Background
Mesencephalic dopaminergic neurons (MDNs) arise from a common set of precursors, but mature to direct a wide range of brain functions [
1]. The common feature of these cells is their ability to regulate dopamine (DA) synthesis, transmission and uptake. One of the most important functions MDNs possess is the control over voluntary movements. Also, their degeneration in substantial nigra (SN) is a hallmark of Parkinson's disease (PD) [
2]. It becomes a high priority to understand the molecular mechanism and pathway by which MDNs develop and maintain their functions [
3,
4]. NURR1, a transcription factor belonging to the orphan nuclear receptor superfamily, recognizes DNA by binding hormone-response elements in the promoters of regulated target genes [
5]. It regulates the expression of tyrosine hydroxylase (
TH), dopamine transporter (
DAT), vesicular monoamine transporter 2 (
VMAT2), and L-aromatic amino acid decarboxylase (
AADC), all of which are important in the synthesis and storage of DA [
6‐
9].
Nurr1 deficiency results in impaired dopaminergic function and increased vulnerability of MDNs to the oxidative insults [
10,
11]. Decreased NURR1 expression is found in the autopsied PD midbrains, particularly in neurons containing Lewy bodies, as well as in peripheral lymphocytes of patients with parkinsonian disorders [
12]. Also, several studies have found that variations in
Nurr1 gene might be risk factors for PD [
13]. All these studies suggest that NURR1 is essential in the development and differentiation of MDNs phenotype, function maintenance and neuroprotection, and has a distinct role in the pathology of PD [
10,
14].
Recently, increasing evidence reveals that NURR1 may influence the development and differentiation of MDNs through the regulation of axon genesis. In
Nurr1 null mice, Wallen and his colleagues, using Fluorogold as a retrograde axonal tracer, did not observe innervations of the striatum by MDN precursors [
15]. In primary ventral mesencephalon (VM) cultures, VM cells from wide type (WT) mice showed clear bundles of dopaminergic fibers while VM cells from
Nurr1 deficient mice displayed a diffuse network of processes without the formation of bundles of dopaminergic fibers after 7 days in culture [
16]. An in vitro study also showed that NURR1 induced morphological differentiation in MN9D cells characterized by long, usually bipolar neurites, while mock-transfected cells retained the usual round shape, bearing occasionally very short neurites [
17]. It is very interesting to know that gene
neuropilin, a receptor protein involved in axon guidance and angiogenesis, has been reported as one of
Nurr1 downstream targets [
1,
18]. Recently, Jacobs
et al. performed a study that combined gene expression microarrays and chromatin immunoprecipitation (ChIP)-on-chip analysis on E14.5
Nurr1-/- and
Nurr1+/+ embryos and thereby identified
Dlk1, Ptpru and
Klhl1 as novel
Nurr1 target genes
in vivo [
19].
Klhl1 is the homolog of the ACTIN-organizing
kelch gene in drosophila and is described as playing a central role in neurite outgrowth [
20,
21].
PTPRs have also been involved in axonal growth and guidance [
22]. These data raise the possibility that NURR1 may play an important role either directly or indirectly in the fasciculation of dopaminergic axons.
In our efforts to understand the mechanism by which NURR1 regulates dopaminergic cell development and differentiation, we used
Nurr1 knock-out mice, in combination with microarray technology, to identify novel
Nurr1 target genes. Using high stringent filtering criteria, several genes were identified as being regulated by
Nurr1. Of these genes, we are particularly interested in the gene
Topoisomerase IIβ (
Top IIβ). Eukaryotic TOP II is present in two isoforms: α and β. The α isoform expresses in proliferating cells and is mainly required for chromosome segregation. The β isoform is enriched in post-mitotic neuronal cells in developing brains [
23]. This nuclear enzyme is the catalytic entity operating directly on chromatin DNA and controls and alters the topologic states of DNA during transcription. Previous studies show that TOP IIβ plays a remarkable role in neurodevelopment and axon outgrowth [
24‐
26].
Top IIβ knock-out mice exhibit a specific and predominant defect in neuronal development. The defects in motor axon growth in
Top IIβ mutant mice cause breathing problems and death of the pups shortly after birth [
24].
