Skip to main content
Erschienen in: Malaria Journal 1/2020

Open Access 01.12.2020 | Research

Molecular characteristics of odorant-binding protein 1 in Anopheles maculipennis

verfasst von: Mohammad Bagher Ghavami, Sakineh Khoeini, Navid Dinparast Djadid

Erschienen in: Malaria Journal | Ausgabe 1/2020

Abstract

Background

Anopheles maculipennis complex, the historic vector of malaria, causes serious medical problems worldwide and exhibits different behaviours. Studying the odorant-binding proteins (OBPs), which influence the chemosensory system and behavioural responses, is essential to understanding the population structure and developing effective control measures against this vector. The present study was designed to identify and analyse the obp1 gene in An. maculipennis.

Methods

Adults of An. maculipennis sensu stricto were collected in Zanjan Province, northwest of Iran, and gDNAs of female mosquitoes were extracted. Fragments of An. maculipennis obp1 (Amacobp1) gene were amplified using degenerate and specific primers, and some of amplicons were selected for sequencing.

Results

Analysis of amplified products identified that the sequence of Amacobp1 gene was 1341 bp long. This gene contains three exons (5′, internal, and 3′of 160, 256, and 18 bp, respectively) and encodes 144 amino acids. The sizes of introns I and II in deduced gene are 268 and 358 nucleotides, respectively. The amino acid sequence in the C-terminal of AmacOBP1 is similar to that of major malaria vector Anopheles species. However, its N-terminal has a specific signal peptide with 19 amino acids. This peptide is conserved in different studied populations, and its sequence of amino acids shows the most variation among anopheline species.

Conclusions

Degenerate primers in this study are suggested for studying obp1 gene in Anopheles species. Amacobp1 gene is proposed as a molecular marker for the detection of intraspecific ecotypes and diagnosis of different species within Maculipennis Group. Moreover, the N-terminal of AmacOBP1 peptide is recommended as a molecular marker to identify the Amacobp1 expression patterns in different chemosensory organs for assessing the molecular mechanisms and developing novel behavioural disturbance agents to control An. maculipennis.
Hinweise

Supplementary information

Supplementary information accompanies this paper at https://​doi.​org/​10.​1186/​s12936-019-3058-6.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
AmacOBP1
Anopheles maculipennis odorant-binding protein 1
BLAST
basic local alignment search tool
BLASTn
basic local alignment search tool for nucleotides
bp
base pair
DDT
dichlorodiphenyltrichloroethane
DEET
N, N-diethyl-m-toluamide
gDNA
genomic DNA
ITS2
internal transcript spacer 2
kD
Kilo Dalton
MEGA6
molecular evolutionary genetics analysis version 6
mRNA
messenger ribonucleic acid
NCBI
The National Center for Biotechnology Information
OBPs
odorant-binding proteins
ORF
open reading frame
P BLAST
basic local alignment search tool for peptides
PCR
polymerase chain reaction
RACE
rapid amplification of cDNA ends
RFLP
restriction fragment length polymorphism
s.s.
sensu stricto
UTR
untranslated region

Background

Anopheles maculipennis complex include the historic vectors of malaria in Holarctic regions and can cause serious public health problems worldwide [13]. In this complex, there are several sibling species, among which An. maculipennis sensu stricto (s.s.) is the dominant one in Europe and the Middle East regions [46]. These species occur partially sympatric and exhibit different behaviours in their host preference and selection of resting and breeding places [57]. Adults of these species are frequently found in human dwellings and animal shelters. They rest both indoor and outdoor shelters, and actively bite humans and animals [69]. Recently, various vector control methods have been developed against malaria vectors, such as An. maculipennis, and the most widely used method is insecticide application [10]. However, over the years, it has been reported that these species are resistant to some insecticides, such as DDT, organophosphate, carbamate, and pyrethroid [11, 12]. Accordingly, new mosquito-centered strategies for controlling and eliminating vector-borne diseases are urgently needed.
Repellents (impregnated bed nets and other formulations) seem to be applicable and efficient for the personal protection against biting insects and the diseases that they transmit to the inhabitants of endemic areas and travellers [10, 13]. These compounds interfere in the olfactory system of insects, thereby preventing the transmission and spread of vector-borne diseases [14, 15]. Knowledge about the molecular elements of the mosquito odorant detection system and their specific functions is crucial for developing novel and eco-friendly methods for mosquito control [16]. Although numerous studies have contributed to understanding structure of various genes and their application in differentiation of species in Maculipennis Group [5, 1720], there is still lack of information on the olfactory system of these species. This information may provide new insight into understanding the mechanism governing the speciation within the aforesaid complex and separation of their ecotypes.
Odorant-binding proteins (OBPs) are the most important agents in the olfactory system. These proteins play key roles in odorant perception and transmission to receptor sites, signal transduction, and triggering a series of behavioural responses [14, 15]. The insect OBPs are soluble and globular peptides (15–40 kDa, ca 120–150 amino acids) with six highly cysteine-rich (Cys) residues, paired in three interlocked disulfide bridges [21, 22]. The affinities of these peptides for binding to ligand are pH-dependent [23]. The hydrogen bonds involving in the C-terminal loop break at low pH and open the loop, thus releasing further ligands [2325]. These proteins are grouped into the following categories: classic, minus-C, plus-C, and atypical OBPs, based on the number of conserved Cys residues and their molecular structure [26]. Classic OBPs is the most important OBP in insects and contains six conserved cysteines having distinct disulfide connectives [2628].
Among the classic group of the mentioned proteins, OBP1 is expressed exclusively in the head and olfactory organs of adult insects [2931]. Meanwhile, the sexually-biased expression of this protein is exhibited in different species of insects [27, 2934]. Moreover, this protein is expressed rhythmically, and its transcription level is reduced after blood feeding by less than twofold in mosquitoes and other blood-feeding insects [34, 35]. The three-dimensional structure of Anopheles gambiae OBP1 (AgamOBP1) has already been detected, and indole and DEET have been identified as its ligands [3638]. The homolog to AgamOBP1 in Anopheles stephensi has also been found as AsteOBP1, and its expression has revealed that its transcription level is sevenfold higher in female’s than in male’s antenna [34]. The amino acid sequence of exon 1 in this gene has been suggested as a molecular marker for diagnosis of biological forms in An. stephensi [39]. Moreover, based on the nucleotide sequence variation of intron I Asteobp1 gene in different populations, An. stephensi may prove to be a complex species [40].
Owing to the wide variation in the biological and ecological characteristics (host preference and vector competence.) within the members of Maculipennis Group, this study attempted to characterize, for the first time, the An. maculipennis OBP1 gene (Amacobp1), as a basic information for further studies to distinguish different taxa belonging to Maculipennis Group in the world. The present study also provides a new insight into the role of OBPs in the behaviour of different species and understanding speciation-related events within this complex.

