradation [
7]. An increasing number of investigations has proved that miRNAs are important regulators of neuroinflammation. miR-155 and miR-146a are the most widely characterized miRNAs that modulate different stages of the innate immune response during inflammation and infection. Since each miRNA has multiple targets, a single miRNA could modulate a large number of proteins and thus can exert diverse effects in different situations. It has been widely reported that miR-155 contributes to pro-inflammatory signaling cascades by inhibiting SHIP-1 [
8] and SOCS1 [
9]; however, miR-155 also functions to deactivate the pro-inflammatory response by targeting IRF8 [
10] and TAB2 [
11]. miR-146a was initially reported to be upregulated in macrophages in response to the Toll-like receptor (TLR)-mediated NF-κB signaling pathway [
12]. miR-146a is an important negative regulator of innate immune activation that functions by regulating TRAF6 and IRAK1 [
12,
13]. However, given the redundant and highly cell-specific effects mediated by microRNA species, the precise functional implications of miR-155 and miR-146a expression during meningitic
E. coli infection remain obscure.
In the current study, we demonstrated that the meningitic infection of astrocytes by E. coli could significantly upregulate miR-155 and miR-146a through NF-κB signaling, which in turn negatively regulated bacteria-triggered pro-inflammatory cytokine and chemokine production via TLR-mediated NF-κB signaling and the EGFR–NF-κB pathway. In vivo treatment of E. coli-infected mice with antagomir-155 or antagomir-146a augmented overall neuroinflammation and decreased survival time. These findings reveal that miR-155 and miR-146a are important inflammatory regulators of NF-κB activation during meningitic E. coli infections that function by inducing negative feedback with respect to TLR-mediated and EGFR-mediated immunity.
Materials and methods
Bacterial strain
The meningitic
E. coli strain PCN033, which is a highly virulent cerebrospinal fluid isolate isolated in China in 2006 [
14], was cultured aerobically in Luria-Bertani (LB) broth or on LB plates at 37 °C. This strain was shown to be able to cause host blood–brain barrier (BBB) disruption and severe neuroinflammation in vitro and in vivo [
6].
Cell culture and infection
The human astrocyte cell line U251 (a kind gift from Prof. Shengbo Cao in Huazhong Agricultural University, Wuhan, China) and HEK-293T cells (ATCC® CRL-3216™) were cultured in Dulbecco’s modified Eagle’s medium containing 10% heat-inactivated fetal bovine serum in a 37 °C incubator with a 5% CO2 atmosphere. U251 cells were cultured in 10-cm dishes until monolayer confluence. Confluent cells were washed three times with phosphate-buffered saline (PBS) and starved in serum-free medium for 16–18 h prior to infection. PCN033 overnight cultures were resuspended in serum-free medium and added to the starved U251 monolayer cells at a multiplicity of infection (MOI) of 10.
Reagents
The anti-TAB2 antibody was purchased from Proteintech (Chicago, IL, USA). Anti-IRAK1 and anti-TRAF6 antibodies were from Sigma-Aldrich (St. Louis, MO, USA). Anti-β-actin antibody was from HuaAn Biotechnology Co., Ltd. (Hangzhou, China). Anti-NF-κB p65, anti-phospho-p65, HRP-conjugated anti-rabbit IgG, and anti-mouse IgG were obtained from Cell Signaling Technology (Danvers, MA, USA). The transfection reagent jetPRIME was purchased from Polyplus Transfection (Illkirch, France). has-miR-155 and has-miR-146a mimics (double-stranded RNA oligonucleotides), inhibitors (single-stranded chemically modified oligonucleotides), and control oligonucleotides were commercially synthesized by GenePharma (Suzhou, China). Cholesterol-conjugated and chemically modified mmu–miR-155 inhibitors (antagomir-155) and mmu–miR-146a inhibitors (antagomir-146a) were synthesized by GenePharma. The super electrochemiluminescence (ECL) kit was obtained from US Everbright Inc (Suzhou, China).
