Background
Human breast cancer is the most common carcinoma in females, and the second leading cause of cancer related mortality in women, accounting for approximately 29% (232,340) of all new cancer cases among women and 14% (39,620) cancer related mortality, representing a serious health threat to women worldwide [
1,
2]. Although various treatments for breast cancer, such as chemotherapy, radiation and hormone therapy, have been used and have been improved recently, the clinical outcome of patients remains unsatisfactory. This is largely because of a lack of effective and specific biomarkers that predict breast cancer. Thus, it is important to identify new genes and molecules that can effectively distinguish patients with favorable prognosis from those with poor prognosis, and to develop new therapy options for breast cancer patients.
Prostate tumor overexpressed 1 (PTOV1), a 46 kDa protein with two repeated PTOV homology blocks, was first identified during a screen for genes overexpressed in prostate cancer [
3]. The PTOV1 gene is located on a region of chromosome 19 (19q13) that is associated with high risk of breast cancer [
4,
5]. PTOV1 comprises 12 exons, and the encoded protein has two almost identical tandemly arranged PTOV domains, each containing a potential nuclear localization signal [
3]. PTOV1 expression is elevated in multiple cancers, including lung, endometrium, bladder, kidney and ovary cancer [
6]. However, the expression and clinical relevance of PTOV1 in breast cancer have not been determined. Additionally, PTOV1 was reported to be associated with tumor development and progression. Recently, PTOV1 was shown to force cells to enter S phase and to promote mitotic activity of prostate cancer cells. High levels of PTOV1 expression are significantly associated with Ki67 immunostaining, indicating that PTOV1 upregulation is functionally related to proliferative status [
7,
8]. PTOV1 negatively regulates retinoic acid receptor transcription activity by antagonizing mediator complex subunit 25 [
9]. Marqués N et al. reported that PTOV1 promotes c-Jun expression at the post-transcriptional level, which enhanced the invasive and metastatic capacity of prostate cancer cells [
10]. Accumulating data indicate that PTOV1 might play an essential role in tumorigenesis.
In the present study, e aimed to investigate the expression of PTOV1 in breast cancer and its relationship with clinical parameters and prognosis in breast cancer patients. The results showed that PTOV1 is significantly upregulated in breast cancer, and overexpression of PTOV1 is closely associated with the clinical stage, T, N and M classification, and estrogen receptor (ER) expression levels in breast cancer. Cox regression analysis revealed that PTOV1 might be considered as an independent biomarker for breast cancer prognosis. Collectively, our findings strongly suggested that PTOV1 plays an important role in the development and progression of human breast cancer, and might be a useful predictive marker of prognosis in breast cancer patients.
Methods
Cell lines
Primary normal breast epithelial cells (NBEC) were established according to a previous report [
11]. Immortalized breast epithelial cells MCF-01A were maintained in keratinocyte serum-free medium and breast cancer cell lines, including BT474, BT549, MDA-MB-435, MDA-MB-453, MDA-MB-231, MDA-MB-415, MDA-MB-468, T47D, MCF-7, ZR-75-1, ZR-75-30, SKBR-3, and Bcap-37 were purchased from ATCC and maintained in DMEM medium (Invitrogen) supplemented with 10% fetal bovine serum (HyClone, Logan, UT, USA) and 100 μg/ml penicillin, and 100 μg/ml streptomycin (Invitrogen) at 37°C in a humidified atmosphere containing 5% CO2.
Tissue specimens and patient information
A total of 169 breast cancer paraffin-embedded specimens from female patients, which had been histopathologically and clinically diagnosed as breast cancer at the Cancer Center, Sun Yat-sen University from 2003 to 2007, were used in the present study. Tumor grade and stage were defined according to the 6th edition of the TNM classification of the Union for International Cancer Control (UICC, 2002). For the use of these clinical materials for research purposes, prior patients’ consents and approval from Sun Yat-sen University Cancer Center Institutional Review Board were obtained. Clinical information on the samples is summarized in Table
1. The median age at the time of surgery was 47 years (range 22–96 years). The follow-up time of the primary breast cancer cohort ranged from 9 to 115 months, and the median follow-up time was 59 months. The percentage of tumor purity in sections adjacent to the regions used for RNA extraction was estimated during routine histopathological analysis.
