Background
Cervical cancer (CC) represents the fourth most frequently occurring malignancy among women across the globe and one of the leading causes of cancer-related death in women in developing countries [
1]. Statistics data have reported approximately 266,000 deaths and 528,000 newly diagnosed cases of CC in Asian countries in 2010, among which about 6000 were found in China [
2]. Many risk factors contributing to CC have been demonstrated, including polygamous spouse, early sexual activity, human papilloma virus history, smoking, as well as poor hygienism [
3]. Owing to insufficient early detection, CC is usually diagnostically confirmed at a high-grade stage. Therefore, a growing body of studies have been identifying promising biomarkers to provide better understanding in underlying mechanism and improve the treatment outcome of CC [
4].
CC-related expression profile (GSE63514) was obtained from GEO, which identified GREM1 as being highly expressed in CC. GREM1 has been well established to be an antagonist of bone morphogenetic protein, which is usually silenced by promoter hyper-methylation in human malignancies [
5]. The functional relevance of GREM1 has been linked with the progression of multiple tumors, like colorectal cancer and basal cell carcinoma [
6,
7]. Furthermore, transforming growth factor-β (TGF-β), acting as a multifunctional cytokine, which has been highlighted to influence malignant behaviors of tumor cells [
8]. It is interesting to note that the TGF-β/smad pathway has also been verified as a critical mediator during the EMT process in CC [
9]. The present study also demonstrated that GREM1 was actively involved in the regulaory process of TGF-β/smad pathway. However, its specific mechanism remains to be defined.
MicroRNAs (miRNAs) represent a family of small non-coding RNA molecules that could diminish the expression of corresponding target genes [
10]. Notably, accumulating miRNAs have been identified to serve as both tumor suppressors and oncogenes to modulate CC progression due to its role in controlling metastasis as well as cell apoptosis [
11]. The tumor suppressive role of miR-137 has been highlighted in a variety of cancers [
12]. Accordingly, we conducted this study to validate the hypothesis that miR-137 may influence the expression of GREM1 and therefore controls the development of CC.
Methods and materials
Ethics statement
The study was conducted with the approval of the Institutional Review Board of Jiangdu People’s Hospital of Yangzhou (Number: 201402006). Written informed consent was obtained from each participant. The animal experiments are carried out in compliance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health.
Microarray data and gene ontology (GO) enrichment analysis
CC-associated expression profiles were acquired from the Gene Expression Omnibus (GEO) database (
http://lgmb.fmrp.usp.br/mirnapath/tools.php). A Limma package in the R language was employed to determine differentially expressed genes (DEGs) with screening criteria of |LogFoldChange| higher than 2 and
p value less than 0.05. The heat-map package was adopted to plot the heat map. GO enrichment analysis was performed using the clusterProfiler, with
p < 0.05 and gene counts > 2 as the screening criteria. The fold change of gene expression of top 50 genes is displayed in Additional file
1, and the gene expression value of top 50 genes in Additional file
2.
Regulatory miRNA prediction
Patients
From March 2014 to March 2016, 109 CC patients (24–71 years old; average age = 44.34 years) from the Department of Gynecology and Obstetrics of Jiangdu People’s Hospital of Yangzhou were recruited for this study. None of the patients had undergone chemotherapy, radiotherapy or biotherapy prior to the surgery. The patients were enrolled if the following criteria were met: (1) CC diagnosis confirmed following histopathological examinations, based on the diagnostic standard of the sixth edition of
Obstetrics and Gynecology; (2) CC staging determined based on classification criteria recommended by International Federation of Gynecology and Obstetrics (FIGO) [
13]. Women who requested or required a radical hysterectomy were also included, the diagnosis of whom was verified by pathological examination after surgery. Patients were excluded if they: (1) had incomplete clinical data; (2) suffered from congenial acute genital tract inflammation, genetic diseases, or any other serious internal medical diseases, or pregnant women. Adjacent tissues 2 cm from the CC tissues, which were pathologically confirmed as normal tissues, were collected to serve as controls.