Methods

Mosquito collection

Adults of An. maculipennis were collected by hand catch from Gheytoul (37°06′31.7″ N 47°47′28.9″ E), Ghara Bouta (37°03′31.3″ N 47°46′09.5″ E), Moshampa (36°56′33.8″ N 47°40′28.8″ E), Kheyrabad (36°55′25.4″ N 47°22′50.6″ E), and Sari Aghol (36°49′23.5″ N 47°37′46.8″ E) in Zanjan Province, the northwest of Iran, in summer 2016.

Processing of mosquitoes

Samples of female mosquitoes were selected for molecular survey. Identification of An. maculipennis s.s. were carried out using morphological characters [3, 7] and PCR–RFLP assay, based on ITS2 ribosomal DNA [20]. To extract genomic DNA (gDNA), the samples were stored at − 70 °C for 1 h. Then the frozen samples were placed individually in 1.5-ml tubes and homogenized by an electrical homogenizer in a 400-µl TENS buffer (100 mM of Tris, pH 8.0, 10 mM of EDTA, 0.5 mM of NaCl, and 1% W/V SDS) containing a few glass beads. The gDNA of the samples was extracted as described by Ghavami et al. [20]. Briefly, 20 µg of proteinase K was added to each sample, mixed gently and incubated at 55 °C for 5 h. After incubation, 100 µl of 8 M potassium acetate was added and kept on ice bath for 10 min. The samples were then spun at 4000×g for 10 min, and the supernatants were transferred to new tubes. An equal volume of cold absolute ethanol was added to each tube, and the samples were spun at 8000×g for 10 min. Pellets of the samples were suspended in 0.5 ml of 70% cold ethanol and eventually spun at 8000×g for 10 min. The final pellet was dried at room temperature and re-suspended in 50 µl of TE buffer (10 mM Tris, pH 8.0, and 1 mM EDTA).
The PCR assays were conducted in two steps. In the first phase, the splicing region between the upstream and the downstream of deduced gene was amplified by degenerate primers. These primers were designed from the conserved regions of this gene in known anopheline species (Table 1) by means of BioEdit version 7 software [41]. These primers are not specific and could be used to generate the OBP1 gene in different anopheline species. The first stage of PCR was performed from mosquito gDNA in two separated ′a′ and ′b′ reactions. Each 50 µl of PCR reaction of this stage contained 4 µg of gDNA as the template, 1.5 mM of MgCl2, 0.2 mM of dNTPs (SinaClon, Iran), 10 pM of each primer (AnFa, AnRa and AnFb, AnRb; Table 2), and 1 U Taq of DNA polymerase (SinaClon, Iran). Thermal profile of PCR reaction was started with one cycle of initial denaturation at 95 °C for 3 min, followed by running through 30 cycles of 60 s at 94 °C, 60 s at 68 °C, and 90 s at 72 °C. The final extension was performed in one cycle at 72 °C for 5 min.
Table 1
Sequences of nucleotides in different genes of encoded odorant-binding protein 1 (OBP1) in Anopheles species used for designing the degenerate primers in this study
Anopheles species
Gene codea
Sequence location
An. culicifacies
ACUA014299
KI424042: 15893–17790
An. dirus
ADIR008409
KB672813: 2498551–2500404
An. epiroticus
AEPI007538
KB671606: 54036–56043
An. farauti
AFAF003898
KI915040: 6703195–6705104
An. funestus
AFUN008615
KB668715: 290624–291834
An. gambiae
AGAP029062
2R: 35643035–35644609
An. melas
AMEC013481
KI920369: 35115–36111
An. merus
AMEM011461
KI915244: 175565–177040
An. quadriannulatus
AQUA010363
KB665843: 2529565–2530556
An. sinensis
ASIS018762
KI916356: 352496–353910
An. stephensi
ASTE010148
KB664334: 168200–170200
aGene numbers submitted to the VectorBase (https://​www.​vectorbase.​org)
Table 2
Details of the primers used in this study
Primer name
Nucleotide sequence (5′ → 3′)
AnFa
TTGTCTCDTGATTGATTTGTCA
AnRa
CTTYTCGTCYTCGTGGATTCT
AnFb
AGATCCACGARGACGARAAG
AnRb
GAAAAATACGGTCTGATTATAG
AmaF
GTGTGGATAGTTCTTGGAACGG
AmaR
AAGAAATGCATCGCACACTCGC
R = A+G, Y = C+T, D = A+G
The second phase of PCR was performed by using the specific primers, AmaF and AmaR (Table 2). These primers, specific to An. maculipennis s.s., were designed based on the nucleotide sequence of the first PCR products. The forward primer (AmaF) was located around the translation start codon and the reverse primer (AmaR) at the translation stop of the Amacobp1 gene. For each 50 µl of PCR reaction, 10 ng of gDNA was amplified with 10 pM of each primer using the following conditions: 95 °C for 5 min in one cycle, 93 °C for 30 s, 60 °C for 50 s, and 72 °C for 2 min. This cycle was repeated 35 times.
Each PCR run contained field samples and a negative control (molecular grade water instead of DNA template). Aliquots of the amplicons were analysed by electrophoresis on 1.5% agarose gel stained with safe stain (SinaClon, Iran) and visualized under a UV light. The amplified fragments were purified by PCR Clean-Up Kit (SinaClon, Iran) and sequenced bi-directionally by SeqLab GmbH (WWW.​Seqlab.​De) using the forward and reverse specific primers. The nucleotide sequences of the samples were aligned and edited by the aid of BioEdit and Sequin software (https://​www.​ncbi.​nlm.​nih.​gov/​Sequin). The Amacobp1 nucleotide sequences in studied populations were submitted to the GenBank and are available with accession nos. MG209518-MG209522 and MN080505-MN080524.
The consensus of nucleotide and amino acid sequences were achieved by Basic Local Alignment Search Tool (BLAST) (https://​blast.​ncbi.​nlm.​nih.​gov/​Blast.​cgi), BLASTn and P BLAST, which were searched for fragment identification and compared with other submitted relevant sequences in NCBI (https://​www.​ncbi.​nlm.​nih.​gov), VectorBase (https://​www.​vectorbase.​org) and FlyBase (http://​www.​flybase.​org).
The mature peptide sequences identified in this study and in the previous studies were aligned using Clustal Omega (https://​www.​ebi.​ac.​uk/​Tools/​msa/​clustalo/​). The alignments were used to construct phylogenetic trees using the Molecular Evolutionary Genetics Analysis software version 6 (MEGA6) [42]. The final unrooted consensus trees were generated with 1000 bootstrap trials using the Neighbor-Joining, Maximum Likelihood, and Minimum-Evolution methods with a cut-off bootstrap value of 50 and using p-distance model.