Table 1
Clinicopathological characteristics of patientsamples and expression of PTOV1 in breast cancer
Gender
| |
Male | 0 (0.0) |
Female | 169 (100.0) |
Age (years)
| |
≥ 47 | 89 (52.7) |
< 47 | 80 (47.3) |
Clinical stage
| |
I | 30 (17.8) |
II | 81 (47.9) |
III | 53 (31.4) |
IV | 5 (3.0) |
T classification
| |
T1
| 52 (30.8) |
T2
| 88 (52.1) |
T3
| 17 (10.1) |
T4
| 12 (7.1) |
N classification
| |
N0
| 72 (42.6) |
N1
| 50 (29.6) |
N2
| 30 (17.8) |
N3
| 17 (10.1) |
M classification
| |
No | 164 (97) |
Yes | 5 (3) |
Vital status (at follow-up)
| |
alive | 131 (77.5) |
Dead | 38 (22.5) |
Expression of PTOV1
| |
Low expression | 86 (50.9) |
High expression | 83 (49.1) |
Detectable | 167 (99.4) |
Undetectable | 2 (0.6) |
Expression of ER
| |
0 | 74 (43.8) |
1 | 37 (21.9) |
2 | 16 (9.5) |
3 | 42 (24.9) |
Expression of PR
| |
0 | 75 (44.4) |
1 | 28 (16.6) |
2 | 27 (16.0) |
3 | 39 (23.1) |
Expression of c-erbB2
| |
0 | 90 (53.3) |
1 | 20 (11.8) |
2 | 13 (7.7) |
3 | 46 (27.2) |
Total RNA from cells and fresh surgically obtained tumor tissues and their adjacent noncancerous tissues was extracted using the Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruction. The extracted RNA was pretreated with RNase-free DNase, and 2 μg of RNA from each sample was used for cDNA synthesis primed with random hexamers. For PCR amplification of PTOV1 cDNA, an initial amplification using PTOV1 specific primers was done with a denaturation step at 95°C for 10 min, followed by 28 cycles of denaturation at 95°C for 60 s, primer annealing at 58°C for 30 s, and primer extension at 72°C for 30 s. Upon completion of the cycling steps, a final extension at 72°C for 5 minutes was done before the reaction was stored at 4°C. Real-time PCR was applied to measure the fold of increase of PTOV1 mRNA in each of the primary breast tumors relative to the paired normal breast tissue obtained from the same patient. Real-time PCR primers were designed using the Primer Express v 2.0 software (Applied Biosystems). The sequences of real-time PCR primers were: PTOV1 Forward: CGAGTACAGGAGCATGAGCA and Reverse: CTTCACCAACAGAGACTGCG; GAPDH Forward: GACTCATGACCACGTCCATGC and Reverse: AGAGGCAGGGATGATGTTCTG. Expression data were normalized to the geometric mean of housekeeping gene Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to control the variability in expression levels and analyzed using the 2
-△△Ct method described by the previous report [
12], and all experiments were performed in triplicate.
Western blotting
Cells were washed twice with ice-cold phosphate-buffered saline (PBS), then lysed on ice in radioimmune-precipitation assay (RIPA; Cell Signaling Technology, Danvers, MA) buffer containing complete protease inhibitor cocktail (Roche Applied Sciences, Mannheim, Germany) and heated for 5 min at 100°C. Fresh tissue samples were ground to powder in liquid nitrogen and lysed with SDS-PAGE sample buffer. Equal protein samples (30 μg) were separated on 10.5% SDS polyacrylamide gels and transferred to PVDF membranes (Immobilon P, Millipore, Bedford, MA). Membranes were blocked with 5% fat-free milk in Tris-buffered saline containing 0.1% Tween-20 (TBST) for 1 h at room temperature. Membranes were incubated with anti-PTOV1 antibody (1:100, Sigma, HPA051812) overnight at 4°C, and then with horseradish peroxidase-conjugated goat anti-rabbit IgG (Santa Cruz Biotechnology, SC-2004). To evaluate PTOV1 expression, enhanced chemiluminescence system (ECL) prime Western blotting detection reagent (Amersham) were used according to the manufacturer’s instructions. α-Tubulin (Sigma, Saint Louis, MO) was used as a loading control.