Immunohistochemistry
The immunohistochemistry was conducted based on the protocols on the SP Kit (wi83516, Beijing Ruoshuihe Technology Co., Ltd., Beijing, China) [
14]. Both CC and the adjacent tissues were prepared into paraffin-embedded sections. Phosphate buffered saline (PBS) and a known positive section were separately served as a negative control (NC) and a positive control. Following dewaxing, the sections were subjected to the treatment of citrate buffer for antigen repair. After treatment of endogenous peroxidase blocking, the sections were cultured with primary antibodies, rabbit antibodies to GREM1 (1:100; ab22138), E-cadherin (1:30, ab15148), N-cadherin (1:200, ab18203) and Vimentin (1:100, ab16700). All the antibodies were provided by Abcam Inc. (Cambridge, MA, USA). Subsequently, biotin-labeled secondary antibody was employed to incubate the sections. The proteins were visualized by diaminobenzidine (GMS12048.1, Shanghai Genmed Gene Pharmaceutical Technology Co., Ltd., Shanghai, China). The cells were counted (over 200 cells) in 4 randomly selected view fields using an optical microscope and protein expression rate was determined as positive cells/total cells × 100%.
Dual-luciferase reporter gene assay
The putative binding sites between miR-137 and GREM1 were identified with the bioinformatics website (microRNA.org). The pmirGLO plasmids (Promega Corporation, Madison, WI, USA), GREM1 3′untranslated region (UTR) and 3′UTRmu fragments were inserted through XbaI and SacI. The wild-type or mutant reporter constructs were co-transfected into the plated Escherichia coli DH5α cells (Takara, Dalian, Liaoning, China). When the cell reached 90–95% confluence, GREM1 3′UTR-pmir-GLO, 3′UTRmu-pmirGLO, or miR-137 mimic (GenePharma Ltd., Shanghai, China) or miR-137 mimic NC were transfected using Lipofectamine 2000 transfection (Invitrogen Inc., Carlsbad, CA, USA). The light intensity was determined based on the protocols of Dual-Luciferase® Reporter Assay System (Promega). In order to prevent the off-target effects, GREM1 3′UTR-pmir-GLO was co-transfected with specific miR-137 inhibitor and miR-137 mimic. After 24, the cells transfected with an inhibitor were regarded as the NC group, while those without any transfection as the blank control. The assay was independently repeated 3 times.
Cell lines and co-culture conditions
Human normal immortalized epithelial cell line HaCaT and CC cell lines C33A, HeLa, Caski and Siha (CL-0210, Wuhan Procell Life Technology Co., Ltd., Wuhan, Hubei, China) were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS) at 37 °C with 5% CO2. The cells were then assigned into six groups to investigate the effect of miR-137 binding to GREM1 on behaviors of CC cells, namely: blank (without transfection); NC (transfected with NC), miR-137 mimic (transfected with miR-137 mimic), miR-137 inhibitor (transfected with miR-137 inhibitor), siRNA-GREM1 (transfected with siRNA-GREM1 sequence) and miR-137 inhibitor + si-GREM1 (co-transfected with miR-137 inhibitor + si-GREM1). To investigate the effect of the TGF-β/smad pathway mediated by miR-137 on behaviors of CC cells, the cells were also tansducted with miR-137 inhibitor + si-NC or miR-137 inhibitor + si-TGF-β. 24 h prior to transfection, the cells were plated into a 6-well plate, after which the transfection was carried out based on the protocols of lipofectamine 2000 (11668-019, Invitrogen) when the cells reached 30–50% confluence. After incubation for 6–8 h, the medium was renewed with complete medium. After further incubation for 24–48 h, the cells were harvested and reserved.