Nurr1 knock-out mice also die soon after birth due to respiratory failure [
27]. Studies using brain-specific
Top IIβ knock-out mice have demonstrated an aberrant lamination pattern in the developing cerebral cortex and a similar prenatal death phenotype suggesting an essential role of TOP IIβ in brain development [
28]. In the cerebral cortex of
Top IIβ null mice, neurons born at later stages of corticogenesis fail to migrate to the superficial layers, motor axons fail to contact skeletal muscles, and sensory axons fail to enter the spinal cord. Isolated cortical neurons from
Top IIβ knock-out embryos exhibit shorter neurites than those from their wild type counterparts, confirming the role of TOP IIβ in neurite outgrowth [
26]. TOP II inhibitor ICRF-193 significantly blocks neurite outgrowth and growth cone formation in cultured cerebella granule neurons, dorsal root ganglions and cortical neurons [
26].
The present study aims to test the hypothesis that Top IIβ is a downstream target of Nurr1 and NURR1 might influence the processes of axon genesis via the regulation of TOP IIβ expression.
Discussion
NURR1 is known to activate transcription and bind DNA as monomer on NBRE that consists of an octanucleotide AAAGGTCA, containing the canonical nuclear receptor hexanucleotide binding motif preceded by two adenines [
31,
35,
36]. According to site-directed mutagenesis and luciferase analysis, we found that both of the NBRE-like sequences located in the 1600 bp
Top IIβ promoter contributed to the activation of
Top IIβ transcription although both of them have a one-base deviation from the consensus NBRE. However, NBRE2 is more sensitive to the transactivation of NURR1. One possible explanation is that NBRE2 is located closer to the transcription start site, making it more accessible to other co-activators. As the reporter gene assays totally depend on promoter context with no consideration of the micro-environment of the gene, ChIP assay is performed to determine whether NURR1 is directly recruited to the relevant DNA binding sites in the natural chromatin in living cells. Our data demonstrate that NURR1 is recruited to the NBRE2 in the
Top IIβ promoter, but not to NBRE1 and the control region located 3700 bp downstream of
Top IIβ transcriptional start site. It is possible that NURR1 binds weakly to the NBRE1
in vivo, and the interaction is undetectable. It is also possible that NURR1 could not bind NBRE1
in vivo for the constraints, DNA accessibility, or availability of co-factors in the cell, which strongly dictate where a transcription factor will actually bind. It seems that NBRE2 is the more critical site both for binding in intact chromatin
in vivo or transcriptional activation
in vitro.
SN dopaminergic neurons selectively project to dorso-lateral striatum in an orderly medial-to-lateral arrangement, forming the nigro-striatal pathway [
37]. Loss of dopaminergic neurons in the SN is one of the main pathological features of PD, which may result from the deficiency of the nigro-striatal pathway. Although the pathway has been identified for more than three decades, the underlying molecular mechanism is not well known. Previous studies suggest that the nigro-striatal circuit is formed via the regulation by many elements such as spatially and temporally distributed guidance cues, neurotrophic factors, morphogens, transcription factors and other known and unknown molecules.
TOP IIβ takes significant role in axon genesis [
24], however the precise molecular mechanism is unclear. Ju et al. found evidence that TOP IIβ activates transcription by generating a break in double-stranded DNA within a nucleosome [
38]. This enzyme, which is associated with a DNA-repair machinery, allows chromatin to relax, and drive gene expression [
38]. Large-scale microarray analysis has revealed that a subset of neuronal genes is down-regulated in the brains of
Top IIβ knock-out embryos. The expression of genes encoding proteins involved in neuron migration (e.g.,
Reln, Dab1, Sst and
Robo1), cell adhesion (e.g.,
Catna2, Cdh4, Cdh8, Nell2 and
Alcam), voltage-gated calcium channel activity (e.g.,
Cacna2d1 and
Cacna2d3), synaptic transmission (e.g.,
Syt1), and cytoskeleton formation (e.g.,
neurofilament) are down-regulated in the mutant [
25]. Using functional immunoprecipitation strategy to identify genomic sites directly targeted by TOP IIβ, several genes were discovered encoding membrane proteins with ion channel, transporter, or receptor activities [
38]. Significant proportions of them encode long transcripts and are juxtaposed to a long AT-rich intergenic region [
39]. These studies support the notion that TOP IIβ is required for neurite outgrowth during neuronal differentiation, possibly at the level of gene expression.
