Mycobacterial antigens in pleural fluid mononuclear cells to diagnose pleural tuberculosis in HIV co-infected patients

Pleural fluid analyses were performed on stored samples from a previous published study [26]. Briefly, patients presenting with pleural effusion and clinical symptoms of pleural TB admitted to the Dr. George Mukhari Hospital, Ga-Rankuwa, Pretoria, South Africa during the period 2004–2005 were recruited into the study. Patients with recent TB therapy (< 1 year) or treated with corticosteroids, immunosuppressive or antiretroviral therapy were not included. HIV testing was done routinely in pleural effusion patients with suspected TB. The demographic and clinical data, HIV status and CD4+ T-cell count were recorded for each patient.

Thoracocentesis was performed according to clinical practice at the hospital. The pleural fluid specimens were processed according to standard laboratory routines for acid fast bacilli (AFB) staining of smears and culture (BacT-alert, Org anon, Teknika). The pleural fluid was also sent for cytological examination and Adenosine deaminase activity (ADA) analysis using a commercial colorimetric assay kit (Diazyme General Atomics, CA) with a cut-off value for positive test of 30 U/L [27, 28]. At the time of inclusion pleural fluid mononuclear cells (PFMCs) were isolated from approximately 200 ml pleural fluid by density gradient centrifugation (Ficoll histopaque 1077, Sigma). Cells were washed once with isotonic NaCl, and twice with RPMI with 10% fetal calf serum (FCS) (1640, L-glutamine and HEPES supl., Sigma), and resuspended in RPMI media to make a final concentration of 1 × 10⁶ cells/ml. Cells were cryopreserved in 10%DMSO/90%FCS. Cryovials were placed in − 80 °C, and then transferred into liquid nitrogen for long term storage. The cells were shipped to Haukeland University Hospital, Bergen, Norway for further analysis. Cryovials were thawed in a 37 °C water bath until the cell suspension was almost melted. The cell suspension was then transferred to 5 mL centrifuge tubes containing RPMI with 10% FCS at 37 °C, centrifuged at 350 g for 5 min, and resuspended in RPMI with 10% FCS. Smears were made for Ziehl Neelsen staining and immunocytochemical staining.

All antibodies used in the study were in-house rabbit polyclonal, except for anti-Bacille Calmette- Guѐrin (BCG), which was obtained from DAKO Immunoglobulins, Copenhagen, Denmark (code B124; lot 063B). Table 1 shows the immunogens used for production of these antibodies, target antigens, how they are named in the manuscript, and dilutions. The specificity of these antisera has been determined by earlier studies [21, 29].

Immunocytochemistry was performed by using the DakoCytomation kit (EnVision + System-HRP; DakoCytomation Denmark A/S, Glostrup, Denmark). The PFMC smears were passed through graded alcohol and treated with 3% bovine serum albumin for 5 min. Primary antibodies were added, and the smears incubated for 1 h 15 min. Optimal dilutions were determined by titration. The smears were incubated with anti-rabbit dextran polymer conjugated to horseradish peroxidase for 45 min. The endogenous peroxidase activity was inhibited by incubating the smears with hydrogen peroxide for 8 min. Antigens were visualized by incubation with 3-amino-9-ethylcarbazol and hydrogen peroxide containing substrate for 15 min. The smears were counter-stained with hematoxylin. All incubations were carried out at room temperature and the smears were washed thoroughly between incubations.

Negative and positive controls were included in all experiments. One smear where the primary antibody was substituted with antibody diluent, and one smear from a patient with non-tuberculous pleural effusion were used as negative controls. One smear from a culture positive patient with abundant acid-fast bacilli on Ziehl-Neelsen staining was used as positive control.

The stained slides were evaluated at 10x magnification using a light microscope and positive signals were further assessed at 40x magnification. Cells with intracellular granular staining were counted at 10x magnification. The whole smear was examined, and the number of fields counted. The antigen load was quantified by calculating the number of stained cells per 100 fields. For diagnostic purpose, a case with any positive signal was labelled as positive.