RNA extraction and RT-qPCR
The Trizol (Takara) method was adopted for obtaining total RNA from the tissues. The sample RNA was reversely transcribed into cDNA using a reverse transcription kit (Fermentas K1621, Hangzhou ZhuNuo Biotechnology, Hangzhou, China). The primers used for amplification were artificially synthesized by TaKaRa (Table
1). Fluorescent quantitative PCR was performed based on the protocols of the SYBR
® Premix Ex Taq™ II Kit (RR820A, XingZhi Biotch. Guangzhou, China) using the ABI PRISM
® 7300 (Shanghai Kunke Instrument and Equipment Co., Ltd., Shanghai, China). U6 was regarded as the housekeeping gene for miR-137, and GAPDH as internal control for the remaining genes. The relative mRNA expression was quantified based on the 2
−ΔΔCt method. The aforementioned methods were also applicable to cell assays.
Table 1
Primer sequences of miR-137, U6, GREM1, TGF-β1, Smad2, Smad3 and Smad4 used in RT-qPCR
miR-137 | F: TTATTGCTTAAGAATACGCGTAG |
R: TGGTGTCGTGGAGTCG |
U6 | F: GCTTCGGCACATATACTAAAAT |
R: CGCTTCACGAATTTGCGTGTCAT |
GREM1 | F: TAACACTGCCACAAGAATGCAA |
R: GCAAGACTGTGGTACAAGCTCCTAA |
TGF-β1 | F: GCTCCACGGAGAAGAACAGGCTG |
R: CTGCTCCACCTTGGGCTTGC |
Smad2 | F: CGAAATGCCAGCGTAFAAAT |
R: CTGCCTTCGGTATTCTGCTC |
Smad3 | F: GCCCGTTACCTACTCGGAGC |
R: TGTTGACATTGGAGAGCAGC |
Smad4 | F: ATGCCTGTCTAGGCATTGTG |
R: CTGAAGCCTCCCATCCAAT |
GAPDH | F: TGTGGGCATCAATGGATTTGG |
R: ACACCATGTATTCCGGGTCAAT |
Western blot analysis
The extraction of total protein was carried out with RIPA lysis buffer. In the cellular protein extraction, the cells were lysed with 400 μL of lysis buffer for 30 min on ice. Subsequently, the cells were centrifuged to obtain the supernatant. The proteins were separated by electrophoresis and then transferred onto a polyvinylidene fluoride (PVDF) membrane, which was then blocked by 5% bovine serum at room temperature for 1 h. The membrane was then incubated at 4 °C overnight with the primary antibodies, diluted monoclonal rabbit antibodies to GREM1 (#4383, 1:1000, Cell Signaling Technology, Beverly, MA, USA), Smad4 (ab40759, 1:5000), the mouse antibodies to TGF-β1 (ab64715, 1:1000), Smad2 (ab119907, 1:1000), Smad3 (ab75512, 1:5000), E-cadherin (ab1416, 1:50), N-cadherin (ab98952, 1:1000), Vimentin (ab8978, 1:1000) and β-actin (ab8226, 1:1000). The membrane was subsequently incubated with corresponding secondary antibody, goat anti-rabbit antibody (ab6721, 1:5000) or goat anti-mouse antibody (ab6789, 1:5000) for 1 h at room temperature. Next, proteins were visualized with an enhanced chemiluminescence kit and observed by a Gel Imaging System for gray value analysis. The experimental procedures were also applicable for the tissue detection.
Cell viability assay
Transfected CC cells in the exponential phase were prepared into cell suspension. The cells (1 × 104 cells for each well) were then plated in a 96-well plate with 180 μL of cell suspension per well, followed by culture at 37 °C and 5% CO2 for 24–72 h. The plate was incubated for 4 h with 5% MTT solution (20 μL/well) without light exposure at 37 °C and 5% CO2. After this, the plate was treated with dimethyl sulfoxide (DMSO, 100 μL/well) in the dark for dissolving the crystal. Subsequently, the optical density (OD) was tested using a microplate reader (SAF-680T, Multiskan GO, Thermo Fisher Scientific, USA) at a wavelength of 570 nm. Growth curves of cells were plotted with the time as the X-axis and OD as the Y-axis. The assay was independently conducted three times.