A recent report also reveals that TOP IIβ is associated with genomic instability in the cerebella region of aging brain [
40]. TOP IIβ is treated as an additional biomarker in DNA repair and aging using cultured cerebella granule neurons as an
in vitro aging model [
41]. It has been suggested that neurons may be more sensitive to repair deficiency than other cell types [
42]. Thus, the observed neural defects in
Top IIβ mutant embryos might be related to the plausible involvement of TOP IIβ in DNA repair. Ju et al. identified a connection between initiations of transcription and sensing and repairing of DNA double strand breaks, and found a new chromatin specific function for TOP IIβ [
38]. These studies undoubtedly stimulate new conceptual views about the interplay between regulated gene transcription and the DNA damage response.
It has been shown that TOP IIβ is highly expressed in differentiating cerebella neurons. It is the catalytically competent entity operating directly on chromatin DNA
in vivo [
43]. In our studies, we first report the expression profile of TOP IIβ in VM dopaminergic neurons. ICRF-193 is a very significant TOP II poison and causes dose-dependent cross-linking of human TOP IIβ to DNA and stimulates TOP IIβ-mediated DNA cleavage at specific sites on
32P-end-labeled DNA [
44]. It functions through both TOP IIβ-specific down-regulation and inhibition of TOP IIβ catalytic activity by activating a 26S proteasome pathway [
33,
45]. TOP IIα-mediated DNA cleavage was stimulated to a lesser extent by ICRF-193 [
44]. In the present study, we administrated ICRF-193 in a primary culture of VM neurons as well as nigra-stratum pathway
in vivo. Our
in vitro studies indicate that TOP IIβ is required for neurite outgrowth and growth cone formation. However the
in vivo studies illustrate a significant loss of dopaminergic neurons in SN, striatal dopamine content and injury of the nigra-striatum pathway after stereotaxically injection of ICRF-193 into the MFB of C57BL/6 mice. After TOP IIβ inhibition, the dopaminergic neurons could not maintain the extension of their axons to the striatum, resulting in fail to uptake and retro-transport the neurotrophic factors to the nigral neurons. Consequently, the nigral dopaminergic neurons degenerate and die. In order to rule out the side-effect of ICRF-193, we applied RNAi strategy
in vitro and observed a similar result as shown in ICRF-193 experiments, confirming that TOP IIβ is required for axon genesis and extension due to its own catalytic function in dopaminergic neurons.
Our results may provide important insights into the mechanisms whereby NURR1 is functioning during mesencephalon development and cell differentiation. Through a combination of
Nurr1 deficient mice and genomic expression profiling technology, we identified genes, which would possibly mediate the phenotype previously observed in
Nurr1 deficient mice. Recent studies suggest that many axon-guidance pathway genes, such like
DCC, EPHB1, NTNG1, SEMA5A and
SLIT3 were differentially expressed in PD [
46,
47]. The understanding of the processes of neurite outgrowth, axonal guidance and synaptogenesis is fundamental for developing treatments of PD. The results from our study provide the first evidence and novel molecular mechanisms by which NURR1 interacts with TOP IIβ to regulate MDNs development, differentiation and functional maintenance. These findings may open up a new avenue to explore the possible association of
Nurr1-Top IIβ in MDNs dysfunction related disease, including PD.
Methods
Experimental animals
Nurr1 deficient mice were generated by Dr. Conneely's laboratory as previously described [
1]. Paired
Nurr1 knock-out heterozygous (
Nurr1+/-) mice with the same background (129× C57BL/6) were mated to produce the
Nurr1+/+,
Nurr1+/- and
Nurr1-/- offspring used in the present study. The genotype of the mice was analyzed with PCR using mouse tail genomic DNA. Three primers were used: a 5' primer (GGCACTCCTGTGTCTAGCTGCC) located in the end of the neo
τ gene in exon 3, and two 3' primers, one (CTGCCTTGGGAAAAGCGCCTCC) in the neo
τ gene to generate a 200-bp band representing the mutated allele and the other (CAGCCCTCACAAGTGCGAACAC) in a 3' portion of exon 3 to generate a 300-bp WT band [
1]. The
Top IIβ-/- mice were kindly provided by Dr. Yi Lisa Lyu from Department of Pharmacology, UMDNJ-Robert Wood Johnson Medical School [
25]. Pups with a
Top IIβ deletion were identified by the presence of a 450-bp product in a PCR by using the primer pair PR3 (5'-ATATGGTACAGCAACAAAGCATTTGACATA-3') and PR7 (5'-GAATTGTT TGCTGTGGATGCATGTA-3') [
28]. WT strains C57BL/6 and ICR were purchased from Experimental Animal Center of Shanghai, China. Mice were mated for 2 hours and subsequently examined for a vaginal plug. Twenty-four hours later, they were designated as E1. Animal care and experimental procedures were performed in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23) and the Laboratory Animal Care Guidelines approved by Shanghai Institutes for Biological Sciences of Chinese Academy of Sciences.