Results

The fragments of 1100 and a 1200 bp were amplified in the ‘a’ and ‘b’ section of the first PCR step, respectively, in 200 specimens (40 samples from each population) by degenerated primers. In the second step, a 1261-bp fragment was obtained in studied samples by specific primers (Fig. 1). A total of 20 PCR products of specific primers (4 samples from each population) and 5 PCR products of degenerated primers (one sample from each population) were selected randomly for sequencing. Analysing the sequences of degenerated primer products revealed that the sequence of Amacobp1 gene has 1341 nucleotides. This analysis also exhibited the existence of two introns and three (5′, internal, and 3′) exons in deduced gene (Fig. 2). In amplified fragments, the transcription start site (GTCGTCG indicated as +1 in Fig. 2) occurred in 57 nucleotide upstream of the start codon (ATG). However, a TCAGG sequence, similar to the arthropod imitator, was observed in 15 nucleotide upstream of the transcription start site. The Goldberg-Hogness box, known as TATA box, is located in the 35-bp upstream of the predicted transcription start site. Imperfect polyadenylation signal sequences AATA, AATTAA, AATTT, and AAATAA were found in the 155, 161, 204, and 211 downstream of the poly (dA) tail, respectively. The position of transcription start site, the start and stop codons, and the open reading frame (ORF) was interrupted by two introns, and the putative polyadenylation signals are all shown in Fig. 2.
The processed transcript was 715 bp long with an approximately 57 bp 5′ UTR and 224 bp 3′ UTR. The coding region contained 434 bp long. In this region, three exons, including 5′, internal, and 3′ of 160, 256, and 18 bp, respectively, encoded 144 amino acids of OBP1. The sizes of intron I and intron II in the deduced gene were 268 and 358 nucleotides, respectively.
Twenty fragments comprising 5′ UTR, ORF, and partial 3′ UTR of Anmacobp1 gene were generated by specific primers. The alignment was 1261 bp in length (including primers 44 bp), and 41 sites (3%) were variable among the sequences. Each of 5′ and internal exons had three variable nucleotide sites, and the nucleotide polymorphism in introns I and II were in 12 and 10 sites, respectively. The percentages of nucleotide polymorphism in coding and noncoding regions of the deduced gene were 1.4% and 3.8%, respectively. All the single nucleotide polymorphisms in the coding region were silent. Multiple alignments of these sequences in representative populations are illustrated in Fig. 3.
Standard protein BLAST analysis of AmacOBP1 indicated that the overall structure of this peptide was highly similar to Anopheles atroparvus OBP1, which was annotated in VectorBase with AATE020811-RA code. The analysis also showed that AmacOBP1 alignment shared 87% amino acid similarity with Anopheles sinensis (AIR09579), as well as 86% identity with An. gambiae (AAI84179), 83% with An. stephensi (ACS83757), and 83% with Drosophila melanogaster (FBpp0078305). Comparison of amino acid sequences of AmacOBP1 with their homologous in An. atroparvus revealed that they had only one non-identical amino acid. In An. maculipennis, cysteine (C) had been replaced by glycine (G) (C → G) in locus 5 (Fig. 4).
Pairwise comparison of amino acids in OBP1 among different species of Anopheles showed the existence of six conserved C amino acids, five of which were in the first exon, and the remaining one in the second exon. This analysis also suggested that the two exons (II and III) were relatively conserved between anopheline species both in terms of their sequence and length. Comparing amino acid sequence of AmacOBP1 with AgamOBP1 indicated that the C-terminal of AmacOBP1 has a high similarity (95%, 3/60) to that of AgamOBP1.
The comparison between the N-terminal of AmacOBP1 and its orthologous polypeptide in different species revealed that this region was less conserved, and 19 amino acids of this part were signal peptides and had specific sequencing. However, C-terminal of the AmacOBP1 polypeptide had a high level of conservation between the species and exon III of deduced obp1 gene in An. maculipennis encoding a short-chain amino acid peptide (6 amino acids), which its composition was similar to that of other anopheline species.
The phylogenic relationship and topology based on the amino acid of polypeptide in deduced protein, along with sequences available in the VectorBase and FlyBase, is illustrated in Fig. 5. The Neighbour-Joining, Minimum Evolution, and Maximum likelihood analyses showed these OBPs cluster in three groups. An. atroparus and An. sinensis were the closest species to An. maculipennis. This clade, together with Anopheles dirus and Anopheles farauti, was deposited in one group. Anopheles farauti, An. dirus, An. stephensi, Anopheles funestus, and Anopheles culicifacies were sister groups with An. maculipennis. The remaining species, including An. gambiae, Anopheles quadrimaculatus, and Anopheles arabiensis, which were initially separated from anopheline species, were located in the third group (Fig. 5).