Immunohistochemistry analysis
Immunohistochemical analysis was done to measure PTOV1 protein expression in 169 human breast cancer tissues. Briefly, paraffin embedded specimens were cut into 4 μm sections and baked at 60°C for 2 hours, followed by deparaffinized with xylenes and rehydrated. Antigenic retrieval was done by submerging the Sections into EDTA antigenic retrieval buffer and microwaving. The sections were then treated with 3% hydrogen peroxide in methanol to quench the endogenous peroxidase activity, followed by incubation with 1% bovine serum albumin to block the nonspecific binding. Sections were then incubated with anti-PTOV1 rabbit polyclonal antibody (1:50, Sigma, HPA051812) overnight at 4°C. For negative controls, the primary antibody was replaced by normal goat serum. After washing, the tissue sections were treated with biotinylated anti-rabbit secondary antibody (Abcam), followed by a further incubation with streptavidin-horseradish peroxidase complex (Abcam). The tissue sections were immersed in 3-amino-9-ethyl carbazole and counterstained with 10% Mayer’s hematoxylin, dehydrated and mounted in Crystal Mount.
The degree of immunostaining of the sections was viewed and scored separately by two independent investigators, who were blinded to the histopathologic features and patient data of the samples. The scores were determined by combining the proportion of positively stained tumor cells and the intensity of staining. Scores given by the two independent investigators were averaged for further comparative evaluation of the PTOV1 expression. The proportion of positively stained tumor cells was graded as follows: 1 (< 10% positive tumor cells), 2 (10-50% positive tumor cells), 3 (50-75% positive tumor cells), and 4 (> 75% positive tumor cells). The intensity of staining was recorded as following: 0 (no staining), 1 (weak staining, light yellow), 2 (moderate staining, yellowish brown), and 3 (strong staining, brown). The staining index was calculated as the product of the proportion of positive cells and the staining intensity score. Cutoff values to define the high and low expression of PTOV1 were chosen based on a measure of heterogeneity with the log-rank test statistics with respect to overall survival (OS). An optimal cut-off value was identified: a staining index score of greater or equal to 6 was used to define tumors with high PTOV1 expression and a score less than or equal to 4 indicated low PTOV1 expression.
Statistical analysis
All statistical analyzes were carried out using the SPSS 16.0 statistical software packages. The chi-square test and Fisher’s exact test were used to analyze the correlation between PTOV1 expression and the clinicopathologic characteristics. Bivariate correlations between study variables were calculated by Spearman’s rank correlation coefficients. Survival curves were plotted using the Kaplan-Meier method and compared with the log-rank test. The significance of various variables for survival was analyzed by univariate and multivariate Cox regression analyzes. All reported P-values are two-sided. A P-value of less than 0.05 was considered statistically significant in all cases.
Discussion
In the present study, we provided the first evidence that overexpression of PTOV1 protein is associated with poor prognosis of breast cancer patients with both early- and late-stage disease. Our data showed that PTOV1 is upregulated in breast cancer cell lines and in clinical tumor specimens, at both the mRNA and protein levels, compared with normal breast epithelial cells and normal breast tissues, respectively. Moreover, the analysis of 169 archived breast cancer samples revealed that PTOV1 expression is significantly associated with progression of breast cancer; a high level of PTOV1 might correlate with a shorter survival time (P < 0.001), indicating that PTOV1 plays an important role in breast cancer progression. Furthermore, Cox regression analysis showed that higher PTOV1 expression was an independent prognostic indicator of shorter survival in breast cancer patients. These findings strongly suggested that lower expression of PTOV1 would provide a selective advantage in prognosis for breast cancer patients.
