Background
Nasopharyngeal carcinoma (NPC) is a common malignant tumor in the people of southern China, particularly in Guangdong population [
1]. Radiotherapy is a commonly used method to treat NPC and combined with chemotherapy to promote the survival rate of the patients. However, NPC cells can easily invade local tissue even metastasize to remote organs, so such relapse and metastasis result in poor prognosis for the patients [
2]. Therefore it is very important to further elucidate pathogenesis of NPC for discovering new therapeutic approaches.
MicroRNAs (miRNAs) are endogenous non-coding RNAs with approachable 22 nucleotides in length and play an important role in physiological and pathological conditions through cleaving or transcript suppressing target mRNAs [
3]. Accumulating evidence demonstrates that miRNAs are associated with cancer occurrence. And determination of miRNA levels has been proposed as a biomarker for diagnosis and prognosis of various cancers [
4,
5]. Here, we identified miR-223 as down-regulated in undifferentiated nasopharyngeal carcinoma cell line CNE-2, compared with immortalized nasopharyngeal epithelial cell line NP69. MiR-223 was firstly reported to be involved in the regulation of human granulopoiesis [
6,
7]. Then it was found to be a potential biomarker for recurrent ovarian cancer [
8]. In Hela cells, overexpression of MiR-223 suppresses cell proliferation by targeting IGF-1R [
9]. It seems contradictory that miR-223 can suppress tumor invasion and metastasis through targeting Artemin [
10], but may promote tumor by inhibiting the expression of EPB41L3, a tumor suppressor in human NPC [
10]. These findings suggest that miR-223 is associated with migration and invasion of malignant tumor. However, to our knowledge, the role of miR-223 in nasopharyngeal carcinogenesis remains undefined.
The present study was performed to find the potential miRNAs in NPC, and verify the role of target miRNA in invasion and metastasis of the cells. Our results illuminate the role of miR-223 in NPC development and provide valuable information for clinical implications.
Materials and methods
Cell culture
Highly and poorly differentiated human NPC cell lines named as CNE-1 and 2 were established and kindly provided by Prof. Yi Zeng from the Institute of Virology, China Institute of Preventive Medical Science, China [
11]. The immortalized human nasopharyngeal epithelial cell line named as NP69 was kindly provided by Prof. Kaitai Yao from Southern Medical University, Guangzhou, China. CNE-1 and CNE-2 cells were cultured in the DMEM medium containing 10 % fetal bovine serum (FBS), and NP69 cells were cultured in Keratinocyte-SFM (serum-free medium). Both mediums were contained 100 units/ml penicillin G and 100 μg/ml streptomycin (Invitrogen). The transfection was conducted with Lipofectamine™2000 reagent (Invitrogen).
Microarray analysis
For microarray assay of miRNAs, double-stranded cDNAs were synthesized with the 2 μg total RNA, and biotin-tagged cRNAs were obtained by the use of the MessageAmp™ II aRNA Amplification Kit (Ambion). The biotin-tagged cRNAs were fragmented into mixed strands in accordance with the Affymetrix’s protocols. The fragmented cRNAs were hybridized with TaqMan® Human MicroRNA Array Set v3.0 containing 754 transcripts. Hybridization was performed at 45 °C with rotation for 16 h (Affymetrix GeneChip Hybridization Oven 640). The GeneChip arrays were washed and then stained (streptavidin-phycoerythrin) on an Affymetrix Fluidics Station 450 followed by scanning on a GeneChip Scanner 3000.
MiRNA transfection and real-time quantitative PCR
MiR-223 mimic (Cat
# miR10004570), miR-223 negative control (Cat
# miR01201), miR-223 (Ca
t# miRQ0004570) and U6 (Cat
# MQP-0201) real-time PCR primers RNA oligonucleotides were obtained from RiboBio (
http://www.ribobio.com Guangzhou, China). miRNAs were transfected to CNE-2 cells by using Lipofectamine®2000, with a final concentration at 50 nM. The expression of miR-223 was measured by real-time quantitative PCR (RT-qPCR) by using One Step SYBR® PrimeScript® RT-PCR Kit II (Takara) and following the manufacturer’s protocol on ABI 7500 HT real-time PCR detection system as normalized to the housekeeping gene U6. The information about primer sequences is depicted in Table
1.