Discussion

Anopheles maculipennis s.s. is the dominant anopheline species of the Maculipennis Group in Europe and the Middle East regions [49]. There has previously been no available information regarding Amacobp gene and sequence details of olfaction-associated genes in this species. Therefore, generating relevant genetic data was a research priority for investigations focusing on olfactory gene functions in different species of Maculipennis Group.
Using degenerate primers in this study, the fragment sequences of 1100 bp within gDNA, a region covering the obp1 gene in An. maculipennis, were amplified by PCR, and, thus, these primers could be suggested for use in studying obp1 gene in different Anopheles species. Applying degenerate primes to amplify the candidate obp1 gene from gDNA is a convenient way to identify the molecular characters. Nonetheless, this method might miscalculate the data related to 5′ and 3′ UTRs of the gene. Hence, further studies are necessary to obtain the full-length cDNA clones from mRNA by RACE-PCR methods.
In the present study, analysis of amplified fragments, products with specific primers, showed that the ORF of Amacobp1 gene has 1060 nucleotides, and this region encodes a 144-amino-acid polypeptide. Comparison of the amplified fragments in studied samples revealed that the AmacOBP1 is conserved within the population level. To the best of our knowledge, this is the first report describing the Amacobp1 gene. The generated information could be useful for the development of molecular techniques in studying Amacobp1 expression patterns in different olfactory and gustatory organs.
Comparison of amino acid sequencing of AmacOBP1 with its orthologous peptides demonstrated that this protein has 86% similarity with AgamOBP1. Previous studies have also indicated that AgamOBP1 displays high affinity with its ligands. The C-terminal loop of this peptide covers the binding cavity, and attractant and repellent have been identified as two of its ligands [36, 37]. The alignment of AmacOBP1 with AgamOBP1 and other mosquito orthologous peptides showed a high level of conservation in the overall protein structure. The availability of the primary and the secondary structures of AmacOBP1 would help prospective modelling studies that compare and contrast the two anopheline OBP1 proteins. Therefore, future studies are suggested to investigate the expression profile and ligand-binding feature in AmacOBP1. Moreover, identifying key amino acids in C-termini and detecting main hydrophobic, polar and nonpolar residues in signal peptides that involve in the ligand binding could be the other subjects for future investigations.
By comparing amino acid sequences in the C-terminal of AmacOBP1 with its orthologous peptides a high identity (95%) was found between AmacOBP1 and AgamOBP1. DEET and other repellents have been demonstrated to target OBP function by disrupting interaction with natural ligands to prevent connection with other compounds of the olfactory signaling pathway. Although effective, DEET has been recognized to be toxic, to have reduced efficacy with time after application, and to be ineffective against developed resistance species [43, 44]. Therefore, the need for a new, more efficient and less toxic repellent is highly felt. In silico ligand-binding studies in future may be valuable for screening mosquito repellents. In addition, X-ray crystallography and nuclear magnetic resonance (NMR) have successfully been applied to solve the structure of OBP from different insect species [24]. Comparative structure of AmacOBP1 is certainly important in forthcoming research, particularly to address questions regarding molecular feature of the pH-dependent conformation changes (Additional file 1).
The phylogeny analysis in the present study showed a great variety in the amino acid alignment of OBP1 peptides in different Anopheles species, and AmacOBP1 exhibited the highest amino acid variation among these peptides. Considering these results, it is suggested that the OBP1-encoding gene in the anopheline is derived from the same ancestor and diverged after speciation. On the other hand, the AmacOBP1, which has the most variation, may have a long history or high rate of evolution in adaptation to ecological conditions. The high rate of variation within AmacOBP1 may suggest the ongoing evolutionary mechanisms, including genetic drift and gene flow that are still faster in the speciation within this complex. This observation may be explained in further studies by the wide variation and distribution patterns of different members in the Maculipennis Group.
The present study showed that the N-terminal of AmacOBP1 assets signal peptides. Despite the consistency of amino acid sequences in C-terminal, this part has specific sequence and little sequence conservation. In the context of evolution, the pressures that shaped the properties of the mature OBP proteins are fundamentally different from those that shaped their signal peptides. The mature proteins evolve to interact with external chemical signals and to function in a behavioural context, while the signal peptides develop to interact with intracellular signals involved in trafficking. All of these OBPs are postulated to be expressed in and secreted by glia-like support cells that ensheathe the sensory neuron somata and have highly folded apical membranes facing the sensillum lumen. The OBPs are presumably secreted across these apical membranes. The OBP signal peptides contain the hydrophobic cores of 10–12 amino acids flanked by more hydrophilic regions. These characteristics of signal peptides are involved in protein translocation into endoplasmic reticulum for the purpose of secretion [45, 46]. In the same general cell type, these intracellular signals are expected to be conserved, especially within a given mosquito species, and are poorly conserved between species. This class of conservation suggests that OBP1 signal peptides might be involved in class-specific processing for expressed homologous proteins. Therefore, they could be used as a molecular marker for studying the population structure of species in Maculipennis Group. Moreover, signal peptides are appropriate sequences to design specific primers and probes for studying the gene expression pattern in olfactory and gustatory organs of An. maculipennis by qPCR assay in different populations.