Plasmid construction
The 3’ UTR sequences of target genes were amplified from U251 cDNA and cloned into the psiCheck-2 dual-luciferase reporter vector (Promega Madison, WI, USA). The promoter sequences of miR-155 and miR-146a were cloned into pGL3-basic (Promega Madison). The site-specific mutation plasmids were constructed by overlapping extension PCR. To construct the transcription factor expression vector, the coding regions of p65 were amplified from U251 cDNA and cloned into pCDNA3.1. All constructs were verified by sequencing.
RNA interference
Small interfering RNAs (siRNAs) siRNA-TAB2, siRNA-IRAK1, siRNA-TRAF6, and the control siRNA were purchased from Gene Pharma. Transfection was performed with jetPRIME according to the manufacturer’s instructions. Cells were transfected with 50 nM of each siRNA.
Transfection
U251 cells and HEK-293T cells were plated in six-well plates and grown to 70% confluence. Cells were subsequently transfected with plasmids and/or RNAs using jetPRIME according to the manufacturer’s instructions, followed by 24–48 h of incubation at 37 °C with 5% CO2.
3’ UTR luciferase reporter assays
HEK-293T cells were co-transfected with 200 ng psiCheck-2 target genes 3’ UTR luciferase reporter plasmid or psiCheck-2 mutant target genes 3’ UTR luciferase reporter plasmid, along with miRNA mimics or control (final concentration, 50 nM). After 24 h, cells were collected and assayed for both firefly and Renilla luciferase activities using the Dual-Luciferase Reporter System following the manufacturer’s instructions (Promega, Madison, WI, USA). The results were calculated as the ratio of Renilla luciferase activity to firefly luciferase activity and recorded as the mean + SD from three replicate wells.
HEK-293T cells were co-transfected with 200 ng of full-length or mutant promoter firefly luciferase reporter constructs and 10 ng of Renilla luciferase vector (pRL-TK), along with the transcription factor expression vector or control. Luciferase activities were determined with the Dual-Luciferase Reporter Assay System according to the manufacturer’s protocol. The results were expressed as relative luciferase activity by normalizing firefly luciferase activity against Renilla luciferase activity and recorded as the mean + SD from three replicate wells.
Animal infection and antagomir administration
The 28-day-old SPF KM mice were obtained from the experimental animal center at China Three Gorges University (Hubei Province, China). Mice were randomly assigned to four groups as follows: control (PBS); antagomir control-treated and E. coli-infected group (antagomir-ctrl + PCN033); antagomir-155-treated and E. coli-infected (antagomir-155 + PCN033); and antagomir-146a-treated and E. coli-infected (antagomir-146a + PCN033). For the antagomir, 60 mg/kg body weight of the antagomir was injected through the tail vein. After 24 h, mice were intravenously challenged with 1 × 107 CFUs of E. coli strain PCN033 or an equal volume of PBS. At 6 h post-infection, mice were sacrificed and blood was collected for quantitative circulating bacterial cultures. Subsequently, mice were perfused, and brain samples were collected and processed for further assays. For the in vivo colonization assay, brains were weighed, homogenized, and plated to determine the bacterial counts.
RNA extraction and quantitative real-time PCR (qPCR)
Total RNA was extracted using TRIzol® Reagent according to the manufacturer’s protocol. Following RNA extraction, 1 μg of RNA was reverse transcribed into cDNA using the HiScript II Q RT SuperMix (Vazyme, Nanjing, China). Real-time PCR was performed with the MonAmp™ SYBR Green qPCR Mix (RN04005M, Monad Biotech Co., Ltd, Wuhan, China) in accordance with the manufacturer’s instructions. The PCR conditions included an initial step at 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of amplification and quantification (95 °C for 15 s, 60 °C for 1 min). The expression of all mRNA targets was normalized to
GAPDH or
β-actin levels, and the miRNA expression was normalized to
U6. Primers used for qPCR in this study are listed in Table
1. The relative expression level was calculated by the 2
−ΔΔCT method, and the results are presented as the mean + SD. Each assay was performed independently three times in triplicate.
