Background
Gastric cancer is among the most common malignancies in East Asian counties [
1,
2]. Recurrence and metastasis are the biggest obstacles for the treatment of gastric cancer [
3]. Therefore, the search for new therapeutic targets to prevent the metastasis of gastric cancer is an urgent issue. However, the pathogenesis and mechanism underlying the metastasis process remain poorly understood. Epithelial-mesenchymal transition (EMT) is a key step toward cancer metastasis. Loss of E-cadherin expression is a hallmark of the EMT process and is likely required for enhanced tumor cell motility [
4,
5]. Epithelial cells lose epithelial characteristics and acquire mesenchymal characteristics by the down-regulation of E-cadherin [
6].
Increasing evidence suggests that post-transcriptional regulation of gene expression, which is mediated by microRNAs (miRNAs), controls tumorigenesis and cancer metastasis [
7‐
9]. Both the over-expression of oncogenic miRNAs and the decreased expression of tumor suppressor miRNAs play pivotal roles in cancer metastasis. Adam et al. demonstrated that miR-200 regulated EMT in bladder cancer cells and reversed resistance to epidermal growth factor receptor (EGFR) therapy [
7]. This group also showed that the stable expression of miR-200 in mesenchymal UMUC3 cells increased E-cadherin levels; decreased protein expression of ZEB1, ZEB2, and ERRFI-1; decreased cell migration; and increased sensitivity to EGFR-blocking agents. Tie et al. described the regulation and function of miR-218 in gastric cancer metastasis. Decreased miR-218 levels eliminated Robo1 repression, which activated the Slit-Robo1 pathway through the interaction between Robo1 and Slit2 to trigger tumor metastasis [
10].
In the current study, we investigated the role of miR-204 in gastric cancer metastasis. We demonstrated that the miR-204 expression was down-regulated in gastric cancer tissues and confirmed that the SIRT1 gene is the direct target of miR-204. Restoration of miR-204 or the knockdown of SIRT1 in metastatic gastric cancer cells induces a shift toward an epithelial morphology concomitant with increased expression of E-cadherin and decreased expression of Vimentin. Down-regulation of miR-204 inactivated LKB1 through SIRT1 to promote human gastric cancer cell invasion.
Methods
Cell lines and clinical samples
The AGS and BGC gastric cancer cell lines used in this study were cultured at 37°C in 5% CO2 and 95% air. All cells were grown in Dulbecco’s modified Eagle’s medium (Invitrogen, California, USA) supplemented with 1 mmol/L L-glutamine, 10% fetal bovine serum (Life Technologies, Inc., Burlington, Canada), penicillin G 100 U/mL, and streptomycin 100 mg/mL.
The Ethics Review Board of Zhongda Hospital, Southeast University Nanjing, China, approved this study. Informed consent was obtained from all patients. We studied gastric cancer specimens (cancer lesions and adjacent non-tumor mucosa) from 24 patients who had undergone resection at the Zhongda Hospital, Southeast University between 2005 and 2010. We gathered all samples in the same manner; they were snap-frozen immediately in liquid nitrogen and stored at −80°C until RNA extraction could be performed. All tissue specimens were evaluated pathologically. No patients had received irradiation or cancer chemotherapy prior to resection.
RT-PCR and real-time RT-PCR
Total cellular RNA was extracted using Trizol (Invitrogen, California, USA). For mRNA detection, SIRT1, E-Cadherin, Vimentin and GAPDH mRNA expression were analyzed by the Sybr Green qRT-PCR according to the manufacturer’s instructions (Applied Biosystems).
For miRNA detection, polyA tail was added to RNase-free DNase digested total RNA using the E.coli polyA polymerase (NEB). Two micrograms of the tailed total RNA was reverse transcribed with ImProm-II (Promega). Conventional PCR or Sybr Green qRT-PCR was used to assay miRNA expression with the specific forward primers and the universal reverse primer complementary to the anchor primer. Anchor RT primer was used as the template for negative control and U6 as internal control.
The primers used are listed in Table
1.