Conclusion

Degenerate primers in this research are suggested for study on obp1 gene in different Anopheles species. Prospective studies are recommended to investigate the gene expression profile and ligand-binding profiles in AmacOBP1. Further investigations are also suggested to identify the key amino acids, main hydrophobic and polar/nonpolar residues of AmacOBP1 C-terminal in ligand-binding. The signal peptide in N-terminal of AmacOBP1 is advised for designing specific primers and probes, to detect the expression pattern of this gene in the main olfactory and gustatory organs for assessing the molecular mechanisms and developing novel repellents against this vector in future surveys. In addition, this peptide is proposed as a molecular marker for detection of An. maculipennis intraspecific ecotypes and diagnosis of different species within Maculipennis Group.

Supplementary information

Supplementary information accompanies this paper at https://​doi.​org/​10.​1186/​s12936-019-3058-6.

Acknowledgements

The authors express their thanks to Mr. Taghiloo, Mohammadi, and Torabi for their collaboration in the collection of samples. We duly acknowledge the financial support of this project provided by Deputy of Research and Technology of Zanjan University of Medical Sciences, Iran. We also would like to thank to Ms. Safari and anonymous reviewers for their comments that improved the quality of the manuscript.
Not applicable.

Competing interests

The authors declare that they have no competing interest.
Not applicable.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
1.
Zurück zum Zitat Jetten TH, Takken W. Anophelism without malaria in Europe. A review of the ecology and distribution of the genus Anopheles in Europe. Netherlands: Wageningen Agricultural University Papers; 1994. p. 94–5. Jetten TH, Takken W. Anophelism without malaria in Europe. A review of the ecology and distribution of the genus Anopheles in Europe. Netherlands: Wageningen Agricultural University Papers; 1994. p. 94–5.
2.
Zurück zum Zitat Service MW, Townson H. The Anopheles vector. In: Warrell DA, Gilles HM, editors. Essential malariology. 4th ed. London: CRC Press; 2002. Service MW, Townson H. The Anopheles vector. In: Warrell DA, Gilles HM, editors. Essential malariology. 4th ed. London: CRC Press; 2002.
3.
Zurück zum Zitat Harbach RE. The classification of genus Anopheles (Diptera: Culicidae): a working hypothesis of phylogenetic relationships. Bull Entomol Res. 2004;94:537–53.PubMedCrossRef Harbach RE. The classification of genus Anopheles (Diptera: Culicidae): a working hypothesis of phylogenetic relationships. Bull Entomol Res. 2004;94:537–53.PubMedCrossRef
4.
Zurück zum Zitat Ramsdale C, Snow K. Distribution of the genus Anopheles in Europe. Eur Mosq Bull. 2000;7:1–26. Ramsdale C, Snow K. Distribution of the genus Anopheles in Europe. Eur Mosq Bull. 2000;7:1–26.
5.
Zurück zum Zitat White GB. Systematic reappraisal of the Anopheles maculipennis complex. Mosq Syst. 1978;10:13–44. White GB. Systematic reappraisal of the Anopheles maculipennis complex. Mosq Syst. 1978;10:13–44.
6.
Zurück zum Zitat Zahar AR. Vector bionomics in the epidemiology and control of malaria. Part II. The WHO European region and the WHO Eastern Mediterranean region, vol. 2. Geneva: World Health Organization; 1990. Zahar AR. Vector bionomics in the epidemiology and control of malaria. Part II. The WHO European region and the WHO Eastern Mediterranean region, vol. 2. Geneva: World Health Organization; 1990.
8.
Zurück zum Zitat Linton YM, Smith L, Koliopoulos G, Samanidou-Voyadjoglou A, Zounos AK, Harbach RE. Morphological and molecular characterization of Anopheles (Anopheles) maculipennis Meigen, type species of the genus and nominotypical member of the maculipennis complex. Syst Entomol. 2003;28:39–56.CrossRef Linton YM, Smith L, Koliopoulos G, Samanidou-Voyadjoglou A, Zounos AK, Harbach RE. Morphological and molecular characterization of Anopheles (Anopheles) maculipennis Meigen, type species of the genus and nominotypical member of the maculipennis complex. Syst Entomol. 2003;28:39–56.CrossRef
9.
Zurück zum Zitat Becker N, Petrić D, Boase C, Lane J, Zgomba M, Dahl C, Kaiser A. Mosquitoes and their control. London: Springer; 2010.CrossRef Becker N, Petrić D, Boase C, Lane J, Zgomba M, Dahl C, Kaiser A. Mosquitoes and their control. London: Springer; 2010.CrossRef
10.
Zurück zum Zitat Devillers J. Use of insecticides indoors for the control of mosquitoes: exposure scenarios and modeling. In: Devillers J, editor. Computational design of chemicals for the control of mosquitoes and their diseases. Boca Raton: CRC Press; 2017. p. 423–52.CrossRef Devillers J. Use of insecticides indoors for the control of mosquitoes: exposure scenarios and modeling. In: Devillers J, editor. Computational design of chemicals for the control of mosquitoes and their diseases. Boca Raton: CRC Press; 2017. p. 423–52.CrossRef
11.