DNA extraction was performed by adding 400-1000 μL of the PFMC suspension to a cryotube containing 250 μl of acid-washed micro-glass beads and ribolysing the tubes for 45 s. A 123- base pair fragment from IS6110 was amplified using the following primers 5′ CCTGCGAGCGTAGGCGTCGG 3′ and 5′ CTCGTCCAGCGCCGCTTCGG 3′. The product was subjected to a second round of PCR amplification using the primers 5′ TTCGGACCACCAGCACCTAA 3′ and 5′ TCGGTGACAAAGGCCACGTA 3′ to amplify a 92-base pair fragment. The PCR reaction mixture consisted of 5 μL DNA, 25 μL Taq master mix (Qiagen), 0.25 μl of each 100 μM primer stock solution, and distilled water to make a final volume of 50 μl. For the second round of PCR, 1 μL of the first PCR product was used as template. The reaction cycle for the first PCR was- 94 °C for 1 min, 68 °C for 1 min, 72 °C for 20 s for 45 cycles, and for the nested-PCR - 94 °C for 1 min, 58 °C for 1 min, and 72 °C for 20 s for 35 cycles. Both PCR had an initial heat activation step of 95 °C for 15 min and a final extension of 72 °C for 10 min. The amplified products were analyzed in a 3% agarose gel stained with ethidium bromide. Mycobacterial DNA isolated from bacterial cultures was used as positive control and a reaction tube where test template was substituted with distilled water as negative control in each PCR run. A negative control tube containing RPMI, going through all steps including the DNA extraction protocol were also included.

Mycobacterial DNA load was estimated based on the number of nested-PCR positive triplicates from each sample. Low and high load was defined when PCR was positive in one of the three, and three of three samples, respectively. For diagnostic purposes, any positive in the triplicate was labelled as positive. The gel electrophoresis image of the nested-PCR results for some of the samples is shown in Fig. 1.

A real-time PCR assay targeting a 103-base pair long segment of the mycobacterial heat shock protein 65 gene GroEL2 was performed as previously published by our group [30]. The target segment was amplified using the forward primer MycoFP1 (5′ -CGAGGCGATGGACAAGGT-3′), the reverse primer TB12 (5′ -CTTGTCGAACCGCATACCCT-3′), and the fluorescent-tagged Taq Man MGB probe MycoPr1 (5′ -VIC-AACGAGGGCGTCATCACCGTCG-MGB-3′). The PCR reactions were set up in a total volume of 20 μl consisting of 10 μL of 2 × TaqMan Universal PCR MasterMix (Applied Biosystems), 5 μL DNA extract from clinical specimen and a final concentration of each primer and probe of 0.9 μM and 0.25 μM, respectively. Amplification was done with a 7500 Fast-Real-Time System (Applied Biosystems) using the following parameters: 2 min at 50 °C to activate AMPErase UNG, 10 min at 95 °C to activate AmpliTaq Gold, followed by 45 thermal cycles of 95 °C for 15 s and 60 °C for 1 min. Each clinical specimen was run in technical duplicates or triplicates. To further ensure the reliability of results, each run included both negative controls (5 μL of sterile water) as well as several positive controls (known dilutions of genomic DNA from Bacille Calmette- Gue’rin, Mycobacterium spp. ATCC 19015D). Standard quantification curves were generated based on the known concentrations of the positive controls using the Sequence Detection System software v1.3 (Applied Biosystems). As per recommendations of the manufacturer (Applied Biosystems), real-time PCR data were analyzed using a threshold set at 10 SDs above background signal level and only threshold cycle values below 40 were noted as positive.

The patients were categorized by using a composite reference standard by combining the clinical and laboratory diagnostic criteria. Pleural TB was defined based on either mycobacterial confirmation by AFB microscopy and/or culture positive pleural fluid, or in the absence of bacteriological confirmation by clinical criteria based on ADA ≥30 U/L from the pleural fluid and/or strong clinical evidence consistent with active TB followed by a clinical decision to treat with anti-tuberculosis therapy [26]. A case was categorized as non-TB when diagnosed as malignancy or another non-TB condition.

The study was evaluated and approved by the Research, Ethics and Publications Committee at the Dr. George Mukhari Hospital, University of Limpopo, South Africa (2003) and the Regional Committee for Ethics in Medical Research in Bergen, Norway (2003, REK Vest nr.185.02). All the patients received written and verbal information of the study and all gave informed written consent.

Table 2 shows the demographic and laboratory characteristics of the 41 patients enrolled in the study. Case based information is provided in Additional file 1. Thirty-two (78%), were classified as pleural TB cases based on the composite reference standard, and nine as non-TB cases. Thirteen patients had culture confirmed pleural TB, 26 (81%) were HIV pleural TB co-infected, and 64% of these had < 100 CD4+ T cells/microL. The median ADA level was 62 U/L. Among non-TB cases, 5 (56%) were HIV positive and median ADA levels were 15 U/L. Seven of the study participants had a history of previous TB with anti-tuberculous treatment finished more than 1 year before study inclusion.