Mesencephalic tissues were dissected from newborn mice according to method described before [
48]. Tissues in each genotyping group were pooled separately and frozen immediately on dry ice. RNA was isolated from tissue samples using RNeasy mini-columns and treated on the column with DNaseI according to manufacturer's instructions (Qiagen Inc., USA). The quality of total RNA was checked with spectrometer and gel electrophoresis.
Microarray experiment
The expression of ≈ 36,700 transcripts containing ≈ 12,423 genes and ESTs represented on the Affymetrix Mouse Genome 430 gene chips was quantified in pooled samples from
Nurr1-null homozygous and wide type mice. For each array, the RNA used was from samples pooled from 5 animals in each group. Triplicate hybridizations were performed for each sample. cDNA synthesis, cRNA labeling, hybridization and scanning were accomplished according to manufacturer's instructions (Affymetrix). The raw data were initially analyzed using Microarray Suite version 5.0 (Affymetrix), which calculates normalized expression levels and generates ratios of experimental/control signals with P values based on the 8-20 different probe pairs that represent each gene on the array. Then, data sets from comparison files were imported into excel (Microsoft) for further comparative analysis. Analysis parameters for gene filtering used by the software were set to values corresponding to high stringency (difference threshold = 100, ratio threshold = 2.0). Affymetrix NetAffx database (
http://www.NetAffx.com) was used to annotate probe sets.
Real-time PCR analysis
Oligonucleotide primers, probes, and reagents (TaqMan universal PCR Master Mix) were purchased from Applied Biosystems. Five genes were selected and verified by TaqMan real-time PCR. The genes and TaqMan probe ID were shown in Additional file
1,
Table S1. The experimental conditions were followed in accordance with the manufacturer's protocol. Amplification and detection of specific products were performed in the ABI Prism 7900 sequence detection system (Applied Biosystems), and a standard curve and Ct value were obtained.
Real-time PCR for samples from N2a cells was conducted using SYBR Green Real-time PCR Master Mix (Toyobo, Japan) and the primers are listed as follows: Nurr1; 5'-CGGCTCTATGGAGATCATCA-3' and 5'-CAATGGAATCAATCCATTCC-3', Top IIβ; 5'-GCCCAACTATGATGCTAGAG-3' and 5'- ACAGCATACTGGTTCTGACC-3', Gapdh; 5'-TGACCACAGTCCATGCCATC-3' and 5'-GACGGACACATTGGGGGTAG-3'. Samples were triplicate and each sample was performed in 3 wells.
Stable transfection and selection of Nurr1knock-down SH-SY5Y cell clones
SH-SY5Y cells were bought from Cell Resources Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. The cells were grown on poly-D-lysine (Sigma, USA) pre-coated dishes in Dulbecco's modified Eagle's medium, (DMEM, GIBCO-Invitrogen, USA) supplemented with 10% fetal bovine serum (heat-inactivated, GIBCO-Invitrogen). The siRNA target sequences are as follows: Nurr1 (5'-CCAGAGTTTGTCAAGTTTA-3') and random (5'-GTGGAGCCGAGTTTCTAAATTCCG-3'). SH-SY5Y cells were transfected with plasmids: pSUPER-Nurr1 siRNA or pSUPER-random using lipofectamine 2000 (Invitrogen, USA). Cells that have stably incorporated the GFP plasmid into their genomic DNA were selected with 600 μg/ml neomycin (Duchefa, Holland). The clones were expanded and picked on an inverted fluorescence microscope (Olympus IX81, Japan). Total proteins from each clone were collected. Clones with decreased expression of NURR1 were identified by Western blot analysis using anti-NURR1 antibody (Santa Cruz, USA).