Following cell transfection for 72 h, the cells at the exponential phase were seeded in 6 well plates (200 cells/well) respectively for a 2-week incubation. Each group was repeated in six wells. The culture was terminated when white clone spots were observed with the naked eye. The cells were fixed in methanol and stained with Giemsa. The colonies formed were observed under an optical microscope with a mass of more than 50 cells as one colony. The plating efficiency was calculated using the following formula: colony formation rate = clones counted/cells plated × 100%. The assay was repeated 3 times independently.
Flow cytometric analysis
After cells plated in 6-well culture plates adhered to the well, the cells were synchronized for 12 h. Digested cells were harvested after centrifugation, resuspended with pre-cooled 75% ethanol and fixed overnight at − 20 °C. The cells were incubated with a 50 μL aliquot of propidium iodide (PI; 0.5 mg/mL), and water-bathed at 37 °C for 30 min. The cell cycle distribution was assessed using a flow cytometer (FACSCalibur; Becton–Dickinson, Franklin Lakes, NJ, USA). The assay was independently repeated 3 times.
The cell apoptosis was evaluated based on the protocols of the Annexin-V-FITC Kit (Bender MedSystems, Vienna, Austria). The cultured cells were prepared into a single cell suspension with 0.05% trypsin. The cells were pipetted to obtain cell suspension. Subsequently, the cells were incubated with Annexin-V-FITC, and then further incubated with PI for 5 min under dark conditions. A flow cytometer was adopted to measure cell apoptosis rate.
Matrigel invasion assay
The Transwell apical chamber was coated with Matrigel diluted with DMEM to 50 μg/mL. The cells at exponential phase were then collected and photographed to analyze cell invasion at the 0th h. After an incubation process for 24 h, the cells were then photographed again. Fold changes of cell invasion were calculated. Matrigel diluted by serum-free medium was employed in the Transwell apical chamber to cover the polycarbonate membrane, which was left to react at room temperature for 1 h. Next, DMEM containing 20% FBS was applied to the Transwell basolateral chamber. The transfected CC cells for 24 h were prepared into single cell suspension by the serum-free DMEM (5 × 105 cells/mL), which was added to each well and cultured for 24 h. The liquid in the apical chamber was discarded and the cells that failed to penetrate through the membrane were wiped off. After hematoxylin–eosin–methylene staining, the number of cells penetrating the membrane was counted from 3 randomly selected fields by a light microscope. The assay was independently repeated 3 times.
Scratch test
The cells were trypsinized at 37 °C until the cell layer adhering to the well was noted to be moving in a sand like manner. The cells were seeded in a 6-well plate and incubated with 10% FBS overnight. When cell confluence reached 90–100%, vertical linear scratches were made at the bottom of the plate using a micropipette tip with 4–5 scratches in each well. The width of each scratch was made to be identical. Afterwards, the cells were incubated with serum-free medium again. The migration distance was observed and photographed under an inverted microscope at the 0th h and 24th h after scratching. IPP7.0 software (Media Cybernetics Inc., Singapore Post Centre, Singapore) was adopted to calculate the cell-free area at each time point, which was compared with that at the 0th h to calculate the migration rate. Six replicates were set up for each group. The assay was independently repeated 3 times.
Sixty female BALB/C athymic nude mice (6-week-old, Shanghai SLAC Laboratory Animal Co., Ltd., Shanghai, China) were randomly divided into 6 groups: blank, NC, miR-137 mimic, miR-137 inhibitor, siRNA-GREM1 as well as miR-137 inhibitor + si-GREM1. The nude mice were fed under a thermostatic and pathogen-free environment, which were observed approximately once a week prior to treatment. The transfected cells, after digestion, were centrifuged at 1000 rpm for 5 min. The cells were harvested and mixed in diluted Matrigel. The cell suspension (5 × 107 cells per mice) was subcutaneously injected into the left axilla of the nude mice. Afterwards, the weight of nude mice was recorded every day, and the volume was recorded every 5 days using Vernier calipers, with growth curves plotted. After 40 days, the nude mice were euthanized by CO2 inhalation and photographed. The tumor weight and size were measured, and the tumor volume was all determined.