Zurück zum Zitat Akiner MM, Caglar SS, Simsek FM. Yearly changes of insecticide susceptibility and possible insecticide resistance mechanisms of Anopheles maculipennis Meigen (Diptera: Culicidae) in Turkey. Acta Trop. 2013;126:280–5.PubMedCrossRef Akiner MM, Caglar SS, Simsek FM. Yearly changes of insecticide susceptibility and possible insecticide resistance mechanisms of Anopheles maculipennis Meigen (Diptera: Culicidae) in Turkey. Acta Trop. 2013;126:280–5.PubMedCrossRef
12.
Zurück zum Zitat Chavshin AR, Dabiri F, Vatandoost H, Mohammadi Bavani M. Susceptibility of Anopheles maculipennis to different classes of insecticides in West Azarbaijan province, northwestern Iran. Asian Pac J Trop Biomed. 2015;5:403–6.CrossRef Chavshin AR, Dabiri F, Vatandoost H, Mohammadi Bavani M. Susceptibility of Anopheles maculipennis to different classes of insecticides in West Azarbaijan province, northwestern Iran. Asian Pac J Trop Biomed. 2015;5:403–6.CrossRef
13.
Zurück zum Zitat Debboun M, Frances S, Strickman D. Insect repellents: principles, methods, and uses. New York: CRC Press; 2006.CrossRef Debboun M, Frances S, Strickman D. Insect repellents: principles, methods, and uses. New York: CRC Press; 2006.CrossRef
14.
Zurück zum Zitat Dickens JC, Bohbot JD. Mini review: mode of action of mosquito repellents. Pesticide Biochem Physiol. 2013;106:149–55.CrossRef Dickens JC, Bohbot JD. Mini review: mode of action of mosquito repellents. Pesticide Biochem Physiol. 2013;106:149–55.CrossRef
15.
Zurück zum Zitat Qiu YT, Van Loon JA. Olfactory physiology of blood-feeding vector mosquitoes. In: Takken W, Knols BGJ, editors. Ecology and control of vector-borne diseases: olfaction in vector-host interactions, vol. 2. Netherland: Wageningen Academic Publisher; 2010. p. 39–62. Qiu YT, Van Loon JA. Olfactory physiology of blood-feeding vector mosquitoes. In: Takken W, Knols BGJ, editors. Ecology and control of vector-borne diseases: olfaction in vector-host interactions, vol. 2. Netherland: Wageningen Academic Publisher; 2010. p. 39–62.
16.
Zurück zum Zitat Vijay V, Reji G. Herbal insecticides: repellents and biomedicines: effectiveness and commercialization. London: Springer; 2016.CrossRef Vijay V, Reji G. Herbal insecticides: repellents and biomedicines: effectiveness and commercialization. London: Springer; 2016.CrossRef
17.
Zurück zum Zitat Oshaghi MA, Sedaghat MM, Vatandoost H. Molecular characterization of the Anopheles maculipennis complex in the Islamic Republic of Iran. East Mediterr Health J. 2003;9:659–66.PubMed Oshaghi MA, Sedaghat MM, Vatandoost H. Molecular characterization of the Anopheles maculipennis complex in the Islamic Republic of Iran. East Mediterr Health J. 2003;9:659–66.PubMed
18.
Zurück zum Zitat Sedaghat MM, Linton Y-M, Oshaghi MA, Vatandoost H, Harbach RE. The Anopheles maculipennis complex (Diptera: Culicidae) in Iran: molecular characterization and recognition of a new species. Bull Entomol Res. 2003;93:527–35.PubMedCrossRef Sedaghat MM, Linton Y-M, Oshaghi MA, Vatandoost H, Harbach RE. The Anopheles maculipennis complex (Diptera: Culicidae) in Iran: molecular characterization and recognition of a new species. Bull Entomol Res. 2003;93:527–35.PubMedCrossRef
19.
Zurück zum Zitat Djadid ND, Gholizadeh S, Tafsiri E, Romi R, Gordeev M, Zakeri S. Molecular identification of Palearctic members of Anopheles maculipennis in northern Iran. Malar J. 2007;6:6.PubMedPubMedCentralCrossRef Djadid ND, Gholizadeh S, Tafsiri E, Romi R, Gordeev M, Zakeri S. Molecular identification of Palearctic members of Anopheles maculipennis in northern Iran. Malar J. 2007;6:6.PubMedPubMedCentralCrossRef
20.
Zurück zum Zitat Ghavami MB, Djadid ND, Haniloo A. Molecular characteristics of Anopheles maculipennis Meigen in Zanjan, northwest of Iran, inferred from ITS2 sequence analysis. Pak J Biol Sci. 2008;11:539–45.PubMedCrossRef Ghavami MB, Djadid ND, Haniloo A. Molecular characteristics of Anopheles maculipennis Meigen in Zanjan, northwest of Iran, inferred from ITS2 sequence analysis. Pak J Biol Sci. 2008;11:539–45.PubMedCrossRef
21.
Zurück zum Zitat Field LM, Pickett JA, Wadhams LJ. Molecular studies in insect olfaction. Insect Mol Biol. 2000;9:545–51.PubMedCrossRef Field LM, Pickett JA, Wadhams LJ. Molecular studies in insect olfaction. Insect Mol Biol. 2000;9:545–51.PubMedCrossRef
22.
Zurück zum Zitat Fan J, Francis F, Liu Y, Chen JL, Cheng DF. An overview of odorant-binding protein functions in insect peripheral olfactory reception. Genet Mol Res. 2011;10:3056–69.PubMedCrossRef Fan J, Francis F, Liu Y, Chen JL, Cheng DF. An overview of odorant-binding protein functions in insect peripheral olfactory reception. Genet Mol Res. 2011;10:3056–69.PubMedCrossRef
23.
Zurück zum Zitat Leite NR, Krogh R, Xu W, Ishida Y, Iulek J, Leal WS, Oliva G. Structure of an odorant-binding protein from the mosquito Aedes aegypti suggests a binding pocket covered by a pH-sensitive “Lid”. PLoS ONE. 2009;26(4):e8006.CrossRef Leite NR, Krogh R, Xu W, Ishida Y, Iulek J, Leal WS, Oliva G. Structure of an odorant-binding protein from the mosquito Aedes aegypti suggests a binding pocket covered by a pH-sensitive “Lid”. PLoS ONE. 2009;26(4):e8006.CrossRef
24.