Table 1
Primers used for qPCR in this study
IRAK1 | GCACCCACAACTTCTCGGAG | CACCGTGTTCCTCATCACCG | Human |
TRAF6 | TTGCCATGAAAAGATGCAGAGG | AGCCTGGGCCAACATTCTC | Human |
TAB2 | GCAGCAAAGGAACATCTAGCC | TGGACTGTTAAGTACAGGTGGA | Human |
EGFR | TGCCACCTGTGCCATCCA | ACCACCAGCAGCAAGAGGAG | Human |
GAPDH | TGCCTCCTGCACCACCAACT | CGCCTGCTTCACCACCTTC | Human |
MIR155HG | GCGAGCAGAGAATCTACCT | TCTAAGCCTCACAACAACCT | Human |
pri-mir146a | CTCCTCTGTCACCAAGTAA | CCTCTAACCTTCTGCCTAA | Human |
IL1β | ATGATGGCTTATTACAGTGGCAA | GTCGGAGATTCGTAGCTGGA | Human |
IL6 | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG | Human |
TNF-α | CGAGTGACAAGCCTGTAG | GGACCTGGGAGTAGATGA | Human |
MCP-1 | CAGCCAGATGCAATCAATGCC | TGGAATCCTGAACCCACTTCT | Human |
CXCL2 | AGTGTGAAGGTGAAGTCC | CTTTCTGCCCATTCTTGAG | Human |
IL1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT | Murine |
IL6 | TTCCATCCAGTTGCCTTCT | AAGCCTCCGACTTGTGAA | Murine |
TNF-α | CCCTCACACTCAGATCATCTTCT | GCTACGACGTGGGCTACAG | Murine |
MCP-1 | TGTGAAGTTGACCCGTAA | TCCTACAGAAGTGCTTGAG | Murine |
CXCL2 | TGACTTCAAGAACATCCAGAG | CCTTGCCTTTGTTCAGTATCT | Murine |
β-actin | GTCCCTCCTCTGATACCTTCCTC | CTGGCAGTGTCATTCACATCTTTCT | Murine |
Western blotting
Challenged U251 cells were lysed in RIPA buffer with a protease inhibitor cocktail (Sigma-Aldrich, USA), sonicated, and centrifuged at 12,000 rpm for 10 min at 4 °C. The protein concentration in the supernatant was measured using a BCA protein assay kit (Beyotime, China). Sodium dodecyl sulphate-polyacrylamide gel electrophoresis was performed, followed by protein transfer to polyvinylidene fluoride membranes using a Mini Trans-Blot Cell (Bio-Rad). Blots were probed with relevant antibodies, and the detection of proteins was conducted using ECL reagent. The densitometric analysis was performed using ImageJ software.
Electrochemiluminescence (ECL) assays
Brain tissue samples from challenged mice were lysed in RIPA buffer (supplemented with protease inhibitor) and centrifuged at 12,000 rpm for 10 min to eliminate tissue debris. The supernatant was stored at – 80 °C and later used for the measurement of preselected cytokines and chemokines, including IL-1β, IL-6, TNF-α, MCP-1, and MIP-2 using the ECL V-Plex Proinflammatory Panel (mouse) kit (Meso Scale Discovery, Meso Scale Diagnostics, Rockville, MD, USA), following the manufacturer’s instructions.
Immunofluorescence microscopy
U251 cells were transfected with miR-155, miR-146a, or miR-ctrl, and 24 h after transfection, cells were challenged with PCN033 at an MOI of 10 for 3 h, and cells were washed and fixed with 4% paraformaldehyde. The fixed cells were subsequently incubated with primary anti-p65 antibody and then with CY3-labeled goat anti-mouse IgG antibody. The plate was mounted and visualized using fluorescence microscopy.
Brain samples were collected, fixed in 4% formaldehyde solution for over 24 h, and embedded in paraffin. Sections were incubated overnight at 4 °C with primary antibodies against GFAP (glial fibrillary acidic protein) or IBA1 (ionized calcium-binding adaptor molecule 1). After washing, sections were incubated with appropriate secondary antibodies. Immunostainings were examined with a fluorescence microscopy. GFAP and IBA1 image analyses were performed using the ImageJ software (NIH, Bethesda, MD, USA).
Histopathological examination
The brain samples were collected, fixed in 4% formaldehyde solution, and embedded in paraffin. Individual 6-μm sections were mounted on adhesive glass slides, dewaxed in xylene, and rehydrated in descending graded ethanol concentration for hematoxylin and eosin (H&E) staining according to the previous protocol [
6].