Statistical analysis
Statistical analysis was carried out using the SPSS 21.0 software (IBM Corp., Armonk, N.Y., USA). The enumeration data were presented by rate or percentage, and processed by χ2 test, and the measurement data by the mean ± standard deviation. Differences between CC tissues and adjacent tissues were compared by paired t test, while other pairwise comparisons were performed using independent sample t test. Differences among multiple groups were compared with one-way analysis of variance. Spearman rank correlation analysis was adopted for correlation analysis. Statistical significance was defined at a level of 5% (p < 0.05).
Discussion
Numerous studies have provided evidence on the ability of various miRNAs in suppressing the growth of CC, such as miR-372, miR-214 and miR-7 [
21‐
23]. Furthermore, the TGF-β/Smad pathway has a critical role to play in the tumor microenvironment, thus mediating cancer progression [
24,
25]. The present study provided a new insight suggesting that miR-137 regulated the TGF-β/Smad pathway by binding to GREM1, resulting in the suppression of the migration and invasion of CC cells.
Initially, our results found that in CC tissues and cells, EMT was active, miR-137 was down-regulated, GREM1 was up-regulated and TGF-β/smad pathway was activated. In a recent study, it was found that miR-137 expression was evidently down-regulated in colorectal cancer (CRC) cell, which suggested the involvement of miR-137 in CRC development [
26]. It has been established that TGF-β pathway is activated in CC, which was consistent with our results [
27]. A high expression in GREM1 has been demonstrated in mesothelioma cells, which induces mesothelioma cell growth [
28]. Moreover, GREM1 has been confirmed to be closely related to TGF-β/smad pathway in glioma, colon cancer, chronic pancreatitis, as well as renal damage [
29‐
32]. Besides, TGF-β/smad signaling pathway was inactivated in response to a decrease in GREM1 expression.
In the subsequent experiments, we identified that the effect of miR-137 on EMT was achieved via the TGF-β/smad pathway by binding to GREM1. In response to GREM1 suppression or miR-137 overexpression, a reduction could be detected in EMT of the CC cells. The tumor-suppressive function of miR-137 has been documented in a variety of human tumors, such as colorectal cancer and breast cancer [
33,
34]. Furthermore, recent evidence has indicated that miR-137 could diminish the expression of Vimentin and N-cadherin and elevate that of E-cadherin in breast cancer cells, indicating that the overexpression of miR-137 may lead to the suppression of EMT [
35]. In line with our findings, a previous investigation demonstrated that the protein expression of N-cadherin and Vimentin are markedly downregulated in GREM1-silenced cells, suggesting that GREM1 may enhance the process of EMT [
36]. GREM1 triggers an instant activation of the Smad pathway featured by elevated phosphorylation of Smad3 and Smad2 proteins [
37]. Another study revealed that GREM1 is a downstream TGF-β1 mediator that acts to intensify EMT in renal cells as the inhibition of GREM1 decreases TGF-β-promoted EMT [
38]. In addition, we also demonstrated that miR-137 could repress the CC cell proliferation, migration and invasion and induce cell cycle arrest and apoptosis via the TGF-β/smad pathway by binding to GREM1. These results were further confirmed by in vivo xenograft tumor formation experiments in nude mice. Consistent with our study, a study has found that Let-7a, could suppress CC cell proliferation by decreasing the expression of TGF-β1 through the TGF-β/smad pathway [
39]. Hence, based on the aforementioned findings, miR-137 could potentially serve as a biomarker to inhibit the growth of CC cells.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.