Zurück zum Zitat Wogulis M, Morgan T, Ishida Y, Leal WS, Wilson DK. The crystal structure of an odorant binding protein from Anopheles gambiae: evidence for a common ligand release mechanism. Biochem Biophys Res Commun. 2006;339:157–64.PubMedCrossRef Wogulis M, Morgan T, Ishida Y, Leal WS, Wilson DK. The crystal structure of an odorant binding protein from Anopheles gambiae: evidence for a common ligand release mechanism. Biochem Biophys Res Commun. 2006;339:157–64.PubMedCrossRef
25.
Zurück zum Zitat Pelosi P, Iovinella I, Felicioli A, Dani FR. Soluble proteins of chemical communication: an overview across arthropods. Front Physiol. 2014;27(5):320. Pelosi P, Iovinella I, Felicioli A, Dani FR. Soluble proteins of chemical communication: an overview across arthropods. Front Physiol. 2014;27(5):320.
26.
Zurück zum Zitat Mastrobuoni G, Qiao H, Iovinella I, Sagona S, Niccolini A, Boscaro F, et al. A proteomic investigation of soluble olfactory proteins in Anopheles gambiae. PLoS ONE. 2013;25(8):e75162.CrossRef Mastrobuoni G, Qiao H, Iovinella I, Sagona S, Niccolini A, Boscaro F, et al. A proteomic investigation of soluble olfactory proteins in Anopheles gambiae. PLoS ONE. 2013;25(8):e75162.CrossRef
27.
Zurück zum Zitat Zhou JJ, He XL, Pickett JA, Field LM. Identification of odorant-binding proteins of the yellow fever mosquito Aedes aegypti: genome annotation and comparative analyses. Insect Mol Biol. 2008;17:147–63.PubMedCrossRef Zhou JJ, He XL, Pickett JA, Field LM. Identification of odorant-binding proteins of the yellow fever mosquito Aedes aegypti: genome annotation and comparative analyses. Insect Mol Biol. 2008;17:147–63.PubMedCrossRef
28.
Zurück zum Zitat Pelletier J, Leal WS. Genome analysis and expression patterns of odorant-binding proteins from the southern house mosquito Culex pipiens quinquefasciatus. PLoS ONE. 2009;16(4):e6237.CrossRef Pelletier J, Leal WS. Genome analysis and expression patterns of odorant-binding proteins from the southern house mosquito Culex pipiens quinquefasciatus. PLoS ONE. 2009;16(4):e6237.CrossRef
29.
Zurück zum Zitat Zhao H, Zhao W, Gao P, Zhang G, Jiang Y. Sequence and expression characterization of an OBP1 gene in the Asian honeybee, Apis cerana cerana (Hymenoptera: Apidae). Appl Entomol Zool. 2014;49:189–96.CrossRef Zhao H, Zhao W, Gao P, Zhang G, Jiang Y. Sequence and expression characterization of an OBP1 gene in the Asian honeybee, Apis cerana cerana (Hymenoptera: Apidae). Appl Entomol Zool. 2014;49:189–96.CrossRef
30.
Zurück zum Zitat Biessmann H, Walter MF, Dimitratos S, Woods D. Isolation of cDNA clones encoding putative odorant binding proteins from the antennae of the malaria transmitting mosquito Anopheles gambiae. Insect Mol Biol. 2002;11:123–32.PubMedCrossRef Biessmann H, Walter MF, Dimitratos S, Woods D. Isolation of cDNA clones encoding putative odorant binding proteins from the antennae of the malaria transmitting mosquito Anopheles gambiae. Insect Mol Biol. 2002;11:123–32.PubMedCrossRef
31.
Zurück zum Zitat Biessmann H, Andronopoulou E, Biessmann MR, Douris V, Dimitratos SD, Eliopoulos E, et al. The Anopheles gambiae odorant binding protein 1 (AgamOBP1) mediates indole recognition in the antennae of female mosquitoes. PLoS ONE. 2010;5:e9471.PubMedPubMedCentralCrossRef Biessmann H, Andronopoulou E, Biessmann MR, Douris V, Dimitratos SD, Eliopoulos E, et al. The Anopheles gambiae odorant binding protein 1 (AgamOBP1) mediates indole recognition in the antennae of female mosquitoes. PLoS ONE. 2010;5:e9471.PubMedPubMedCentralCrossRef
32.
Zurück zum Zitat Justice RW, Dimitratos S, Walter MF, Woods DF, Biessmann H. Sexual dimorphic expression of putative antennal carrier protein genes in the malaria vector Anopheles gambiae. Insect Mol Biol. 2003;12:581–94.PubMedCrossRef Justice RW, Dimitratos S, Walter MF, Woods DF, Biessmann H. Sexual dimorphic expression of putative antennal carrier protein genes in the malaria vector Anopheles gambiae. Insect Mol Biol. 2003;12:581–94.PubMedCrossRef
33.
Zurück zum Zitat Li ZX, Pickett JA, Field LM, Zhou JJ. Identification and expression of odorant-binding proteins of the malaria-carrying mosquitoes Anopheles gambiae and Anopheles arabiensis. Arch Insect Biochem Physiol. 2005;58:175–89.PubMedCrossRef Li ZX, Pickett JA, Field LM, Zhou JJ. Identification and expression of odorant-binding proteins of the malaria-carrying mosquitoes Anopheles gambiae and Anopheles arabiensis. Arch Insect Biochem Physiol. 2005;58:175–89.PubMedCrossRef
34.
Zurück zum Zitat Sengul MS, Tu Z. Identification and characterization of odorant-binding protein 1 gene from the Asian malaria mosquito Anopheles stephensi. Insect Mol Biol. 2010;19:49–60.PubMedCrossRef Sengul MS, Tu Z. Identification and characterization of odorant-binding protein 1 gene from the Asian malaria mosquito Anopheles stephensi. Insect Mol Biol. 2010;19:49–60.PubMedCrossRef
35.
Zurück zum Zitat Rund SS, Bonar NA, Champion MM, Ghazi JP, Houk CM, Leming MT, et al. Daily rhythms in antennal protein and olfactory sensitivity in the malaria mosquito Anopheles gambiae. Sci Rep. 2013;29(3):2494.CrossRef Rund SS, Bonar NA, Champion MM, Ghazi JP, Houk CM, Leming MT, et al. Daily rhythms in antennal protein and olfactory sensitivity in the malaria mosquito Anopheles gambiae. Sci Rep. 2013;29(3):2494.CrossRef
