Skip to main content
Erschienen in: BMC Musculoskeletal Disorders 1/2014

Open Access 01.12.2014 | Research article

Osteogenic differentiation of amniotic epithelial cells: synergism of pulsed electromagnetic field and biochemical stimuli

verfasst von: Qian Wang, Wenchao Wu, Xiaoyu Han, Ai Zheng, Song Lei, Jiang Wu, Huaiqing Chen, Chengqi He, Fengming Luo, Xiaojing Liu

Erschienen in: BMC Musculoskeletal Disorders | Ausgabe 1/2014

Abstract

Background

Pulsed electromagnetic field (PEMF) is a non-invasive physical therapy used in the treatment of fracture nonunion or delayed healing. PEMF can facilitate the osteogenic differentiation of bone marrow mesenchymal stem cells in vitro. Amniotic epithelial cells (AECs) have been proposed as a potential source of stem cells for cell therapy. However, whether PEMF could modulate the osteogenic differentiation of AECs is unknown. In the present study, the effects of PEMF on the osteogenic differentiation of AECs were investigated.

Methods

AECs were isolated from amniotic membrane of human placenta by trypsin digestion and were induced by PEMF and/or osteo-induction medium. After 21 days we used real time RT-PCR and immunocytochemistry to study the expression of osteoblast markers. The signal transduction of osteogenesis was further investigated.

Results

The PEMF stimulation, or osteo-induction medium alone could induce osteogenic differentiation of AECs, as shown by expression of osteoblast specific genes and proteins including alkaline phosphatase and osteocalcin. Furthermore, a combination of PEMF and osteo-induction medium had synergy effects on osteogenic differentiation. In our study, the gene expression of BMP-2, Runx2, β-catenin, Nrf2, Keap1 and integrinβ1 were up-regulated in the osteogenic differentiation of AECs induced by PEMF and/or osteo-induction medium.

Conclusions

Combined application of PEMF and osteo-induction medium is synergistic for the osteogenic differentiation of AECs. It might be a novel approach in the bone regenerative medicine.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1471-2474-15-271) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

QW designed and carried out the experiments and performed statistical analysis and drafted the manuscript. Wc W designed the experiments and responsible for AEC cell isolation and culture; XY H worked on cell culture; A Z provided study material; J W and HQ C conception and design; S L worked on the transmission electron microscopy. CQ H conceived of the study. FM L participated in the design and coordination. XJ L conceived of the study, provided expert advice, interpretation of the study's results and prepared the manuscript. All authors read and approved the final manuscript.

Background

Amniotic epithelial cells (AECs), derived from the placenta, possess several advantages over both embryonic stem cells (ESCs) and adult stem cells. They express ESCs markers such as SSEA-1, SSEA-4 and Oct-4, and have the ability to differentiate into all three germ layers in vitro[1, 2]. Therefore, AECs have been proposed to be a good candidate for cell transplantation and regenerative medicine [3, 4].
AECs can be induced to differentiate into osteoblasts in vitro by treating with osteo-induction medium, which contains biochemical factors including dexamethasone, β-glycerol phosphate and ascorbic acid [5]. However, efficient induction of AECs differentiation into osteoblasts remains a challenge, and its mechanism is not fully understood.
Pulsed electromagnetic field (PEMF), a non-invasive physical treatment, is now used clinically to promote bone healing for fracture nonunion or delayed fracture healing [6, 7]. PEMF has various biological functions and can affect bone metabolism. Several studies have shown that PEMF can facilitate the osteogenesis by its direct effects on osteoblasts [8, 9]. Recently, it has been reported that PEMF with specific parameters could modulate osteogenic differentiation of bone marrow derived mesenchymal stem cells (BMMSCs) in vitro[1012]. These findings suggest that PEMF might be able to induce AECs to differentiate into osteoblasts.
In this study, we tested the hypothesis that PEMF could modulate the osteogenic differentiation of AECs. We hypothesized that physical force (PEMF) and biochemical treatment and/or their combination might play important roles in the process of osteogenic differentiation of AECs. We explored the possible mechanisms, especially the regulating role of BMP-2 and ROS pathways in the process.

Methods

AECs isolation, culture and identification

Five placenta samples through cesarean delivery were collected aseptically with the informed consents of parturients. Primary cultures of human AECs were isolated from amniotic membrane by trypsin digestion method and cultured in standard culture medium, according to Miki’s methods [1]. AECs were identified by the specific epithelial cell marker cytokerin 19 using immunocytochemistry. Phenotype of human AECs was analyzed by flow cytometry.
The study was conducted according to the Declaration of Helsinki and approved by the medical ethics committee of the West China Hospital, Sichuan University.

PEMF stimulation

PEMF was generated by a commercial, clinically approved PEMF system (Model XT-2000B). During each pulse, the applied field increased from 0 to 1mT in 1.5 ms and then decayed back to 0 in 5 ms. The 50Hz repetitive pulsed waveform was based on other previous investigations [13, 14]. AECs from the third to fifth passages were maintained in standard culture medium as controls or in osteo-induction medium (OM) [5]. For PEMF treatment, the cells were exposed daily to 50Hz 1mT PEMF stimulation for 30 minutes each time and twice a day, with an interval of 12 hours. The treatment lasted for 21 days. Each experiment was in three replicates.

Detection of alkaline phosphatase (ALP) activity by histochemistry staining

The activity of ALP was detected by histochemistry staining using a BCIP/NBT ALP kit (R&D Biotech, UK) according to manufacturer’s instructions [15]. The percentage of ALP-positive cells was calculated by ImageJ software (National Institutes of Health, USA).

