Background
Rice stripe virus (RSV) belongs to the genus
Tenuivirus, and is characterized by transovarian transmission in a persistent, circulative-propagative manner by the small brown planthopper (
Laodelphax striatellus) [
1]. Since 2000, RSV has occurred in the Yangtze River region and generally caused a 30–40% reduction in yield in eastern China [
2,
3]. RSV comprises four single-stranded RNAs, named RNA1–RNA4 in order of decreasing molecular size, which encode seven proteins with an ambisense expression strategy [
4]. RNA1 encodes a protein in the negative-sense (virus-complementary [vc]) strand, which is called RNA-dependent RNA polymerase (RdRp, 337 kDa) [
5]. NS2 (silencing suppressor, 22.8 kDa) and NSvc2 (glycoprotein, 94 kDa) are produced from viral-sense RNA2 (vRNA2) and vcRNA2, respectively [
6]. RNA3 encodes a nonstructural protein that has been identified as a viral suppressor of RNA silencing (VSR; NS3, 23.9 kDa), and a nucleocapsid protein (CP, 35 kDa)[
7], which are derived independently from vRNA3 and vcRNA3 [
8]. vRNA4 and vcRNA4 encode a disease-specific protein (NS4) and a movement protein (NSvc4), respectively [
9,
10].
RNA silencing is a defense system that interacts with viral genomic RNAs in plants. VSRs from different viral families do not share any obvious sequence similarity, but they generally bind to double stranded RNAs (dsRNAs), such as small interfering RNA (siRNA) duplexes, to suppress RNA silencing and block host RNA silencing pathways by targeting different steps [
11‐
13]. The NS3 protein of
Rice hoja blanca tenuivirus suppresses RNA silencing in plant and insect hosts by efficiently binding both siRNAs and microRNAs (miRNAs) [
14]. P19, the suppressor of
Tomato bushy stunt virus (TBSV), functions by binding siRNAs to prevent them from forming RNA-induced silencing complex (RISC) [
15]. P69, the suppressor of
Turnip yellow mosaic virus (TYMV), binds dsRNAs to inhibit the initiation of RNA silencing [
11,
16,
17]. 2b protein, the suppressor of
Cucumber mosaic virus (CMV), targets Argonaute (AGO) protein, a core component of RISC [
11,
17]. NS3 of RSV, a reported RNA silencing suppressor, suppresses post-transcriptional gene silencing (PTGS) in
Nicotiana benthamiana through its siRNA and dsRNA binding ability [
8].
VSRs may enhance viral pathogenicity and accumulation, but transgenic plants expressing
Tobacco etch virus (TEV) HC-Pro exhibit enhanced resistance to heterologous TBRV and to the oomycete
Peronospora tabacina [
12]. Transgenic rice expressing RSV NS3 exhibit stronger resistance to rice blast disease (
Magnaporthe grisea oryzae Guy) than wild-type rice [
18]. Furthermore, disease symptoms and viral accumulation are more moderate in transgenic rice than in wild-type rice after RSV inoculation [
8]. NS3 not only plays a critical role in combating viral infection at the early stages of disease, but also induces host resistance to the virus and other pathogens. Previous studies showed that NS3-induced miRNA accumulation in rice may lead to enhanced miRNA processing complexes and pathogenicity [
19]. The apparent dual roles of NS3 may be further explored using molecular techniques.