Table 1
Genes and primers for RT-qPCR
U6
| Reverse transcription | CGCTTCACGAATTTGCGTGTCAT |
| Sense | GCTTCGGCAGCACATATACTAAAA |
| Anti sense | GCTTCGGCAGCACATATACTAAAAT |
miR-223
| Reverse transcription | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTGGGGT |
| Sense | GGGTGTCAGTTTGTCAAAT |
| Anti sense | TGCGTGTCGTGGAGTC |
GAPDH
| Sense | GCACCGTCAAGGCTGAGAAC |
| Anti sense | TGGTGAAGACGCCAGTGGA |
MAFB
| Sense | TTGTAACCAGAATCACCCTGAGGTC |
| Anti sense | CCAGGGTCAGGGATGGCTAA |
Cell proliferation analysis
CNE-2 cells with a number of 5 × 103/well were seeded into 96-well plates, incubated for 12 h, and then transfection was performed. At 24 h after transfection, each well was treated with 10 μL MTT solution (10 mg/ml in PBS) and incubated sequentially at 37 °C. After the incubation for 4 h, 100 μL of DMSO was added to dissolve the crystals. Then the absorbance of each well in culture plate was measured at 570 nm and 630 nm after oscillated for 10 min at room temperature.
Two experiments were employed for measuring colony formation ability. For plate colony formation, at 24 h after transfection, 600 cells were plated for 10 days. The colonies were photographed and counted. For soft agar analysis, 1 × 104 cells were plated in triplicates in 6 cm diameter plates with 0.6 % base agar and 0.3 % top agar and incubated 21 days. The colonies were count in 10 randomly chosen microscope fields.
Wound healing assay
The cells (2 × 105) were seeded into a 6-well plate. Then the cells were scratched using a 100 μl tip when the cells formed a confluent monolayer. The closure of scratch was detected under the microscope at 0, 24, 48, 72 h time point respectively after incubation.
Transwell migration and invasion assay
The ability of cells to migrate through filters was measured using Polycarbonate Membrane Transwell Inserts (Corning). At 24 h after transfection, cells were trypsinised. Cell culture inserts with a polycarbonate membrane (8 μm pore size) were used. The bottom chamber contained medium (0.5 ml) supplemented with 10 % FBS, whereas the transfected cells were seeded into the upper chamber and incubated for 36 h. The remaining cells on the upper surface were mechanically removed. Then the membranes were washed and stained using 0.1 % crystal violet. The cell migration ability was measured by the cell numbers that migrated to the lower side of the filter. Experiments were repeated 3 times.
The invasion ability of cells was determined by a Matrigel invasion chamber assay. This assay was conducted by the use of 6.5 mm and 8 μm pore size Transwell chambers (Corning). Cells transfected with miRNA mimic or control one were cultured in serum-free medium for 12 h (1 × 105 cells per Transwell) and then the cells were migrated into a medium containing 10 % FBS for 24 h. Cells that migrated to the underside of the filter were fixed in methanol and stained using 0.1 % crystal violet. Whole filters were manually counted under the inverted microscope.
In vivo antitumor assay
Seven nude athymic mice (male, SPF grade, 6–8 weeks of age) were purchased from Animal Experimental Center of Guangdong Medical College. CNE-2 cells transfected with miR-223 mimic and control microRNA (2 × 106) or MAFB specific siRNA and negative control siRNA in 100 μl no serum medium were injected respectively into particular side of each mouse. Tumor size was measured every three day and tumor volume was calculated as V = ab2/2, where a is length and b is width of tumor. At day 23 after cell injection, the animals were sacrificed and the tumors were frozen quickly for following assays. Tissue sections were fixed in 4 % paraformaldehyde and embedded in paraffin. Three micrometer tissue sections were prepared and stained with hematoxylin-eosin. All of the animal experiments were approved by the Experimental Animal Care and Use Committee in Guangdong Medical College.
Patient plasma collection
Human plasma samples from NPC patients and healthy donors were derived from the Affiliated Hospital of Guangdong Medical College and Dongguan area in China, with the informed consent under institutional review board-approved protocols. Blood was collected in EDTA tubes and processed for isolation of plasma within 2 h of collection. Blood was centrifuged at 2000 rpm at room temperature for 10 min. Then the upper layer plasma was transferred to RNase/DNase-free 1.5 ml conical tubes and stored at −80 °C.