PTOV1 was first identified as a novel elevated expressed gene in prostate cancer [
3]. Aberrant PTOV1 expression is associated with tumor progression in prostate cancer and other neoplasms [
3,
6]. PTOV1 was reported to assist Flotillin-1 nuclear translocation and promote the mitogenic activity of Flotillin-1 in a cell cycle-dependent manner [
7]. Flotillin-1 promotes tumorigenesis of various cancers, such as esophageal squamous cell carcinoma, non-small cell lung cancer and breast cancer [
13‐
16]. Flotillin-1 promotes breast cancer carcinogenesis inducing entry into the S phase of the cell cycle and by upregulating the transcription factor Foxo3a [
16]. Thus, we assumed that PTOV1 might promote breast cancer progression through a similar mechanism. Further investigations are required to test this assumption. In quiescent cells, PTOV1 is mainly localized in the cytoplasm and is excluded from the nucleus. However, elevated nuclear PTOV1 is closely correlated with high Ki67 immunoreactivity, indicating that PTOV1 plays an important role in cells proliferative status [
8]. In xenograft experiments, tumor cells overexpressing PTOV1 showed an increased growth rate and tumorigenic capacity [
10]. Taken together, these results confirmed that overexpression of PTOV1 could contribute to the proliferative status of tumor cells, indicating that PTOV1 is involved in the progression of cancer.
Recently, PTOV1, which is a modulator of the mediator transcriptional regulatory complex, was revealed to regulate c-Jun expression at the posttranscriptional level [
10]. c-Jun is a major component of the AP-1 complex and is associated with a variety of biological processes, including proliferation and differentiation [
17]. c-Jun is thought to induce mammary cell invasiveness, which plays an important role in breast cancer metastasis and stem cell expansion [
18]. Therefore, we speculated that PTOV1 might promote breast cancer tumorigenesis through the transcription factor c-Jun and its downstream genes. Furthermore, a previous study found that high PTOV1 expression might be a good predictor of prostate cancer in men with isolated high-grade prostatic intraepithelial neoplasms in needle biopsies [
19,
20].Thus, PTOV1 might be a positive regulator of breast cancer development and progression; however, the exact mechanism needs further investigation.
Breast cancer patients with the same clinical stage, which is routinely classified by TNM stage system, often have distinct outcomes. This large difference indicates that the TNM stage system alone is not sufficient to fully predict the clinical outcome of breast cancer patients with regard to the heterogenetic biological characteristic of this malignancy. The ER is overexpressed in about 50% breast cancer patients and could be a prognostic indicator for breast cancer patients [
21]. However, there is dispute over the definition of ER positive status nuclear staining by the routinely used IHC method, which has limited its clinical application [
22‐
24]. Moreover, not all ER positive breast cancer patients respond to endocrine therapy; some of the patients who were sensitive to hormone therapy developed resistance; however, the mechanism is unclear [
25,
26]. Collectively, these defects limit the application of ER status in breast cancer management. A close correlation between PTOV1 expression and ER expression status (r = 0.246,
P = 0.001) suggested that the expression level of PTOV1 might be a useful supplement to breast cancer hormone therapy decision-making. Thus, PTOV1 may be a useful marker for determining prognosis and guiding the follow-up schedule of breast cancer patients.
Our study indicated that PTOV1 might positively regulate breast cancer development and progression, and is a useful indicator of poor prognosis and a prognostic marker for patient survival. However, the modulation of PTOV1 expression in this malignant tumor and its molecular mechanisms in breast cancer development and progression still require further investigation.
Acknowledgements
This study was supported by grants from Guangdong Medical Science and Technology Research Fund (No. A2011199, No. A2010192), and the Science and Technology Program Fund of Guangdong Province (No. S2013010016623). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
FYLei carried out the Western blotting, and drafted the manuscript. LJZ collected the tissue specimens and patient information, and editing of the manuscript. XHL collected patient information and carried out the statistical analyses. XL carried out Immunohistochemical (IHC) analysis. SW carried out RNA extraction and real-time PCR. FYLi participated in designing the study and guiding editing the manuscript. JLL conceived the study and guided editing manuscript. All authors read and approved the final manuscript.