To elucidate the underlying mechanisms for host plant responses to RSV infection, we aimed to identify the key genes involved in plant-RSV interactions. Transcriptomic analysis has been a popular approach to explore the unknown players in a wide range of biological processes. In functional genomics, transcriptomic studies typically involve comparisons between biological samples collected under different conditions, and are used to analyze which genes are upregulated or downregulated in response to stresses [
20‐
22]. RSV infection affects expression patterns of plant miR171 and several other miRNAs, and a reduction of osa-miR171b in RSV-infected rice contributes to RSV symptoms [
23]. How NS3 enhances host resistance to viral infection remains unclear, but this effect is likely to be mediated by changes in endogenous gene expression. NS3 induces the accumulation of several miRNAs and enhances viral infection and pathogenesis in rice; most of these miRNAs target pivotal genes associated with growth and development or pathogen resistance [
19]. This study employed transcriptome analysis and RT-qPCR to uncover the function of NS3 in transgenic
N. benthamiana. To characterize
N. benthamiana responses to NS3 at the transcriptome level, we identified genes that were differentially expressed between wild-type and NS3-expressing
N. benthamiana up to the 6th leaf stage. We aimed to provide novel insights into the mechanisms underlying hosts-VSR interactions.
Methods
Plant growth and virus inoculation
Wild-type N. benthamiana and NS3-transgenic N. benthamiana were grown in a greenhouse under a 16-h light and 8-h dark cycle at 25 °C. NS3-transgenic N. benthamiana and wild-type N. benthamiana were inoculated with RSV. At 21 days post-infiltration, leaf tissues were collected. Three biological replicates (three plants per replicate) were processed independently.
Northern blotting
Total RNA was isolated from frozen NS3-transgenic N. benthamiana plants, which were not infected with RSV, using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Fifty micrograms of DNase-treated total RNA was separated on a 15% agarose gel, and transferred electrophoretically to Hybond-N+ membranes using 20× SSC. Membranes were baked at 80 °C for 2 h. DNA oligonucleotides complementary to the putative NS3 sequences were end-labeled with digoxigenin (DIG) using the DIG Oligonucleotide 3′-end Labeling Kit (Roche, 11,585,614,910). Membranes were pre-hybridized for at least 1 h and hybridized overnight at 42 °C using the DIG High Prime Labeling and Detection Starter Kit II (Roche, 11,585,614,910).
Western blotting
To determine RSV protein accumulation in RSV-infected N. benthamiana and RSV-infected NS3-transgenic N. benthamiana plants, total proteins were extracted from 0.1 g of plant material in 500 μL of protein extraction buffer. For protein gel blotting, proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in a 12% gel and transferred to PVDF membranes (BioRad, Hercules, CA, USA). The membranes were blocked for 1 h with 5% milk in PBST buffer at room temperature. After washing, the membranes were incubated with anti-RSV CP antibody overnight at room temperature. Signals were developed in NBT/BCIP buffer (Transgen Biotech, Beijing, China).
RNA extraction and purification and transcriptome sequencing
Total RNA was extracted from N. benthamiana and NS3-transgenic N. benthamiana plants uninfected with RSV at the 6th leaf stage using Trizol reagent according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). RNA was quantified using agarose gel electrophoresis and a NanoDrop. Five RNA samples (CK④, CK⑤, NS3–5①, NS3–6④, and NS3–9④) were sent to the BioMark company for transcriptome sequencing as follows: first, mRNA was purified using poly-T oligo-attached magnetic beads, followed by fragmentation and cDNA synthesis and purification. Library quality was then assessed using the Agilent 2100 system. Libraries were sequenced on the Solexa Illumina HiSeq platform (BioMark Company, Beijing, China). Clean reads were obtained from raw reads by removing reads containing adapter or poly-N, and low-quality reads. The Q20, Q30, GC-content, and sequence duplication level of the clean reads were calculated. Then, clean reads were directly used for further bioinformatics analysis.
Analysis of differentially expressed genes (DEGs)
The original data from transcriptome sequencing comprised raw reads, and clean reads were obtained after removing adaptor sequences and low-quality reads. All clean reads were mapped to
Solanaceae reference sequences using bowtie software allowing a 2-bp mismatch. Each gene’s expression level was calculated using reads per kilobase per million mapped reads (RPKM). DEGs were identified by a
P value ≤0.05 and an expression change of 2-fold or more (|log2Foldchange| ≥ 1) between the two treatments using IDEG6 software. Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) classification were used to determine the main biological functions and pathways related to DEGs. GO was implemented using the GOseq R package, in which gene length bias was corrected, and GO terms with corrected
P values ≤0.05 were considered significantly enriched in DEGs. GO annotation was performed using the REVIGO web server (
http://revigo.irb.hr/). The KEGG classification of the DEGs was performed using the KEGG Mapper Annotate Sequence tool with the BlastKOALA server available on the Kyoto Encyclopedia of Genes and Genomes website (
https://www.kegg.jp/kegg/tool/annotate_sequence.html).