Among the HIV pleural TB co-infected, the proportion of culture positive cases was significantly higher as compared to the HIV-negative pleural TB cases (50% versus 0%, respectively), while the proportion of AFB microscopy, nested-PCR and real-time PCR was not different (Table 3). Among the non-TB cases, there was no difference between HIV positive and HIV negative cases, except for a higher number of positive for a combination of culture or nested-PCR or any antigen in the HIV positive group (Table 3).

Mycobacterial antigens were observed as intracellular granular staining in the cytoplasm of pleural fluid mononuclear cells (Fig. 2). There was no difference in the proportion of mycobacterial antigen positive cases or load of any antigens between HIV positive and HIV negative pleural TB cases (Table 3). The load of individual antigens varied among pleural TB cases. Heterogeneous antigens were the most abundant (Fig. 3) and were higher as compared to LAM (p = 0.04) and secreted antigen (p = 0.02) (Fig. 3). The levels of antigens had a significant positive correlation with each other, except between heterogeneous mycobacterial antigens and cell wall antigen (Table 4). Interestingly, culture had a tendency towards negative correlation with all antigens, but the association was not statistically significant (Table 4).

Association of mycobacterial DNA load with culture, AFB microscopy and the mycobacterial antigens was also studied. Cases with higher DNA load had higher number of culture positive (p = 0.06), microscopy positive (p = 0.07) and cell wall antigen positive (p = 0.007) results as compared to those with lower DNA load (Table 5). Figure 4 shows the load of various antigens among cases with higher and lower DNA load. The load of cell wall antigen was higher in the cases with higher DNA load (p = 0.02), while there was no difference in the load of any of the other mycobacterial antigens studied (Fig. 4). Additional file 1 provides case-based information.

Pleural TB cases with CD4+ T-cell counts < 100 had higher number of culture positive cases as compared to cases with CD4+ T-cell counts > 100 (p = 0.07) (Table 5), indicating higher viable bacterial load. There was a significant negative correlation between the CD4+ T-cell counts and culture (p = 0.006) (Table 4). The number of cases positive for cell wall antigen (p = 0.003) and secreted antigen (p = 0.04) were also higher in those with CD4+ T cell count < 100 (Table 5). The load of individual antigens was higher among cases with CD4+ T-cell count < 100 as compared to those with CD4+ T-cell count > 100. The only statistically significant difference was seen for cell wall antigen (p = 0.01), where this antigen was not detected in cases with higher CD4+ T-cell counts (Fig. 5). There was a trend towards negative correlation between CD4+ T-cell counts and the mycobacterial antigens, though without statistical significance (Table 4). Additional file 1 provides case-based information.

Using the composite reference standard, sensitivity and specificity of the individual antigens to diagnose pleural TB was between 38 and 47% and 56–100% respectively (Table 6). LAM was the most frequently detected antigen (47%) and was not detected in any of the non-TB cases. When using culture or the combination of culture and nested-PCR as reference standard, the sensitivity of the individual antigens was, in general, higher. Except for heterogenous antigens, the specificity, was lower as compared to the composite reference standard.

Among rapid tests, the sensitivity of antigen detection was better than the AFB microscopy and real-time PCR, and very close to the nested-PCR. The sensitivity of culture was 41%. By using a composite antigen detection approach based on the detection of any of the four mycobacterial antigens, the sensitivity improved to 72%, which was better than all the other tests, although the specificity was reduced to 44% (Table 6).

Using culture as a reference standard, the sensitivity of the individual antigens was better than AFB microscopy and real-time PCR, but lower than the nested-PCR. By using a combination of culture and nested-PCR as reference standard, the sensitivity of antigen detection was much better than the AFB microscopy and real-time PCR (Table 6).

As the different diagnostic tests were positive in different cases, a head-to-head comparison of all tests was also performed to show that combination of various tests gives a better diagnostic yield as compared to a single test (Table 7). Among the 23 nested-PCR negative cases, 10 more cases were positive with combination of secreted antigen and LAM, and 15 more cases with combination of all antigens. A combination of culture, nested-PCR, and mycobacterial antigens was positive in 28 (88%) of pleural TB cases, indicating added value of combining various diagnostic tests.