Detection of osteocalcin (OC) protein expression by immunocytochemistry

AECs were plated onto coverslips in 6-well plates and treated with different stimuli. The protein expression of OC was measured by immunocytochemistry as described before [16] Images were captured on a Leica DFC 300FX Digital Camera system (Leica, UK) and analyzed with the ImageJ software to semi-quantitatively determine the level of cytoplasmic OC.

Assessment of calcium deposition by alizarin red staining

Calcium deposition, one of the markers of osteogenic differentiation of stem cell, was assessed by alizarin red S staining [17]. Images were captured on a Leica DFC 300FX Digital Camera system (Leica, UK). The amount of calcified deposition was semi-quantitatively calculated with ImageJ software.

Quantitative reverse transcription PCR (Real-time RT-PCR)

Total RNA was extracted from AECs with TRIZOL (Invitrogen, USA), and cDNA was synthesized using a reverse transcription (RT) kit (Toyobo, Osaka, Japan) [16]. Quantitative PCR was carried out on BIO-RAD CFX96™ Real-Time PCR Detection System with fluorescence dye EvaGreen (EvaGreen Supermix kit, Bio-Rad, USA). Primer sequences are shown in Table 1. Data analysis was carried out by Bio-Rad software using relative quantification. The comparative cycle-threshold method (2-△△CT) was used for quantification of gene expression [17]. For quantification, the target sequence was normalized to the β-actin mRNA levels.
Table 1
Primer sequences and amplicon sizes for real-time RT-PCR
Genes
Gene Bank ID
Primer Sequence (5'-3')
Amplicon (bp)
ALP
NM_000478
F: 5' GGAACTCCTGACCCTTGACC 3'
86
R: 5' TCCTGTTCAGCTCGTACTGC 3'
OC
NM_001199662
F:5' AGGGCAGCGAGGTAGTGAA 3'
151
R: 5' TCCTGAAAGCCGATGTGGT 3'
BMP-2
NM_001200
F:5' TCAAGCCAAACACAAACAGC 3'
103
R: 5' AGCCACAATCCAGTCATTCC 3'
RUNX2
NM_001015051
F:5' TTACTTACACCCCGCCAGTC 3'
139
R: 5' TATGGAGTGCTGCTGGTCTG 3'
β-catenin
NM_020248
F:5' CCTATGCAGGGGTGGTCAAC 3'
95
R: 5' CGACCTGGAAAACGCCATCA 3'
Integrinβ1
NM_002211
F:5' CAAGCAGGGCCAAATTGTGG 3'
121
R: 5' TGTCATCTGGAGGGCAACCC 3'
Nrf2
NM_001145413
F:5' ATTGCCTGTAAGTCCTGGTCA 3'
182
R: 5' ACTGCTCTTTGGACATCATTTCG 3'
Keap1
NM_203500
F:5' GTGGCTGTCCTCAATCGTCT 3'
127
R: 5' GGATGGTGTTCATTGCTGTG 3'
β-actin
NM_001099771
F:5' ACTATCGGCAATGAGCGGTTC 3'
77
R: 5' ATGCCACAGGATTCCATACCC 3'

Statistical analysis

The experimental data were presented as means ± SD. Group means were compared by One-way ANOVA using the statistical software SPSS 10.0 for Windows (Chicago, IL, USA), and P value < 0.05 was considered to be statistically significant.

Results

Characterization and phenotype of isolated AECs

Amniotic epithelial cells (AECs) were successfully isolated from human placenta and formed a confluent monolayer of cobblestone-shaped epithelial cells after 3 days of culturing in the standard culture media (Figure 1A).
In our study, flow cytometry analysis revealed that 54.2% of primary cultured AECs were positive for SSEA-4 and 92.8% were positive for Oct-4 (Figure 1B). Furthermore, the AECs could also express cytokeratin 19, the epithelial cell marker (Figure 1C). Consistent with previous reports [2, 5], we provided further evidence that AECs expressed not only the epithelial cell marker cytokeratin 19, but also the stem cell markers such as SSEA-4 and Oct-4.

PEMF modulates the osteogenic differentiation of AECs

In order to examine whether PEMF could play a role in osteogenic differentiation of AECs, we used real time RT-PCR and immunocytochemistry to study the expression of osteoblast markers, such as alkaline phosphatase (ALP) and osteocalcin (OC) in AECs followed by (1) standard culture media (control group), (2) administration of PEMF for AECs cultured in standard culture media (PEMF only), (3) osteo-induction medium (OM only), (4) combined treatments with PEMF and osteo-induction medium for various time points (up to 21 days).Real time RT-PCR results showed that application of PEMF alone increased the gene expression of ALP and OC above basal levels after 7 days of treatment. The osteo-induction medium alone induced the gene expression of ALP and OC at day 3 post-treatment. The combined induction of ALP and OC mRNA expression were both peaked at day 11, and the elevated level lasted up to day 21 after the combined treatments (Figure 2).Next, we examined the administration of PEMF and/or OM-induced change of ALP and OC protein level in AECs. Exposure of AECs to PEMF alone induced the ALP activity at day 7. Culture of AECs in osteo-induction medium increased the ALP activity, which reached the highest level at day 11, and the increased level lasted up to day 21 post-treatment. Moreover, combined application of PEMF and osteo-induction medium resulted in a much higher level of ALP activity compared with other groups (Figure 3). The expression of OC protein was analyzed by immunocytochemistry, which showed that AECs after combined stimulation of PEMF and osteo-induction medium presented a much stronger OC protein expression, than what either treatment alone (Figure 4).
The osteogenic differentiation of AECs was also validated by detection of the calcium deposits [17]. Alizarin red S staining results showed that, application of PEMF alone increased calcium deposits in AECs as early as day 7 after treatment. The osteo-induction medium also evoked a marked increase of extracellular matrix calcification in AECs. Furthermore, a combination of PEMF with osteo-induction medium induced much more calcium deposition in AECs than the other treatments, and the effect was peaked at day 11 (Figure 5).
Taken together, we demonstrated that a combination of PEMF and osteo-induction medium had much stronger effects on osteogenic differentiation of AECs, than what either treatment alone had.