Real-time quantitative PCR (RT-qPCR) validation
Total RNA was extracted from wild-type
N. benthamiana and NS3-transgenic
N. benthamiana at the 6th leaf stage using Trizol reagent according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized from 1 μg of total RNA in a volume of 20 μL using the PrimeScript RT Reagent Kit (TAKARA Bio, RR037A) according to the manufacturer’s instructions. RT-qPCR was performed using the SYBR Green Real-time PCR Master Mix (ToYoBo, JAPAN) with the iQ5 Real-Time PCR system (Bio-Rad, USA) with gene-specific primers (Table
1), each reaction containing 10.0 μL of SYBR Green Real-time PCR Master Mix, 1.0 μL of cDNA, 0.5 μL of (10 pM) primers, and 8.0 μL of water. The expression levels of transcripts are presented relative to the corresponding control samples for each condition. The ubiquitin gene was used as an internal control gene. All RT-qPCR experiments were performed in triplicate.
Table 1
Primers used for RT-qPCR
ATP-2-NbS00015227g0002 | TATTCAAGCAGTTTATGTACCCGC | TGGGCTGTTTCGTAATGTTTCTC |
HIS -0-NbS00000634g0101 | AACAGCACGTAAATCCACTGGAG | AACCCACCAAGTAAGCCTCTG |
HIS- 2-NbS00002567g0001 | ATGGCGAGAACCAAACAAACAG | TCCTGCGCTATTTCTCTTACC |
LRR-1-NbS00005377g0007 | AGTGGGAGTATACCTGACAG | ATTGATACAGAGGCCAAGTTCAG |
LRR-2-NbS00007194g0113 | TAGTTACAACTGCGGTCGATG | TCCAGATCCAAACATTCCACG |
preoxidase-2-NbS00013071g0001 | AGGCTATTCAATTTCAACTCCAC | CTTGTAGAAGCATCGGTCCAC |
Psb-3-NbS00027134g0004 | ATCCAGAGCAAGACATACATG | ATCAAGAGTGTAGGTTAAGCG |
NBC-3-NbS00003711g0003 | TCTACCAGAAATTGAGGACCG | ATTCAATTGCGTGGGGTGAGC |
HSFP-NbS00043262g0009 | GGAGGAGGAATGTTGGTCAAAGC | CACATTTATCCAAGTATTGCTGG |
Rh-1-NbS00007177g0002 | AGGAGCTCAACTAAGTGATGTG | ACCTAAGTCATTATCTGTGTTC |
Ser-p-3-NbS00032762g0006 | AGGCGATGGTACTATTGTTTC | ACATCAGCAGAGAAATAATGTGC |
Psbp- 3-NbS00027024g0003 | TGAAGCCATTGTCCTCCATC | TAGGAGAAGTAGGAAGGTAAG |
Discussion
VSR is a determinant of viral pathogenicity. Recombinant virus co-expressing heterogeneous VSR is associated with increased virulence and more severe symptoms in host plants. However, our previous research showed that NS3-transgenic rice exhibited enhanced resistance to
Magnaporthe oryzae [
18]. The expression of some VSRs as transgenes in plants also induced developmental defects in vegetative and reproductive organs [
24‐
26]. Conversely, in this study we found that NS3-transgenic
N. benthamiana plants not only had the normal phenotype, as observed with transgenic
N. benthamiana expressing P19 from TBSV and P25 from
Potato virus X (PVX) [
25,
27], but also exhibited increased resistance to RSV, as observed with transgenic
N. benthamiana expressing HC-Pro from TEV [
12]. The underlying mechanism for this resistance requires further investigation, but is presumably related to NS3 activity, possibly in the nucleus [
8]. Primary-miRNAs (pri-mRNAs) were differentially expressed in rice infected by RSV, and NS3 was associated with decreased accumulation of pri-miRNAs; however, the mechanism by which NS3 influences pri-miRNA expression levels remains unclear [
23].