Neurite length analysis
The total neurite length per neuron was determined and calculated as the sum of the lengths of all neurites of a single neuron. The average total neurite length per experimental condition was determined from a sample of at least 100 neurons from random fields.
N2a cell culture and transient transfection
N2a cells were bought from Cell Resources Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. The cells were grown in Dulbecco's modified Eagle's medium (DMEM, GIBCO-Invitrogen, USA) supplemented with 10% fetal bovine serum (heat-inactivated, GIBCO-Invitrogen). Cells were maintained at 37°C in an incubator containing 5% CO2. The stealth siRNA target sequences are as follows: Nurr1si#1 (5'-UAAACUGUCCGUGCGAACCACUUCU-3'), Nurr1 si#2 (5'-UCAACAAUGGAAUCAAUCCAUUCCC-3'), Nurr1 si#3 (5'-AGAAAUCGGAGCUGUAUUCUCCCG-3') (Cat. No: 152999), and a random sequence used as a negative control (Cat.No:12935300). N2a cells were transfected with stealth siRNA using lipofectamine 2000 (Invitrogen, USA).
Western blot analysis
Nucleoprotein was isolated from N2a cells (3 days after transfection) using the Proteo JET™ cytoplasmic and nuclear protein extraction kit (Thermo Fisher Scientific, USA). 50 μg of protein from each sample were loaded onto 10% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF). After being blocked for 1 hour in 5% non-fat milk, the PVDF membrane was incubated with primary antibodies overnight at 4°C. The primary antibodies are listed as follows: anti-NURR1 (Santa Cruz, USA), anti-TOP IIβ (Santa Cruz, USA), anti-LAMIN B (Santa Cruz, USA) and anti-β-ACTIN (Sigma, USA). After washing with TBST, samples were incubated with peroxidase-conjugated secondary antibody. The immunoreaction was developed using Super Signal West Dura Extended Duration Substrate (Pierce Biotechnology, USA), and the signal was quantified by measuring optical density of the bands.
Plasmids construction
The
Top IIβ promoter fragment was amplified from mouse genomic DNA using the primers:-1380/+237:5'-AAGGCCCGATGATGGACTTGGGAAAGCT-3' and 5'-ATTGGGATCGCG GATGAGGGACGAGGTT-3'. Base substitutions in the NBRE-like motifs on
Top IIβ promoter were introduced into the promoter sequence using the Muta-direct kit (Beijing SBS Genetech Co., Ltd) according to the manufacturer's instructions. The following oligo nucleotides were used in the mutagenesis procedure: NBRE1 mutant primer; 5'-GCATTGTTGGGAGGAAA
TTTCTGTAGCCAGAAAAGG-3', NBRE2 mutant primer; 5'-GTTGCTACCCGCAATGA
AATTTTCCCCTCGGGTCCCG-3' (underlined base pairs indicate the mutated bases). NBRE(C)1 primer had a consensus NBRE motif at NBRE1 position by changing T at the last position of NBRE1 to A: 5'- GCATTGTTGGGAGGAAAGGTC
AGTAGCCAGAAAAGG-3'. NBRE(C)2 primer had a consensus NBRE motif at NBRE2 position by changing G at the fifth position of NBRE2 to C: 5'-GTTGCTACCCGCAATGAC
CTTTTCCCCTCGGGTCCCG-3'. All promoter constructs were cloned into the pGL3-Basic plasmid (Promega, USA) containing the firefly luciferase gene. Mouse NURR1 over-expression vector pCI
-Nurr1 was generously donated by Sotirios Tetradis (University of California, Los Angeles). pCI-
Nurr1
R334A
has an alanine in position R334 [
17]. Dominant negative
Nurr1 contains a truncated sequence of
Nurr1 (amino acids 94-365), followed by the sequence of the repressor domain from the Drosophila Engrailed protein [
17]. To generate mouse TOP IIβ over-expression vector, total RNA from mouse midbrain at postnatal day 1 was isolated using TRIzol (Invitrogen, USA) and cDNA synthesis was carried out with reverse transcriptase (Toyobo, Japan). The full open reading frame of mouse
Top IIβ was amplified by PCR with KOD-plus polymerase (Toyobo, Japan) and the following primers: forward 5'- CTCGAGCTATGGCCAAGTCCAGCCTC -3'; reverse 5'- GTCGACTTAATTAAACATTGCA-3'. The fragment was inserted into pRFP-C1 vector from the sites: XhoI and SalI. pRFP-C1 vector is derived from pEGFP-C1 vector and has a red fluorescent protein coding sequence instead of EGFP. The TOP IIβ protein expressed by the plasmid was fused with RFP.