PEMF might modulate the osteogenic differentiation of AECs via BMP-2/Runx2 or Wnt/β-catenin signaling

To investigate the possible role of BMP-2/Runx2 or Wnt/β-catenin signaling in osteoblast differentiation of AECs, we assessed the expression change of BMP-2, Runx2 and β-catenin mRNA in AECs with different treatments. Exposure of PEMF alone induced the expression of BMP-2, Runx2 and β-catenin above basal levels after 7 days of treatment. Osteo-induction medium alone promoted the expression of BMP-2, Runx2 and β-catenin, followed by a gradual decrease after treatment. Moreover, combined application of PEMF with osteo-induction medium led to a significant up-regulation in the expression of BMP-2, Runx2 and β-catenin compared with other treatments (Figure 6A-C).

Nrf2 and Keap1 might be involved in the PEMF-induced osteogenic differentiation of AECs

Reactive oxygen species (ROS) could play vital role in the self-renewal and differentiation of stem cells [18, 19]. To test whether Nrf2 and Keap1, the master regulators of ROS generation, might be implicated in the osteogenic differentiation of AECs, we examined the gene expression of Nrf2 and Keap1. PEMF treatment alone significantly induced the expression of Nrf2 at day 7. Combined use of PEMF and osteo-induction medium evoked a significant up-regulation of Nrf2 mRNA expression compared with other treatments (Figure 2F). Furthermore, the gene expression profile of Keap1 was similar to that of Nrf2 during the osteogenic induction of AECs (Figure 6D,E).

Integrinβ1 may be the PEMF sensitive receptor in the process of osteogenic differentiation of AECs

Integrinβ1 is a well-known mechanoreceptor in mediating the transduction of mechanical strain in most cells [20]. We therefore investigated whether integrinβ1 might also act as the PEMF-sensitive receptor in the osteogenic induction of AECs. Real-time RT-PCR results showed that, PEMF alone induced the significant up-regulation of gene expression of integrinβ1 in AECs at day 7. Moreover, treatments with PEMF and osteo-induction medium together evoked a significant up-regulation of integrinβ1 mRNA expression in comparison to the other treatments (Figure 6F). These results suggest that, integrinβ1 appears to be one of the PEMF or biochemical sensitive receptor mediated in the osteogenic differentiation of AECs.