Several reports indicated that VSRs have the ability to induce upregulated expression of genes related to the plant responses to biotic or abiotic stress, in addition to their pathogenic roles during viral infection [
27,
28]. For example, expression of CMV VSR 2b protein in transgenic plants conferred increased drought tolerance [
28]. Expression of the PVX-specific P25 silencing suppressor in transgenic tobacco plants caused upregulation of 138 transcripts belonging to genes that are induced by various biotic and nonspecific stresses [
27]. In this study, we found that NS3 affected the expression of endogenous genes in
N. benthamiana. These DEGs were associated with 43 GO terms belonging to three categories, as well as four KEGG pathways. The most highly enriched GO terms were “metabolic process,” “single-organism process,” “cell part,” “membrane”, and “organelle part”. The key KEGG pathways were related to “ribosome,” “photosynthesis,” “photosynthesis-antenna proteins”, and “carbon metabolism”. Further functional analysis is required to clarify the roles of genes associated with these pathways. We suggest that NS3 has dual functions, including facilitating viral infection as a VSR and inhibiting pathogenic development as an inducer of host defense.
The fundamental unit of chromatin is the nucleosome, which is composed of approximately 146 base pairs of DNA wrapped around a histone octamer containing two copies each of histones H2A, H2B, H3, and H4. Chromatin structure influences the accessibility of transcription factors and cofactors for DNA-tempered processes. The structure and function of chromatin are regulated by multiple epigenetic mechanisms, including DNA methylation, histone modifications, adenosine triphosphate (ATP)-dependent chromatin remodeling, placement of histone variants, and regulation by non-coding RNA [
29]. Since the histone tail domains are highly accessible to the nuclear environment, they constitute attractive targets for signal-activated enzymes, and may function as important links between signal transduction and gene expression [
30]. A growing body of research suggests that histone modifications play vital roles in several chromatin-based processes [
31]. Recent research has demonstrated that a single methylated H3K36 per nucleosome is sufficient to silence cryptic transcription in vivo. The modification of nucleosomes, including histones, may lead to changes in biological processes and the plant response to abiotic stress [
32,
33]. The transgenic expression of RSV NS3 downregulated histone-related genes, indicating that NS3 could affect the nuclear environment of host cells.
Leucine-rich repeats receptor-like kinase (LRR-Like) genes represent a large and complex gene family in plants, and are involved mainly in development and stress responses. These receptors are composed of an LRR-containing extracellular domain (ECD), a transmembrane (TM) domain, and an intracellular kinase domain (KD) [
34]. Transcriptome analysis predicted downregulated LRR genes in the NS3-transgenic
N. benthamiana, although the precise functional roles of these genes remain unclear. However, it is plausible that NS3 expression affected the TM domain, which is required for RSV infection.
A newly discovered gene for a NAC domain protein in rice confers resistance to
Rice dwarf virus (RDV) [
35]. Similarly, genes related to the NAC domain were downregulated and associated with enhanced resistance in NS3-transgenic
N. benthamiana. The functions of these genes will be verified in subsequent vector-based experiments using vectors. Upregulated genes related to heat shock protein (HSP) play a role in
Agrobacterium-mediated plant transformation; therefore, decreased or increased HSP90 expression may affect transformation susceptibility [
36]. The function of HSP may be further investigated using transformation studies.
Acknowledgements
We would like to thank Junmin Li in the Zhejiang Provincial Key Laboratory of Plant Virology, Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, for analyzing transcriptome data.