Statistical analysis
Data were expressed as the mean + SD unless otherwise specified. Statistical significance of the differences between each group was analyzed by Student’s t test or one-way analysis of variance (ANOVA) embedded in GraphPad Prism, version 7.0 (GraphPad Software Inc., La Jolla, CA, USA); p < 0.05 was considered statistically significant, p < 0.01 and p < 0.001 indicated extremely significant differences.
Discussion
Astrocytes are the most abundant glial cells within the brain and are essential for brain homeostasis and neuronal functions [
22,
23]. Astrocytes play vital roles in regulating innate and adaptive immune responses in the injured CNS. Our previous study showed that the meningitis-associated
E. coli strain PCN033 could infect astrocytes U251, induce rapid inflammatory responses, and promote the expression of many pro-inflammatory mediators such as IL-1β, IL-6, IL-8, TNF-α, MCP-1, and MIP-2. We hypothesized that astrocytes would trigger inflammatory responses to recruit circulating immune cells to the sites of insults, thereby mediating immune elimination of the pathogen. However, exaggerated or persistent long-term inflammatory responses lead to pathological neuroinflammation, and thus it is essential to tightly regulate the inflammatory response to avoid further damage of the CNS.
Increasing research has revealed that miRNAs are essential regulators of various biological processes, including inflammation [
24,
25]. Our previous comprehensive miRNA sequencing data showed that a group of miRNAs is differentially expressed upon PCN033 infection. Among these miRNAs, miR-155 and miR-146a exhibited the highest expression and were found to be the most significantly upregulated. Given that the regulatory role of miR-155 and miR-146a in the context of meningitic
E. coli infection remained unknown, we selected these two molecules as targets for further experimentation. In this study, we demonstrated that miR-155 and miR-146a were highly upregulated by
E. coli through NF-κB signaling and that miR-155 and miR-146a negatively regulated bacteria-induced pro-inflammatory responses. Importantly, we found that miR-155 combined with miR-146a to exert anti-inflammatory effects by targeting different key proteins in TLR signaling pathways and collectively regulate EGFR–NF-κB signaling.
TLRs play important roles in recognizing pathogens and initiating inflammatory responses during infection [
26]. However, it is crucial to tightly modulate the TLR signaling pathways to avoid excessive inflammation. During this process, miRNAs can modulate the TLR signaling pathways by inhibiting key intracellular signaling proteins. A previous study and our work showed that miR-146a can inhibit IRAK1 and TRAF6. In addition, IRAK2, a kinase that is necessary for the persistence of NF-κB activation, has also been shown to be regulated by miR-146a [
17]. In addition to miR-146a, miR-155 can target vital signaling proteins in TLR signaling pathways. MyD88 has been identified as a target of miR-155 in a model of
Helicobacter pylori infection [
27]. We also proved that TAB2 was an important target of miR-155. Moreover, Schulte et al. has verified that IKKƐ and NIK were targeted by miR-155 [
28]. Consequently, miR-155 and miR-146a can work together to target different components of several TLR signaling pathways to avoid excessive pro-inflammatory responses. Besides, many miRNAs can also target signaling molecules in TLR pathways. For example, miR-302b suppressed bacteria-induced inflammatory responses by regulating IRAK4 [
29]. The activity of NF-κB was tightly regulated by inhibitor of NF-κB kinases (IKKs), whereas IKKα was targeted by miR-223, and IKKβ was regulated by miR-199 [
30,
31]. Further, many other miRNAs participated in the regulation of TLR signaling pathways through different mechanisms. Some miRNAs can directly modulate the expression of receptor expression. For example, let-7 miRNA family members let-7e and let-7i can regulate the expression of TLR4 [
32,
33], and TLR3 and TLR4 expressions were regulated by miR-223 in granulocytes [
34]. Some miRNAs can also target transcription factors to affect TLR-induced gene expression. For example, miR-155 targeted CEBPB to decrease G-CSF and IL-6 expression in splenocytes. Altogether, miRNAs could play crucial roles in controlling inflammation by inhibiting key proteins in the TLR signaling pathways.