Discussion

In the present study, the combined effects of physical treatment (PEMF) and biochemical stimuli (osteo-induction medium) on the osteogenic differentiation of AECs were investigated. The major findings of this study are: (1) Combined application of PEMF and osteo-induction medium to AECs has stronger effects on osteogenic differentiation, than either treatment alone; (2) Activation of signaling pathways, such as BMP-2 and Wnt/β-catenin, might be important in mediating the PEMF and/or osteo-induction medium-induced osteogenic differentiation of AECs; (3) Nrf2/Keap1, master regulators of ROS, might be implicated in the PEMF and/or osteo-induction medium-induced osteogenic differentiation of AECs; (4) The expression of integrinβ1 mRNA was up-regulated in the process of osteogenic differentiation of AECs induced by PEMF and/or osteo-induction medium. Our data indicate that PEMF could play an important role in the modulation of osteogenic differentiation of AECs. These observations also establish possible links of integrinβ1 and Nrf2/Keap1 in mediating PEMF and/or osteo-induction medium-induced osteogenic differentiation of AECs.
PEMF could interfere with cellular growth, proliferation and differentiation, as recently demonstrated in osteoblasts [9]. PEMF is also capable of regulating Ca2+ homeostasis and promoting fracture healing [21]. There have been several studies to demonstrate the inductive effect of PEMF in the osteoblast differentiation of MSCs [11, 12, 14, 22, 23]. Tsai et al. reported that PEMF could induce early onset of osteogenic differentiation of MSCs on the basis of ALP activity and stimulate the gene expression of ALP and Runx-2 at day 7 but lower at day 10 in the process of osteogenic induction [22]. The similar results were reported by Sun et al. who found that exposure to PEMF significantly increased ALP gene expression during the early stages of osteogenesis and enhanced mineralization near the midpoint of osteogenesis [12]. Additionally, Song et al. revealed that PEMF could up-regulate the gene expression of Runx-2, bone sialoprotein (BSP) and osteopontin (OPN); enhance the alkaline phosphatase activity and calcium deposition in a time-dependent manner. Furthermore, MEK/ERK signaling pathway might be mediated in this process of osteogenic differences of MSCs [11].
The present study showed that PEMF stimulation alone could induce the expression of osteoblast markers ALP and OC at both gene and protein levels at specific time point(day 7). The osteo-induction medium was also able to induce the osteogenesis of AECs as reported in the previous literature [5]. Moreover, combined application of PEMF and osteo-induction medium led to significant up-regulation of ALP and OC expression and promoted the obvious extracellular matrix calcification. Our findings demonstrated the synergistic effects of physical (PEMF) and biochemical stimuli (OM) on the osteogenic induction of AECs. The effect of PEMF on the osteoblast differentiation of AECs may depend on the specific parameters of PEMF, such as waveform, duration, frequency and magnetic flux, as well as different cell types [22, 24]. This may be the reason why the effects of PEMF alone on the stimulation of osteogenic differentiation of AECs were found most obvious at day 7. Therefore, further studies are necessary to determine the optical parameters of PEMF in the osteogenic differentiation of AECs.
Among the intracellular signals involved in PEMF actions, the activation of bone morphogenetic proteins (BMPs) plays important roles. Runx2, as a downstream regulator of BMP-2 signaling, is necessary for osteoblast differentiation [25]. Wnt/β-catenin signaling is also of crucial importance for MSCs osteogensis [26]. Our results showed that the gene expression of BMP-2, Runx2 and β-catenin were all up-regulated in the osteogenic differentiation of AECs induced by PEMF alone at the specific time point (day 7). Osteo-induction medium alone or combined with PEMF exposure could induce BMP-2, Runx2 and β-catenin gene expression especially at the early stage of osteogenic induction (day 3). Additionally, similar gene expression profiles of BMP2, Runx2 and β-catenin were observed. These results may be due to the fact that both BMP-2/Runx2 and Wnt/β-catenin signaling could play important role in activating the osteogenic induction of AECs at the early-stage, while down-regulation of these signals are required for the late-stage of osteogenesis and matrix mineralization [26, 27]. Therefore, the present observations showed that PEMF and/or osteo-induction medium-induced the osteogenic differentiation of AECs may be via activation of both BMP-2 and Wnt/β-catenin signaling.
Another pathway implicated in the PEMF action is the generation of reactive oxygen species (ROS) [28, 29]. Recent study showed that Nrf2/Keap1, master regulator of ROS generation, would be required for intestinal stem cells (ISCs) proliferation [19]. In our study, the induction expression of Nrf2 and Keap1 were observed in the treatment of PEMF and/or osteo-induction medium, and the gene expression of Nrf2 and Keap1 exhibited similar profiles during the osteogenesis of AECs. As key regulators of ROS generation, Nrf2/Keap1 might be of potential importance during osteogenic differentiation of AECs induced by PEMF and/or the osteo-induction medium.
The mechanism involving how the cells sense and transduce physical stimulation such as PEMF into biochemical signals has remained elusive. Integrins function as one of the mechanoreceptors, which are capable of switching mechanical strain to biochemical signals [20, 30]. This process is comprised of binding to the extracellular matrix (ECM) ligands and activating the specific signaling pathways which would be involved in the mechanical-induced differentiation of cells [31]. Kasten et al. reported that certain biological functions of MSCs would be performed under the circumstance of integrin-mediated mechanical forces [32]. Franceschi et al. found that the application of mechanical force to osteoblasts could activate the MAPK signaling through integrin α2 and β1 [33]. However, little is known about the role of integrins in the differentiation of AECs. The current study showed that, integrinβ1 gene expression was up-regulated in the PEMF and/or osteo-induction medium-induced osteogenic differentiation of AECs. We propose that integrinβ1 might act as a receptor, which can be inducible in response to the physical stimulation, especially to the PEMF.
Our preliminary study demonstrates the role of BMP-2, Wnt/β-catenin, Nrf2/Keap1 and integrinβ1 in the osteogenic differentiation of AECs, only from the perspective of gene expression. Even though these molecules/pathways may be critical in mediating PEMF/osteo-induction medium enabled osteogenic differentiation, it is difficult to reveal the exact mechanisms without further testing, such as pathway-specific approaches. Therefore, additional experiments are needed to explore the mechanisms on how these signalings, ROS and integrinβ1 play role in regulating the PEMF-induced osteogenic differentiation of AECs.

Conclusions

The present study demonstrates that combined use of physical (PEMF) and biochemical stimuli (osteo-induction medium) is synergistic for the osteogenic differentiation of AECs, which might be a novel approach in bone regenerative medicine. BMP-2/Runx2, Wnt/β-catenin, ROS and integrin signalings might be involved in the osteogenic differentiation of AECs induced by PEMF and/or osteo-induction medium.

Acknowledgments

This work was supported by grants from the National Natural Science Foundation of China, No. 30470437, 30870596 and 11072163 (XIAOJING LIU), No.81171865 (CHENGQI HE), No. 30971325(FENGMING LUO). The PEMF system was support by the Department of Rehabilitation Medicine, West China Hospital, Sichuan University. We would like to acknowledge the assistance and critical advice provided by Dr. Jue Lin (University of California, San Francisco) and Dr. Rui Lin (Medimmune Inc.) in the preparation of this manuscript.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
The Creative Commons Public Domain Dedication waiver (https://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