Luciferase assay
In preliminary experiments, SH-SY5Y cells were used to set the optimal cell density and plasmid concentration for the luciferase assay experiment. The reporter assays were performed in 24-well plates using lipofectamine 2000 reagent (Invitrogen, USA). For the promoter analysis, the plasmids pGL3-Top IIβ NBRE1mut, pGL3-Top IIβ NBRE2mut, pGL3-Top IIβ NBRE(C)1 and pGL3-Top IIβ NBRE(C)2 were transfected with NURR1 over-expression plasmid pCI-Nurr1. The renilla luciferase vector pRL-SV40 was used as an internal control. Each well was transfected with 400 ng Top IIβ promoter plasmid, 400 ng pCI-Nurr1 and 8 ng pRL-SV40. Cells were harvested 48 hours after transfection and lysed in Passive Lysis Buffer (Promega, USA). Firefly and renilla luciferase luminescence were measured using the Dual-Luciferase® Reporter Assay System (Promega, USA) according to the manufacturer's instructions. Firefly luminescence was normalized against renilla luminescence for each well, and relative values (fold induction) were calculated by setting the normalized value of the control transfection to 1. The data was performed in triplicate.
ChIP
Briefly, 106 SH-SY5Y cells grown in 10 cm cell dishes were treated with 1% formaldehyde solution for 10 min at 37°C to cross-link histones, and resuspended in lysis buffer containing 1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1, and then were sonicated to shear DNA. DNA was recovered, and histone-DNA cross-links were reversed in an aliquot, which subsequently was used in PCR reactions to evaluate the amount of DNA present in various groups. The remaining DNA-histone complexes were used in immunoprecipitation reactions utilizing 1 μg of NURR1 specific antibody (E-20, sc-990x, Santa Cruz, USA) or rabbit IgG as a control antibody (Cell Signaling Technology, USA), and a salmon sperm DNA/Protein A-agarose slurry (GE Healthcare, Sweden). Histone-DNA cross-links were reversed, and DNA was recovered and used in PCR reactions utilizing primers that bracket the proximal NBRE-like sites in the Top IIβ promoter. The sequences of the primers that encompass the proximal NBRE-like element were 5'-CTGGGTAAAGTTCTTCGG-3' and 5'-GTGCCACCAGTTAGGGA-3'; 5'-CCCGGAATGACTCTTGACA-3' and 5'-CGGCATAACACGGCACA-3'in the proximal mouse Top IIβ promoter; and against a control region 3.7 kb downstream of the transcriptional start site 5'-GACAATGCCCTCGCCTTAC-3' and 5'-GCTTTGGATTTGCCTGAA-3'.
Primary ventral MDNs cultures
Primary ventral mesencephalic (VM) neuron-enriched cultures isolated from E13.5 mouse fetuses were cultured on PDL-coated coverslips (Wanner Instruments, USA). The cells were allowed to grow in a serum-free medium with B27 (GIBCO-Invitrogen, USA). After 2 hours, ICRF-193 was added to a final concentration of 20 μM or 40 μM separately. The incubation was continued for another 24 hours for growth corn formation analysis and 5 days for neurite length measurement. Cells were fixed and stained with anti-TH antibody and Alexa Fluor 488-conjugated phalloidin for F-ACTIN staining. The neurite length and growth cone area of the immuno-reactive neurons were measured and analyzed. For electroporation, the primary VM neurons were homogenously resuspended with the transfection buffer to a final concentration of 4-5 × 106 /100 μl and mixed with 2 μg plasmid DNA of either pSUPER- Top IIβ siRNA or pSUPER-random. The siRNA target sequences are as follows: Top IIβ (5'-CAACTATGATGCTAGAGAA-3') and random (5'-GTGGAGCCGAGTTTCTAAATTCCG -3'). Electroporation was performed with an AMAXA Nucleofector instrument as per the manufacturer's protocol. The transfected neurons were then seeded to 24-well plates containing poly-D-lysine coated coverslips. After 5 days, the cells were fixed and stained with anti-TH and anti-GFP antibodies.