Table 1
Sequence of RT-Primers
miR-138 F | agctggtgttgtgaatcaggccg |
miR-155 F | ttaatgctaatcgtgataggggt |
miR-181a F | aacattcaacgctgtcggtg |
miR-181b F | aacattcattgctgtcggtgggt |
miR-181c F | aacattcaacctgtcggtgagt |
miR-181d F | aacattcattgttgtcggtgg |
miR-30a F | gctgtaaacatcctcgactgga |
miR-30b F | gccttgtaaacatcctacactcag |
mIR-30c F | gtaaacatcctacactctcagc |
miR-30d F | ctgtaaacatccccgactgg |
miR-30e F | ccggtgtaaacatccttgactg |
miR-204 F | ttccctttgtcatcctatgcct |
miR-211 F | ttccctttgtcatccttcgcct |
miR-9 F | tctttggttatctagctgtatga |
miR-135a F | tatggctttttattcctatgtga |
miR-135b F | tatggcttttcattcctatgtga |
miR-133a F | tttggtccccttcaaccagctg |
miR-133b F | tttggtccccttcaaccagcta |
miR-22 F | cgtaagctgccagttgaagaa |
miR-199a F | cccagtgttcagactacctgtt |
miR-199b F | gtcccagtgtttagactatctgttc |
miR-128 F | tcacagtgaaccggtctcttt |
miR-217 F | tactgcatcaggaactgattgga |
miR-200a F | ccctaacactgtctggtaacgat |
miR-141 F | ggtaacactgtctggtaaagatgg |
miR-34a F | tggcagtgtcttagctggttgt |
Anchor RT primer | cgactcgatccagtctcagggtccgaggtattcgatcgagtcgcacttttttttttttv |
Universal rev primer | ccagtctcagggtccgaggtattc |
U6F | ctcgcttcggcagcaca |
U6T | aacgcttcacgaatttgcgt |
SIRT1 F | gccagagtccaagtttagaaga |
SIRT1 T | ccatcagtcccaaatccag |
E-Cadherin F | acagccccgccttatgatt |
E-Cadherin T | tcggaaccgcttccttca |
Vimentin F | tacaggaagctgctggaagg |
Vimentin T | accagagggagtgaatccag |
GAPDH F | gcaagttcaacggcacag |
GAPDH T | cgccagtagactccacgac |
Luciferase reporter assay
Using Lipofectamine 2000 (Invitrogen), HEK293 cells (104 cells/well) were plated in a 24-well plate. The cells were then co-transfected with 20 mM of either miR-204 or microRNA control, 40 ng of either pGL3-promoter-SIRT1-3’UTR-WT or pGL3-promoter-SIRT1-3’UTR-MUT, and 4 ng of pRL-TK (Promega, Madison, WI). HEK293 cells were collected 24 hours after transfection and analyzed using the Dual-Luciferase Reporter Assay System (Promega). The pRL-TK vector responsible for the constitutive expression of Renilla luciferase (Promega) was co-transfected as an internal control to correct for differences in both transfection and harvest efficiencies. Transfections were performed in triplicate and repeated at least three times in separate experiments.
Western blot analysis and antibodies
Western blot analysis to assess SIRT1, Vimentin, E-Cadherin, LKB1, and β-actin expression was performed as previously described [
11]. All of these primary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, Daly City, CA).
In vitro cell invasion assay
For transwell invasion assays, 1×105 cells were placed on the non-coated membrane in the top chamber (CytoSelectTM 24 Well Cell Migration and Invasion Assay Combo Kit, 8-μm, CBA100-C, Cell Biolab, United States). Cells were plated in medium without serum. Medium supplemented with serum was used as a chemo-attractant in the lower chamber. The cells were incubated for 24 hours; cells that did not invade through the pores were removed using a cotton swab. Cells on the lower surface of the membrane were fixed with methanol and stained with crystal violet (Fisher Scientific Co., Fairlawn, NJ). The cell numbers were determined by counting the penetrating cells under a microscope at 200 magnification in random fields in each well. Each experiment was performed in triplicate.
Anoikis assay
Poly-hydroxyethyl methacrylate (poly-HEMA, Sigma- Aldrich) was reconstituted in 95% ethanol to a concentration of 12 mg/mL. To prepare poly-HEMA coated plates, 0.5 mL of 12 mg/mL solution was added to each well of a 24-well plate and allowed to dry overnight in a laminar flow tissue culture hood. Cells were transfected as before. Twenty-four hours after transfection, 50,000 cells were plated in triplicate in poly-HEMA coated 24-well plates using regular culture medium. Following the addition to poly-HEMA coated plates, cells were collected at 2, 4, 8, 24 and 48 hrs post plating. Cell apoptosis was assayed by Annexin FITC/PI staining following manufacturer instructions (Invitrogen, California, USA). Briefly, cells were collected and washed in cold PBS. Cells were incubated for 15 min at room temperature in the presence of 1 μl Annexin V-FITC, 1 μl of propidium iodide and 98 μl of 1x binding buffer (all reagents provided by the manufacturer). After incubation, 400 μl of 1X binding buffer was added to each tube, and cells were analyzed by flow cytometry.
Databases and statistics
We used the paired Wilcoxon nonparametric test to analyze pairs of non-tumor mucosa and cancer samples. The statistical significance of intergroup differences was determined using the χ2 test. All statistical analyses were performed using SPSS 16.0 software (SPSS, Chicago, IL). Differences were considered significant if P < 0.05. All experiments were performed in triplicate and repeated at least three times.