QW designed and carried out the experiments and performed statistical analysis and drafted the manuscript. Wc W designed the experiments and responsible for AEC cell isolation and culture; XY H worked on cell culture; A Z provided study material; J W and HQ C conception and design; S L worked on the transmission electron microscopy. CQ H conceived of the study. FM L participated in the design and coordination. XJ L conceived of the study, provided expert advice, interpretation of the study's results and prepared the manuscript. All authors read and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Miki T, Marongiu F, Ellis E: Isolation of amniotic epithelial stem cells. Curr Protoc Stem Cell Biol. 2007, 12: 1-9. Miki T, Marongiu F, Ellis E: Isolation of amniotic epithelial stem cells. Curr Protoc Stem Cell Biol. 2007, 12: 1-9.
2.
Zurück zum Zitat Miki T, Mitamura K, Ross MA, Stolz DB, Strom SC: Identification of stem cell marker-positive cells by immunofluorescence in term human amnion. J Reprod Immunol. 2007, 75 (2): 91-96. 10.1016/j.jri.2007.03.017.CrossRefPubMed Miki T, Mitamura K, Ross MA, Stolz DB, Strom SC: Identification of stem cell marker-positive cells by immunofluorescence in term human amnion. J Reprod Immunol. 2007, 75 (2): 91-96. 10.1016/j.jri.2007.03.017.CrossRefPubMed
3.
Zurück zum Zitat Carbone A, Paracchini V, Castellani S, Di Gioia S, Seia M, Colombo C, Conese M: Human Amnion-Derived Cells: Prospects for the Treatment of Lung Diseases. Curr Stem Cell Res Ther. 2014, 9 (4): 297-305. 10.2174/1574888X0904140429142451.CrossRefPubMed Carbone A, Paracchini V, Castellani S, Di Gioia S, Seia M, Colombo C, Conese M: Human Amnion-Derived Cells: Prospects for the Treatment of Lung Diseases. Curr Stem Cell Res Ther. 2014, 9 (4): 297-305. 10.2174/1574888X0904140429142451.CrossRefPubMed
4.
Zurück zum Zitat Barboni B, Mangano C, Valbonetti L, Marruchella G, Berardinelli P, Martelli A, Muttini A, Mauro A, Bedini R, Turriani M: Synthetic bone substitute engineered with amniotic epithelial cells enhances bone regeneration after maxillary sinus augmentation. PLoS One. 2013, 8 (5): e63256-10.1371/journal.pone.0063256.CrossRefPubMedPubMedCentral Barboni B, Mangano C, Valbonetti L, Marruchella G, Berardinelli P, Martelli A, Muttini A, Mauro A, Bedini R, Turriani M: Synthetic bone substitute engineered with amniotic epithelial cells enhances bone regeneration after maxillary sinus augmentation. PLoS One. 2013, 8 (5): e63256-10.1371/journal.pone.0063256.CrossRefPubMedPubMedCentral
5.
Zurück zum Zitat Parolini O, Alviano F, Bagnara GP, Bilic G, Buhring HJ, Evangelista M, Hennerbichler S, Liu B, Magatti M, Mao N: Concise review: isolation and characterization of cells from human term placenta: outcome of the first international Workshop on Placenta Derived Stem Cells. Stem Cells. 2008, 26 (2): 300-311. 10.1634/stemcells.2007-0594.CrossRefPubMed Parolini O, Alviano F, Bagnara GP, Bilic G, Buhring HJ, Evangelista M, Hennerbichler S, Liu B, Magatti M, Mao N: Concise review: isolation and characterization of cells from human term placenta: outcome of the first international Workshop on Placenta Derived Stem Cells. Stem Cells. 2008, 26 (2): 300-311. 10.1634/stemcells.2007-0594.CrossRefPubMed
6.
Zurück zum Zitat H-f S, Xiong J, Chen Y-x, Wang J-f, Qiu X-s, Wang Y-h, Qiu Y: Early application of pulsed electromagnetic field in the treatment of postoperative delayed union of long-bone fractures: a prospective randomized controlled study. BMC Musculoskelet Disord. 2013, 14 (1): 35-10.1186/1471-2474-14-35.CrossRef H-f S, Xiong J, Chen Y-x, Wang J-f, Qiu X-s, Wang Y-h, Qiu Y: Early application of pulsed electromagnetic field in the treatment of postoperative delayed union of long-bone fractures: a prospective randomized controlled study. BMC Musculoskelet Disord. 2013, 14 (1): 35-10.1186/1471-2474-14-35.CrossRef
7.
Zurück zum Zitat Assiotis A, Sachinis NP, Chalidis BE: Pulsed electromagnetic fields for the treatment of tibial delayed unions and nonunions. A prospective clinical study and review of the literature. J Orthop Surg Res. 2012, 7 (1): 1-6. 10.1186/1749-799X-7-1.CrossRef Assiotis A, Sachinis NP, Chalidis BE: Pulsed electromagnetic fields for the treatment of tibial delayed unions and nonunions. A prospective clinical study and review of the literature. J Orthop Surg Res. 2012, 7 (1): 1-6. 10.1186/1749-799X-7-1.CrossRef
8.