Total RNA was enriched from all plasma samples using the TRIzol LS (Invitrogen). To normalize the different RNA samples, 10 μl of synthetic cel-miR-39 (1.6 × 108 copies/μl) was added to each sample during the RNA isolation. The reverse transcription was conducted using the TaqMan miRNA Reverse Transcription Kit (Life Technologies), according to the manufacturer’s protocol. RT-qPCR was carried out as described above. Data were analyzed under the SDS Relative Quantification Software version 1.4 (Applied BioSystems).
Two widely advocated online bioinformatic softwares, Target Scan [
12] and microRNA.org [
13], were used to predict the interaction probability between miR-223 and
MAFB, including binding sites for miR-223 in MAFB and the targeting efficiency. The predictive outcome was used for further investigation.
A 249-bp-long MAFB 3’UTR fragment was cloned into downstream region of the luciferase gene within the pGL3 vector (Promega), namely the wild-type 3’UTR (WT-UTR). The mutated MAFB 3’UTR containing mutations of the miR-223 binding sit was obtained using GeneTailor Site-Directed Mutagenesis System (Invitrogen), namely mutated 3’UTR (mt-UTR). For dual luciferase reporter assays, WT-UTR or mt-UTR recombinant vector (0.5 μg per well) was cotransfected with the normalizer vector pRL-CMV (0.5 μg per well per well) coding for Renilla luciferase (Promega) using Lipofectamin 2000™ (Invitrogen). The CNE-2 cells were cultured in 24 wells plates with the density of 5 × 105 per well. Dual-Luciferase® Reporter 1000 Assay System (Promega) was used to detect the luciferase activity at 36 h after transfection.
cDNA microarray and confirmation
cDNA microarray analysis was performed on Human Genome U133 Plus 2.0 gene chips by Capital Bio Corporation (Beijing, China). The microarray results were confirmed by RT-qPCR, with housekeeping gene GAPDH as a normalizer.
MAFB specific siRNA transfection
MAFB siRNA and negative control were synthesized by RiboBio (Guangzhou, China). The transfection was performed using Lipofectamin 2000™ (Invitrogen). Then the cells were harvested 24 h after transfection, and the MAFB expression level was measured by RT-qPCR as described above.
Western blotting
The total cell lysates were harvested and the total protein was separated on SDS-PAGE gel by Bio-rad system. The anti-MAFB and anti-GAPDH antibodies were used as the primary antibody (Abcam), with GAPDH as a normalizer. The signal intensity was detected with the enhanced chemiluminescence substrate kit (Thermo).
Statistical analysis
Data were expressed as means ± standard deviation (SD), and the the analysis between groups was performed by Student’s t-test unless otherwise noted. Difference with a P-value less than 0.05 was considered significant.
Discussion
To sum up, we report here that miR-223 plays a critical role in NPC carcinogenesis. The plasma miR-223 level was lower in NPC cells and NPC patients’ plasma, as compared with normal ones. To fully realize its effect, we observed that miR-223 inhibited NPC cell growth, migration and invasion both in vitro and in vivo. MAFB was identified as a miR-223 target gene. And MAFB expression was decreased accompanied with miR-223 overexpression. In addition, the consistent result was observed that the cell growth and migration were inhibited after MAFB specific siRNA transfected into NPC cells. The findings implicated that miR-223 could be a potential target for intervention and diagnosis to NPC.
NPC is a highly prevalent malignant cancer in south China and Southeast countries. It has been known that virus, diet and genetic makeups all are the risk factor for NPC development, but underlying pathogenesis of the disease is still poorly understood [
14]. Oncogenes and tumor suppressing genes might form a very complicated network, and how they interact one another to lead to the cancer is not clear [
15]. Few reports have indicated that miRNAs abnormally express in different cancers, and more researchers have been paying close attentions to molecular mechanisms of miRNAs in tumorigenesis [
16]. In NPC, down-expressed miR-29c could upregulate mRNA expression of extracellular matrix genes [
17], and ZEB2 and CTNNB1 low-expression induced by miR-200a inhibits the growth, migration and invasion of NPC cells [
18]. In addition, miR-216b suppresses the proliferation and invasion via inhibiting KRAS expression [
19]. Mir-218 exerts suppressing function to NPC by down-regulating survivin expression and SLIT2-BOBO1 pathway [
20], and miR-26a acts the similar function for inhibiting cell growth and tumorigenesis through repression of EZH2miR [
21]. Recent study reported that miR-663 targets p21 (WAF1/CIP1) to promote the proliferation and development of NPC [
22]. Those results have shed light on which miRNAs are involved in NPC tumorigenesis, however, the role of miRNAs in pathogenesis has not been elucidated.