Discussion
Class III histone deacetylase SIRT1 blocks senescence and apoptosis and promotes cell growth and angiogenesis, making it a critical regulator of tumor initiation, prognosis and drug resistance. Our previous studies have suggested that the up-regulation of SIRT1 is related to lymph node metastasis in gastric cancer [
12]. The underlying mechanism by which this occurs is still unclear. There are 34 miRNAs are predicted to target the 3’UTR of SIRT1, which is 1.7 kb. We evaluated and analyzed the expression of these miRNAs that are conserved across various species in normal gastric mucosa tissue, gastric cancer specimens, and 2 gastric cancer cell lines. The results showed that reduced expression of miR-204 frequently occurred in gastric cancer tissues and was related with the up-regulation of SIRT1. We also verified this result in 24 gastric cancer tissues and found that the decreased expression of miR-204 was related with cancer metastasis.
miRNAs are involved in several important biological events such as tumorigenesis and cancer metastasis. miRNAs are known to act as regulators in gastric cancer cell growth and to regulate gastric cancer metastasis. Deregulation of some miRNAs, including miR-101, miR-107, miR-221, and miR-222, has been observed in gastric cancer [
13‐
15]. miR-101 was down-regulated in gastric cancer tissues. The ectopic expression of miR-101 significantly inhibited cellular proliferation, migration, and invasion of gastric cancer cells by targeting EZH2, Cox-2, Mcl-1, and Fos. miR-107 is frequently up-regulated in gastric cancers, and its overexpression is significantly associated with gastric cancer metastasis. Here, we demonstrated miR-204, another miRNA specific to gastric cancer metastasis, and its specific target, SIRT1.
Epithelial–mesenchymal transition (EMT) consists of a rapid and often reversible change of cell phenotype [
16]. Epithelial cells loosen cell–cell adhesion structures, including adherens junctions and desmosomes, to modulate their polarity and rearrange their cytoskeleton. Specifically, intermediate filaments typically switch from cytokeratins to Vimentin [
17,
18]. Cells become isolated, motile and resistant to apoptosis. Many genes and pathways have been implicated in inducing EMT in tumor cells. Typically, these pathways are also active in other processes, including cell proliferation, apoptosis and differentiation during early developmental stages, tissue morphogenesis and wound healing. Their specific role during human tumor progression is usually not well understood [
19]. Our previous analysis of the clinical characteristics indicated that SIRT1 expression was significantly associated with tumor stage and the presence of metastasis, which further indicated that SIRT1 acts as a tumor promoter and facilitates the infiltration of gastric cancer. The oncogenic epithelial-to-mesenchymal transition (EMT) is thought to play an important role in tumor progression. Our current results suggest that miR-204 down-regulation and SIRT1 restoration can induce EMT in GC cells.
There is a tight correlation between anoikis resistance and oncogenic EMT [
20‐
22]. A common hallmark of EMT is the breakdown of E-cadherin expression or function [
23], which suffices to circumvent anoikis in some contexts. For example, the targeted knockout of the E-cadherin gene in a mouse mammary tumor model or the stable knockdown of E-cadherin in a mammary epithelial cell line confers anoikis resistance [
24]. This finding implies that EMT-promoting transcription factors such as ZEB1/2, Snail1/2 and Twist can block anoikis both by directly regulating apoptosis control genes and by suppressing E-cadherin expression. Here, we discuss the mechanism by which E-cadherin suppression triggers signaling events that control other apoptosis regulatory genes [
25]. This study also investigated whether the miR-204-SIRT1 pathway was involved in anoikis resistance and metastasis promotion in GC cells. We demonstrate that miR-204 down-regulation and SIRT1 overexpression both can induce anoikis resistance in GC cells.
LKB1 was identified originally as the tumor suppressor gene on human chromosome 19p13. LKB1 inactivation triggers EMT in lung cancer cells through the induction of ZEB1 [
26]. Cheng et al. reported that LKB1 was an essential upstream regulator of p53-mediated anoikis [
27]. Recent studies have revealed that many proteins, such as SIRT1, are involved in the regulation of LKB1 [
28]. Over-expression of LKB1 promoted cellular senescence and retarded endothelial proliferation, which could be blocked by increasing SIRT1 levels. Knocking down of SIRT1 induced senescence and elevated the protein levels of LKB1. SIRT1 antagonized LKB1 activation through promoting deacetylation, ubiquitination and proteasome-mediated degradation of LKB1. Our data show that over-expression of miR-204 increased LKB1 expression in GCCs, while down-regulation of SIRT1 can also restore LKB1 expression in GCCs. LKB1 down-regulation could promote cancer cells invasion even when miR-204 was upregulated. As a result, miR-204 may modulate LKB1 by interacting with SIRT1. These data suggest that reduction of miR-204 promotes EMT by inactivating LKB1, and SIRT1 might be the direct target of miR-204 in the LKB1 pathway.
Acknowledgements
The authors wish to thank Hong Fan for clinical, laboratory and logistic support.
Financial support
This work was supported by grants from the natural science foundation of Jiangsu Province (BK2012750), and the Natural Science Foundation of China (81101856).
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
LZ was responsible for planning the study. XW carried out the molecular genetic studies and involved in all steps of the data analysis and manuscript writing. PC provided laboratory support and helped to draft the manuscript. All authors read and approved the final manuscript.