Zurück zum Zitat Vincenzi F, Targa M, Corciulo C, Gessi S, Merighi S, Setti S, Cadossi R, Goldring MB, Borea PA, Varani K: Pulsed electromagnetic fields increased the anti-inflammatory effect of A2A and A3 adenosine receptors in human T/C-28a2 chondrocytes and hFOB 1.19 osteoblasts. PLoS One. 2013, 8 (5): e65561-10.1371/journal.pone.0065561.CrossRefPubMedPubMedCentral Vincenzi F, Targa M, Corciulo C, Gessi S, Merighi S, Setti S, Cadossi R, Goldring MB, Borea PA, Varani K: Pulsed electromagnetic fields increased the anti-inflammatory effect of A2A and A3 adenosine receptors in human T/C-28a2 chondrocytes and hFOB 1.19 osteoblasts. PLoS One. 2013, 8 (5): e65561-10.1371/journal.pone.0065561.CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Barnaba S, Papalia R, Ruzzini L, Sgambato A, Maffulli N, Denaro V: Effect of pulsed electromagnetic fields on human osteoblast cultures. Physiother Res Int. 2013, 18 (2): 109-114. 10.1002/pri.1536.CrossRefPubMed Barnaba S, Papalia R, Ruzzini L, Sgambato A, Maffulli N, Denaro V: Effect of pulsed electromagnetic fields on human osteoblast cultures. Physiother Res Int. 2013, 18 (2): 109-114. 10.1002/pri.1536.CrossRefPubMed
10.
Zurück zum Zitat Ceccarelli G, Bloise N, Mantelli M, Gastaldi G, Fassina L, Cusella De Angelis MG, Ferrari D, Imbriani M, Visai L: A Comparative analysis of the in vitro effects of pulsed electromagnetic field treatment on osteogenic differentiation of two different mesenchymal cell lineages. Bio Res Open Access. 2013, 2 (4): 283-294. 10.1089/biores.2013.0016.CrossRef Ceccarelli G, Bloise N, Mantelli M, Gastaldi G, Fassina L, Cusella De Angelis MG, Ferrari D, Imbriani M, Visai L: A Comparative analysis of the in vitro effects of pulsed electromagnetic field treatment on osteogenic differentiation of two different mesenchymal cell lineages. Bio Res Open Access. 2013, 2 (4): 283-294. 10.1089/biores.2013.0016.CrossRef
11.
Zurück zum Zitat Song M-Y, Yu J-Z, Zhao D-M, Wei S, Liu Y, Hu Y-M, Zhao W-C, Yang Y, Wu H: The time-dependent manner of sinusoidal electromagnetic fields on rat bone marrow mesenchymal stem cells proliferation, differentiation, and mineralization. Cell Biochem Biophys. 2014, 69 (1): 47-54. 10.1007/s12013-013-9764-8.CrossRefPubMed Song M-Y, Yu J-Z, Zhao D-M, Wei S, Liu Y, Hu Y-M, Zhao W-C, Yang Y, Wu H: The time-dependent manner of sinusoidal electromagnetic fields on rat bone marrow mesenchymal stem cells proliferation, differentiation, and mineralization. Cell Biochem Biophys. 2014, 69 (1): 47-54. 10.1007/s12013-013-9764-8.CrossRefPubMed
12.
Zurück zum Zitat Sun LY, Hsieh DK, Lin PC, Chiu HT, Chiou TW: Pulsed electromagnetic fields accelerate proliferation and osteogenic gene expression in human bone marrow mesenchymal stem cells during osteogenic differentiation. Bioelectromagnetics. 2010, 31 (3): 209-219.PubMed Sun LY, Hsieh DK, Lin PC, Chiu HT, Chiou TW: Pulsed electromagnetic fields accelerate proliferation and osteogenic gene expression in human bone marrow mesenchymal stem cells during osteogenic differentiation. Bioelectromagnetics. 2010, 31 (3): 209-219.PubMed
13.
Zurück zum Zitat Bai W-f, Xu W-c, Feng Y, Huang H, Li X-p, Deng C-y, Zhang M-s: Fifty-Hertz electromagnetic fields facilitate the induction of rat bone mesenchymal stromal cells to differentiate into functional neurons. Cytotherapy. 2013, 15 (8): 961-970. 10.1016/j.jcyt.2013.03.001.CrossRefPubMed Bai W-f, Xu W-c, Feng Y, Huang H, Li X-p, Deng C-y, Zhang M-s: Fifty-Hertz electromagnetic fields facilitate the induction of rat bone mesenchymal stromal cells to differentiate into functional neurons. Cytotherapy. 2013, 15 (8): 961-970. 10.1016/j.jcyt.2013.03.001.CrossRefPubMed
14.
Zurück zum Zitat Zhong C, Zhang X, Xu Z, He R: Effects of low-intensity electromagnetic fields on the proliferation and differentiation of cultured mouse bone marrow stromal cells. Phys Ther. 2012, 92 (9): 1208-1219. 10.2522/ptj.20110224.CrossRefPubMed Zhong C, Zhang X, Xu Z, He R: Effects of low-intensity electromagnetic fields on the proliferation and differentiation of cultured mouse bone marrow stromal cells. Phys Ther. 2012, 92 (9): 1208-1219. 10.2522/ptj.20110224.CrossRefPubMed
15.
Zurück zum Zitat Yang F, Yang D, Tu J, Zheng Q, Cai L, Wang L: Strontium enhances osteogenic differentiation of mesenchymal stem cells and in vivo bone formation by activating wnt/catenin signaling. Stem Cells. 2011, 29 (6): 981-991. 10.1002/stem.646.CrossRefPubMed Yang F, Yang D, Tu J, Zheng Q, Cai L, Wang L: Strontium enhances osteogenic differentiation of mesenchymal stem cells and in vivo bone formation by activating wnt/catenin signaling. Stem Cells. 2011, 29 (6): 981-991. 10.1002/stem.646.CrossRefPubMed
16.
Zurück zum Zitat Pan P, Fu H, Zhang L, Huang H, Luo F, Wu W, Guo Y, Liu X: Angiotensin II upregulates the expression of placental growth factor in human vascular endothelial cells and smooth muscle cells. BMC Cell Biol. 2010, 11 (1): 36-44. 10.1186/1471-2121-11-36.CrossRefPubMedPubMedCentral Pan P, Fu H, Zhang L, Huang H, Luo F, Wu W, Guo Y, Liu X: Angiotensin II upregulates the expression of placental growth factor in human vascular endothelial cells and smooth muscle cells. BMC Cell Biol. 2010, 11 (1): 36-44. 10.1186/1471-2121-11-36.CrossRefPubMedPubMedCentral