Based on miRNA microarray we found that miR-223 was down-regulated in NPC cell line CNE-1 and CNE-2, and further verified the role of miR-223 in NPC pathogenesis. Using microarray-based serum miRNA profiling and RT-qPCR method, Zeng et. al. compared serum miRNAs level between the patients with nasopharyngeal carcinoma and non-cancerous volunteers, and they found that miR-223 was decreased significantly in the serum of NPC patients [
23]. Our results confirmed this by comparison the miRNAs expression between NPC and immortalized human nasopharyngeal epithelial cell line NP69. Exogenously up-regulating miR-223 could suppress cell proliferation and colony formation, increase tumor formation in nude mice (Fig.
2 and
4). The results are consistent with the discovery in hepatic carcinoma that the inhibition of miR-223 accompanies the enhancement of Stathmin1 expression [
24]. In hematopoietic cells, miR-223 can negatively post-transcript regulate the expression of LMO2 and CEBP-β to reduce cell proliferation [
25]. MiR-223 up-regulation in Hela cells inhibits cell proliferation by targeting IGF-1R [
9]. However, in the gastric cancer development, miR-223 acts as an oncogene to promote cell invasion and migration via affecting expressions of EPB41L3 and FBXW7/hCdc4 genes [
10,
26,
27]. In addition, miR-223 has been report to regulate the proliferation and invasion of human breast cancer cells for targeting Caprin-1 [
28]. On the other hand, there has been another report suggesting that miR-223 functions as a potent tumor suppressor of the Lewis lung carcinoma cell line by targeting insulin-like growth factor-1 [
29]. MicroRNA 223 is up-regulated in the multistep progression of Barrett’s esophagus and modulates sensitivity to chemotherapy by targeting PARP1 [
30], it also modulates multidrug resistance via downregulation of ABCB1 in hepatocellular carcinoma cells [
31]. In our study, we demonstrated that exogenous miR-223 inhibits CNE-2 cell migration and invasion (Fig.
3). The discrepant results of miR-223 role seemed to indicate that miR-223 regulates different gene expression to play different role in various cancers.
In the normal cells, miRNAs maintain the homeostasis of various life processes including proliferation, differentiation and apoptosis. During the tumorigenesis, deregulation of miRNAs can lead to various consequences since various miRNAs bind with many mRNAs to regulate gene expression [
32]. Biological approaches are commonly used to verify the relationship between miRNAs and tumor phenotypes or to validate the possibility as a drug target [
33]. MiR-122 is significantly higher in the serum of hepatocarcinoma patients, suggesting that miR-122 is likely as a novel biomarker for screening the patients [
34]. A plasma miRNA panel is discovered for early diagnosis of hepatocarcinoma, and used in clinic to significantly reduce the frequency that optimal treatment window is missing [
34]. Osteosarcoma development is associated with gene expression regulated by MiRNAs [
4]. MiR-223/Ect2/p21 signaling regulates osteosarcoma cell cycle progression and proliferation [
35]. A study also reported that miR-421 can be used as a biomarker to detect circulated tumor cells of gastric cancer patients [
5]. In addition, many miRNAs have been discovered as a potential target for diagnosis and treatment of human diseases. In the serum from non-small lung cancer patients, miR-146b, miR-221, let-7a, miR-155, miR-17-5p, miR-27a and miR-106a are significantly reduced but miR-29c increased [
36]. The above-mentioned reports with our study indicate that miR-223 could be a serum biomarker of NPC patients to give early diagnosis for optimal treatment.
MAFB, a member of Maf protein family, is a transcription factor with basic-leucine zipper structure and plays an important role in early tissue specification and terminal differentiation [
37]. In multiple myeloma, MAFB can make hematopoietic stem/progenitor cells reprogramed into malignant plasma cells [
38]. In addition, MAFB is expected to be highly sensitive and very specific biomarker for poor prognosis of multiple myeloma patients [
39]. Further studies need to illustrate the role of MAFB in NPC carcinogenesis.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
WY conducted the whole experiment. DL provided necessary technical guides. XL and SL edited the manuscript and were responsible for the paper submission process. SL and TL were responsible for all the required funds raising, experiment designing and paper appraisal as the study directors. All authors read and approved the final manuscript.