Immunohistochemical and immnunofluorescent staining
VM cells or tissue sections were fixed in 4% paraformaldehyde at room temperature for 30 min. For immunohistochemical staining, cells or tissue sections were treated with 0.3% H2O2 and then blocked with a pretreatment solution (PBS containing 4% horse serum and 0.3%Triton-X-100) at room temperature for 30 min, followed by incubation overnight at 4°C with TH antibody (1:500, Millipore, USA). After incubation with biotinylated secondary antibody (1:200, Vector, Burlingame, CA) at room temperature for 2 hours, the Vector ABC kit (Vector, USA) and diaminobenzydine (DAB)-H2O2 were used to visualize perspective cells. For immnunofluorescent staining, the cells were blocked in the pretreatment solution at room temperature for 30 min, followed by incubation with TH antibody (1:500, Millipore, USA), NURR1 antibody (1:100, Santa Cruz, USA) or TOP IIβ antibody (1:50, Santa Cruz, USA) overnight at 4°C, then with FITC-conjugated (1:400, Vector, USA) or TRITC-conjugated IgG (1:800, Vector, USA) at room temperature for 2 hours. Finally, the visual area was covered with a coverslip mounted with anti-fade Aqua Poly/Mount (Polysciences, USA), and then visualized and photographed using an inverted fluorescence microscope (Olympus IX81, Japan) equipped with a DP70 CCD digital camera (Olympus, Japan).
Stereotaxic injection
For administration of TOP II inhibitor ICRF-193
in vivo, male C57BL/6 mice weighting 22-26 g were anesthetized with chloral hydrate and mounted on a Benchmarker stereotaxic apparatus (myNeurolab, St. Louis, MO, USA) in a sterilized chamber. Each animal received an injection of either ICRF-193 of different concentrations (Biomol, USA) in 2 μl vehicle (0.1% dimethyl sulfoxide, DMSO) or vehicle alone as a control into the right medial forebrain bundle (MFB) at a flow rate of 1 μl/min (AP -1.3 mm, ML ± 1.1 mm DV -5.25 mm from Bregma) [
49].
In order to study the influence on nigra-striatum pathway formation of ICRF-193 injection, Fluorogold (Fluorochrome, USA) was used as a retrograde tracer. Two weeks after ICRF-193 or vehicle injection, each animal received an injection of 0.2 μl Fluorogold (AP 0.8 mm, ML ± 2 mm DV -3 mm from Bregma) [
49].
Biochemical analysis of catecholamines
The whole right striatum was dissected and homogenized (10%wt/vol) by sonication in ice-cold 0.2 M perchloric acid with 3, 4-dihydroxybenzylamine (DHBA) as internal standard. Homogenate was centrifuged at 20,000 g for 15 min at 4°C and the supernatant was collected. The levels of DA, 3, 4-dihydroxyphenylacetic acid (DOPAC) and 5-hydroxyindolacetic acid (5-HIAA) were determined by high-pressure liquid chromatography (HPLC; EPC-300, Eicom, Japan) equipped with a column of 5 μm spherical C18 particles and detected with an electrochemical detector. The mobile phase (previously filtered and degassed) consisted of 0.042 M citric acid monohydrate, 0.038 M sodium acetate trihydrate, 0.94 mM sodium octane sulfonate and 0.013 mM EDTA-2Na (pH 3.8).
Statistics
Statistical significance between groups was assessed by t-tests using GraphPad Prism (GraphPad Software, Inc., San Diego, CA). A P-value < 0.05 was considered significant.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
XH carried out the molecular genetic studies, cell culture, stereotaxic injection, immunohistochemistry and drafted the manuscript. GJ conceived and designed the microarray experiments and provided intellectual input. XZ conceived of the study, and participated in its design and coordination and helped to draft the manuscript. DHY participated in the design of the study and performed the statistic analysis. MZZ and SJF carried out the microarray experiments and performed the data analysis. XPL carried out the TH staining of Top IIβ null mice and participated in the design of the study. WDL conceived and designed the experiments and provided intellectual input. All authors read and approved the final manuscript.