36.
Zurück zum Zitat Rusconi B, Maranhao AC, Fuhrer JP, Krotee P, Choi SH, Grun F, et al. Mapping the Anopheles gambiae Odorant Binding Protein 1 (AgamOBP1) using modeling techniques, site directed mutagenesis, circular dichroism and ligand binding assays. Biochim Biophys Acta. 2012;1824:947–53.PubMedPubMedCentralCrossRef Rusconi B, Maranhao AC, Fuhrer JP, Krotee P, Choi SH, Grun F, et al. Mapping the Anopheles gambiae Odorant Binding Protein 1 (AgamOBP1) using modeling techniques, site directed mutagenesis, circular dichroism and ligand binding assays. Biochim Biophys Acta. 2012;1824:947–53.PubMedPubMedCentralCrossRef
37.
Zurück zum Zitat Tsitsanou KE, Thireou T, Drakou CE, Koussis K, Keramioti MV, Leonidas DD, et al. Anopheles gambiae odorant binding protein crystal complex with the synthetic repellent DEET: implications for structure-based design of novel mosquito repellents. Cell Mol Life Sci. 2012;69:283–97.PubMedCrossRef Tsitsanou KE, Thireou T, Drakou CE, Koussis K, Keramioti MV, Leonidas DD, et al. Anopheles gambiae odorant binding protein crystal complex with the synthetic repellent DEET: implications for structure-based design of novel mosquito repellents. Cell Mol Life Sci. 2012;69:283–97.PubMedCrossRef
38.
Zurück zum Zitat Murphy EJ, Booth JC, Davrazou F, Port AM, Jones DN. Interactions of Anopheles gambiae odorant-binding proteins with a human-derived repellent: implication for the mode of action of N, N-diethyl-3-methylbenzamide (DEET). J Biol Chem. 2013;288:4475–85.PubMedCrossRef Murphy EJ, Booth JC, Davrazou F, Port AM, Jones DN. Interactions of Anopheles gambiae odorant-binding proteins with a human-derived repellent: implication for the mode of action of N, N-diethyl-3-methylbenzamide (DEET). J Biol Chem. 2013;288:4475–85.PubMedCrossRef
39.
Zurück zum Zitat Gholizadeh S, Firooziyan S, Ladonni H, Hajipirloo HM, Djadid ND, Hosseini A, et al. The Anopheles stephensi odorant binding protein 1 (AsteObp1) gene: a new molecular marker for biological forms diagnosis. Acta Trop. 2015;146:101–13.PubMedCrossRef Gholizadeh S, Firooziyan S, Ladonni H, Hajipirloo HM, Djadid ND, Hosseini A, et al. The Anopheles stephensi odorant binding protein 1 (AsteObp1) gene: a new molecular marker for biological forms diagnosis. Acta Trop. 2015;146:101–13.PubMedCrossRef
40.
Zurück zum Zitat Firooziyan S, Djadid ND, Gholizadeh S. Speculation on the possibility for introducing Anopheles stephensi as a species complex: preliminary evidence based on odorant binding protein 1 intron I sequence. Malar J. 2018;17:366.PubMedPubMedCentralCrossRef Firooziyan S, Djadid ND, Gholizadeh S. Speculation on the possibility for introducing Anopheles stephensi as a species complex: preliminary evidence based on odorant binding protein 1 intron I sequence. Malar J. 2018;17:366.PubMedPubMedCentralCrossRef
41.
Zurück zum Zitat Hall TA. Bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95–8. Hall TA. Bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;41:95–8.
42.
Zurück zum Zitat Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;16:2725–9.CrossRef Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;16:2725–9.CrossRef
43.
Zurück zum Zitat Robbins PJ, Cherniack MG. Review of the bio-distribution and toxicity of the insect repellent N, N-diethyl-m-toluamide (DEET). J Toxicol Environ Health. 1986;18:503–25.PubMedCrossRef Robbins PJ, Cherniack MG. Review of the bio-distribution and toxicity of the insect repellent N, N-diethyl-m-toluamide (DEET). J Toxicol Environ Health. 1986;18:503–25.PubMedCrossRef
44.
Zurück zum Zitat Corbel V, Stankiewicz M, Pennetier C, Fournier D, Stojan J, Girard E, et al. Evidence for inhibition of cholinesterase in insect and mammalian nervous systems by the insect repellent DEET. BMC Biol. 2009;7:47.PubMedPubMedCentralCrossRef Corbel V, Stankiewicz M, Pennetier C, Fournier D, Stojan J, Girard E, et al. Evidence for inhibition of cholinesterase in insect and mammalian nervous systems by the insect repellent DEET. BMC Biol. 2009;7:47.PubMedPubMedCentralCrossRef
45.
Zurück zum Zitat Rapoport TA. Protein translocation across the eukaryotic endoplasmic reticulum and bacterial plasma membranes. Nature. 2007;450:663–9.PubMedCrossRef Rapoport TA. Protein translocation across the eukaryotic endoplasmic reticulum and bacterial plasma membranes. Nature. 2007;450:663–9.PubMedCrossRef
46.
Zurück zum Zitat Rabouille C. Pathways of unconventional protein secretion. Trends Cell Biol. 2017;27:230–40.PubMedCrossRef Rabouille C. Pathways of unconventional protein secretion. Trends Cell Biol. 2017;27:230–40.PubMedCrossRef
Metadaten
Titel
Molecular characteristics of odorant-binding protein 1 in Anopheles maculipennis
verfasst von
Mohammad Bagher Ghavami
Sakineh Khoeini
Navid Dinparast Djadid
Publikationsdatum
01.12.2020
Verlag
BioMed Central
Erschienen in
Malaria Journal / Ausgabe 1/2020
Elektronische ISSN: 1475-2875
DOI
https://doi.org/10.1186/s12936-019-3058-6

Weitere Artikel der Ausgabe 1/2020

Malaria Journal 1/2020 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.