17.
Zurück zum Zitat Dalby MJ, Gadegaard N, Tare R, Andar A, Riehle MO, Herzyk P, Wilkinson CDW, Oreffo ROC: The control of human mesenchymal cell differentiation using nanoscale symmetry and disorder. Nat Mater. 2007, 6 (12): 997-1003. 10.1038/nmat2013.CrossRefPubMed Dalby MJ, Gadegaard N, Tare R, Andar A, Riehle MO, Herzyk P, Wilkinson CDW, Oreffo ROC: The control of human mesenchymal cell differentiation using nanoscale symmetry and disorder. Nat Mater. 2007, 6 (12): 997-1003. 10.1038/nmat2013.CrossRefPubMed
18.
Zurück zum Zitat Yanes O, Clark J, Wong DM, Patti GJ, Sanchez-Ruiz A, Benton HP, Trauger SA, Desponts C, Ding S, Siuzdak G: Metabolic oxidation regulates embryonic stem cell differentiation. Nat Chem Biol. 2010, 6 (6): 411-417. 10.1038/nchembio.364.CrossRefPubMedPubMedCentral Yanes O, Clark J, Wong DM, Patti GJ, Sanchez-Ruiz A, Benton HP, Trauger SA, Desponts C, Ding S, Siuzdak G: Metabolic oxidation regulates embryonic stem cell differentiation. Nat Chem Biol. 2010, 6 (6): 411-417. 10.1038/nchembio.364.CrossRefPubMedPubMedCentral
19.
Zurück zum Zitat Hochmuth CE, Biteau B, Bohmann D, Jasper H: Redox regulation by Keap1 and Nrf2 controls intestinal stem cell proliferation in Drosophila. Cell Stem Cell. 2011, 8 (2): 188-199. 10.1016/j.stem.2010.12.006.CrossRefPubMedPubMedCentral Hochmuth CE, Biteau B, Bohmann D, Jasper H: Redox regulation by Keap1 and Nrf2 controls intestinal stem cell proliferation in Drosophila. Cell Stem Cell. 2011, 8 (2): 188-199. 10.1016/j.stem.2010.12.006.CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Puklin-Faucher E, Sheetz MP: The mechanical integrin cycle. J Cell Sci. 2009, 122 (2): 179-186. 10.1242/jcs.042127.CrossRefPubMed Puklin-Faucher E, Sheetz MP: The mechanical integrin cycle. J Cell Sci. 2009, 122 (2): 179-186. 10.1242/jcs.042127.CrossRefPubMed
21.
Zurück zum Zitat Ibiwoye MO, Powell KA, Grabiner MD, Patterson TE, Sakai Y, Zborowski M, Wolfman A, Midura RJ: Bone mass is preserved in a critical-sized osteotomy by low energy pulsed electromagnetic fields as quantitated by in vivo micro-computed tomography. J Orthop Res. 2004, 22 (5): 1086-1093. 10.1016/j.orthres.2003.12.017.CrossRefPubMed Ibiwoye MO, Powell KA, Grabiner MD, Patterson TE, Sakai Y, Zborowski M, Wolfman A, Midura RJ: Bone mass is preserved in a critical-sized osteotomy by low energy pulsed electromagnetic fields as quantitated by in vivo micro-computed tomography. J Orthop Res. 2004, 22 (5): 1086-1093. 10.1016/j.orthres.2003.12.017.CrossRefPubMed
22.
Zurück zum Zitat Tsai MT, Li WJ, Tuan RS, Chang WH: Modulation of osteogenesis in human mesenchymal stem cells by specific pulsed electromagnetic field stimulation. J Orthop Res. 2009, 27 (9): 1169-1174. 10.1002/jor.20862.CrossRefPubMedPubMedCentral Tsai MT, Li WJ, Tuan RS, Chang WH: Modulation of osteogenesis in human mesenchymal stem cells by specific pulsed electromagnetic field stimulation. J Orthop Res. 2009, 27 (9): 1169-1174. 10.1002/jor.20862.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat Yang Y, Tao C, Zhao D, Li F, Zhao W, Wu H: EMF acts on rat bone marrow mesenchymal stem cells to promote differentiation to osteoblasts and to inhibit differentiation to adipocytes. Bioelectromagnetics. 2010, 31 (4): 277-285.PubMed Yang Y, Tao C, Zhao D, Li F, Zhao W, Wu H: EMF acts on rat bone marrow mesenchymal stem cells to promote differentiation to osteoblasts and to inhibit differentiation to adipocytes. Bioelectromagnetics. 2010, 31 (4): 277-285.PubMed
24.
Zurück zum Zitat Schwartz Z, Simon B, Duran M, Barabino G, Chaudhri R, Boyan B: Pulsed electromagnetic fields enhance BMP2 dependent osteoblastic differentiation of human mesenchymal stem cells. J Orthop Res. 2008, 26 (9): 1250-1255. 10.1002/jor.20591.CrossRefPubMed Schwartz Z, Simon B, Duran M, Barabino G, Chaudhri R, Boyan B: Pulsed electromagnetic fields enhance BMP2 dependent osteoblastic differentiation of human mesenchymal stem cells. J Orthop Res. 2008, 26 (9): 1250-1255. 10.1002/jor.20591.CrossRefPubMed
25.
Zurück zum Zitat Satija NK, Gurudutta G, Sharma S, Afrin F, Gupta P, Verma YK, Singh VK, Tripathi R: Mesenchymal stem cells: molecular targets for tissue engineering. Stem Cells Dev. 2007, 16 (1): 7-24. 10.1089/scd.2006.9998.CrossRefPubMed Satija NK, Gurudutta G, Sharma S, Afrin F, Gupta P, Verma YK, Singh VK, Tripathi R: Mesenchymal stem cells: molecular targets for tissue engineering. Stem Cells Dev. 2007, 16 (1): 7-24. 10.1089/scd.2006.9998.CrossRefPubMed
26.
Zurück zum Zitat Ling L, Nurcombe V, Cool SM: Wnt signaling controls the fate of mesenchymal stem cells. Gene. 2009, 433 (1–2): 1-7.CrossRefPubMed Ling L, Nurcombe V, Cool SM: Wnt signaling controls the fate of mesenchymal stem cells. Gene. 2009, 433 (1–2): 1-7.CrossRefPubMed
27.