EGFR is a member of the ErbB family, which is composed of four tyrosine kinase receptors, EGFR (ErbB1) and ErbB2–4 [
35]. These four receptors are essential for modulating many biological processes, including cell survival, proliferation, and differentiation in many tissue types [
36]. Despite the fact that EGFR has been mainly studied in the field of cancer, increasing studies have discovered diverse roles in pathogenic bacterial infections, such as regulating bacterial invasion, inflammation, and apoptosis [
37‐
39]. Our recent research showed that the bacteria-induced transactivation of EGFR activated downstream signaling pathways NF-κB and MAPK-ERK1/2 in hBMECs, which subsequently initiated and mediated the inflammatory response. In this study, we blocked the function of EGFR by introducing the EGFR inhibitor AG1478 in astrocytes, resulting in the reduced expression of pro-inflammatory factors. This result suggests that EGFR also functions as an initiator of inflammatory responses in astrocytes. We further confirmed that NF-κB signaling pathways were influenced by EGFR activity. Importantly, we proved that EGFR was a common target of miR-155 and miR-146a, and thus, both can serve as anti-inflammatory miRNAs by targeting EGFR, subsequently inhibiting downstream NF-κB signaling pathways and eventually suppressing inflammatory cytokines and chemokines. EGFR has been reported as a target of miR-146a in cancer, and miR-146a can block pancreatic cancer cell invasion and metastasis by inhibiting EGFR and IRAK1 [
40]. To our knowledge, this is the first study to show that miR-146a and EGFR are implicated in bacterial infection and the related immune response and that EGFR is also a target of miR-155.
Our in vivo data showed that inhibiting miR-155 and miR-146a in mice promoted the production of inflammatory cytokines, aggravated astrocyte and microglia activation, and decreased mouse survival time. However, the bacterial loads in the blood and brain remained unchanged. We propose that miR-155 and miR-146a can modulate the inflammatory responses of mice to respond to E. coli infection, rather than exerting direct antibacterial activity. In this study, almost all E. coli-challenged mice showed neurologic symptoms including trembling, circling, paddling, and opisthotonos. Besides, we observed the meningeal thickening and neutrophil infiltration in the meninges in response to the infection. Moreover, the production of pro-inflammatory cytokines and chemokines and the activation of astrocytes and microglia further supported the occurance of meningitis after hematogenous E. coli infection. Considering the important immunomodulation effects of miR-155 and miR-146a on E. coli-induced meningitis, miR-155 and miR-146a may be attractive candidates of new therapeutic interventions in the treatment of bacterial meningitis.
We found that miR-155 and miR-146a are simultaneously upregulated in astrocytes during the later period of
E. coli infection. Therefore, a one-tier model was established in that NF-κB-regulated miR-155 and miR-146a collectively act via feedback to modulate TLR signaling and EGFR-NF-κB signaling. In contrast to our results, Schulte [
28] identified a two-tier mechanism in LPS-stimulated macrophages; specifically, miR-146 was found to be activated at sub-inflammatory levels, whereas miR-155 was gradually induced to full expression at pro-inflammatory levels. Therefore, miR-155 acts as a final limit to the inflammatory response once the miR-146-dependent barrier to LPS-induced inflammation has been breached. Interestingly, a recent study showed that miR-155 and miR-146a can form a combined positive and negative regulatory loop regulating NF-κB activity [
41]. Inflammatory stimuli lead to the activation of NF-κB, which rapidly activates miR-155. miR-155 acts as a positive regulator of NF-κB activity by inhibiting SHIP1 and SOCS1. As the inflammatory response develops, miR-146a levels accumulate to negatively regulate NF-κB activity, resulting in the attenuation of inflammatory gene and miR-155 expression. In addition, another study on rheumatoid arthritis (RA) showed that miR-155 and miR-146a were downregulated in Tregs from RA patients, and the decrease in miR-146a-induced pro-inflammatory effects prevailed over the counteracting effect of reduced miR-155 expression, resulting in a pro-inflammatory phenotype for Tregs in RA [
42]. It seems that miR-155 and miR-146a play different roles in controlling inflammatory responses in different disease models, depending on the diversity of cell types and experimental conditions. This also sheds light on the importance of understanding the interactions between them and the contribution of miR-155 and miR-146a to specific inflammatory disorders.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.