Zurück zum Zitat Horst G, Werf SM, Farih-Sips H, Bezooijen RL: Downregulation of Wnt signaling by increased expression of dickkopf-1 and-2 is a prerequisite for late-stage osteoblast differentiation of KS483 cells. J Bone Miner Res. 2005, 20 (10): 1867-1877. 10.1359/JBMR.050614.CrossRefPubMed Horst G, Werf SM, Farih-Sips H, Bezooijen RL: Downregulation of Wnt signaling by increased expression of dickkopf-1 and-2 is a prerequisite for late-stage osteoblast differentiation of KS483 cells. J Bone Miner Res. 2005, 20 (10): 1867-1877. 10.1359/JBMR.050614.CrossRefPubMed
28.
Zurück zum Zitat Regoli F, Gorbi S, Machella N, Tedesco S, Benedetti M, Bocchetti R, Notti A, Fattorini D, Piva F, Principato G: Pro-oxidant effects of extremely low frequency electromagnetic fields in the land snail Helix aspersa. Free Radic Biol Med. 2005, 39 (12): 1620-1628. 10.1016/j.freeradbiomed.2005.08.004.CrossRefPubMed Regoli F, Gorbi S, Machella N, Tedesco S, Benedetti M, Bocchetti R, Notti A, Fattorini D, Piva F, Principato G: Pro-oxidant effects of extremely low frequency electromagnetic fields in the land snail Helix aspersa. Free Radic Biol Med. 2005, 39 (12): 1620-1628. 10.1016/j.freeradbiomed.2005.08.004.CrossRefPubMed
29.
Zurück zum Zitat Frahm J, Mattsson MO, Simko M: Exposure to ELF magnetic fields modulate redox related protein expression in mouse macrophages. Toxicol Lett. 2010, 192 (3): 330-336. 10.1016/j.toxlet.2009.11.010.CrossRefPubMed Frahm J, Mattsson MO, Simko M: Exposure to ELF magnetic fields modulate redox related protein expression in mouse macrophages. Toxicol Lett. 2010, 192 (3): 330-336. 10.1016/j.toxlet.2009.11.010.CrossRefPubMed
30.
Zurück zum Zitat Ward DF, Salasznyk RM, Klees RF, Backiel J, Agius P, Bennett K, Boskey A, Plopper GE: Mechanical strain enhances extracellular matrix-induced gene focusing and promotes osteogenic differentiation of human mesenchymal stem cells through an extracellular-related kinase-dependent pathway. Stem Cells Dev. 2007, 16 (3): 467-480. 10.1089/scd.2007.0034.CrossRefPubMed Ward DF, Salasznyk RM, Klees RF, Backiel J, Agius P, Bennett K, Boskey A, Plopper GE: Mechanical strain enhances extracellular matrix-induced gene focusing and promotes osteogenic differentiation of human mesenchymal stem cells through an extracellular-related kinase-dependent pathway. Stem Cells Dev. 2007, 16 (3): 467-480. 10.1089/scd.2007.0034.CrossRefPubMed
32.
Zurück zum Zitat Kasten A, Müller P, Bulnheim U, Groll J, Bruellhoff K, Beck U, Steinhoff G, Möller M, Rychly J: Mechanical integrin stress and magnetic forces induce biological responses in mesenchymal stem cells which depend on environmental factors. J Cell Biochem. 2010, 111 (6): 1586-1597. 10.1002/jcb.22890.CrossRefPubMed Kasten A, Müller P, Bulnheim U, Groll J, Bruellhoff K, Beck U, Steinhoff G, Möller M, Rychly J: Mechanical integrin stress and magnetic forces induce biological responses in mesenchymal stem cells which depend on environmental factors. J Cell Biochem. 2010, 111 (6): 1586-1597. 10.1002/jcb.22890.CrossRefPubMed
33.
Zurück zum Zitat Franceschi RT, Xiao G: Regulation of the osteoblast-specific transcription factor, Runx2: Responsiveness to multiple signal transduction pathways. J Cell Biochem. 2003, 88 (3): 446-454. 10.1002/jcb.10369.CrossRefPubMed Franceschi RT, Xiao G: Regulation of the osteoblast-specific transcription factor, Runx2: Responsiveness to multiple signal transduction pathways. J Cell Biochem. 2003, 88 (3): 446-454. 10.1002/jcb.10369.CrossRefPubMed
Metadaten
Titel
Osteogenic differentiation of amniotic epithelial cells: synergism of pulsed electromagnetic field and biochemical stimuli
verfasst von
Qian Wang
Wenchao Wu
Xiaoyu Han
Ai Zheng
Song Lei
Jiang Wu
Huaiqing Chen
Chengqi He
Fengming Luo
Xiaojing Liu
Publikationsdatum
01.12.2014
Verlag
BioMed Central
Erschienen in
BMC Musculoskeletal Disorders / Ausgabe 1/2014
Elektronische ISSN: 1471-2474
DOI
https://doi.org/10.1186/1471-2474-15-271

Weitere Artikel der Ausgabe 1/2014

BMC Musculoskeletal Disorders 1/2014 Zur Ausgabe

Arthropedia

Grundlagenwissen der Arthroskopie und Gelenkchirurgie. Erweitert durch Fallbeispiele, Videos und Abbildungen. 
» Jetzt entdecken

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Arthroskopie kann Knieprothese nicht hinauszögern

25.04.2024 Gonarthrose Nachrichten

Ein arthroskopischer Eingriff bei Kniearthrose macht im Hinblick darauf, ob und wann ein Gelenkersatz fällig wird, offenbar keinen Unterschied.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Ärztliche Empathie hilft gegen Rückenschmerzen

23.04.2024 Leitsymptom Rückenschmerzen Nachrichten

Personen mit chronischen Rückenschmerzen, die von einfühlsamen Ärzten und Ärztinnen betreut werden, berichten über weniger Beschwerden und eine bessere Lebensqualität.

Update Orthopädie und Unfallchirurgie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.