P3H4 is correlated with clinicopathological features and prognosis in bladder cancer

Forty-four bladder cancer and corresponding adjacent normal tissues were obtained from Shaoxing Hospital of China Medical University. Tissue samples were first frozen in liquid nitrogen after resection and stored in a − 80 °C refrigerator until use. The research protocol was approved by the Ethics Committee of Shaoxing Hospital of China Medical University. Moreover, written informed consent for using the tissue samples was obtained from those 44 patients. All samples are muscle invasive bladder cancer (MIBC).

RNA of the tissue samples was extracted using TRIzol reagent in accordance with the manufacturer’s instructions (Life Technologies, USA). Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out using Thunderbird SYBR qPCR Mix (Toyobo, Japan) in the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, USA). The primers for P3H4 were ACGCGCTGTTCAAGGCTAA (forward) and CCAGCATCCCCTGATAGTAGT (reverse). GAPDH was used as an internal control.

We downloaded TCGA clinical data in “Biotab” format from The Cancer Genome Atlas. Then, the normalized mRNA expression counts of P3H4 were acquired from TCGA and are expressed as RNA-Seq by transcripts per kilobase million values.

Data on normal distribution were expressed as mean ± standard deviation and were then compared with t test. Data on abnormal distribution were compared with Mann–Whitney U test. Chi-square test or Fisher’s exact test was used to evaluate the connection between clinicopathological characteristics and P3H4 expression, as appropriate. Kaplan–Meier and Cox regression analyses were performed to assess the prognostic value of P3H4. Statistical significance was considered at p < 0.05. All statistical analyses were carried out using SPSS, and GraphPad Prism 5 was used for drafting.

To examine the role of P3H4 in bladder cancer, we investigated the P3H4 expression in 44 primary tumors and their paired adjacent normal tissues using qRT-PCR. P3H4 was upregulated in primary tumor compared with their paired adjacent normal tissues (2.02 ± 0.64 vs 1.21 ± 0.54, p < 0.001, Fig. 1). To further confirm the results, we analyzed the expression of P3H4 in 389 bladder cancer tissues and 19 adjacent normal tissues from the TCGA database. As shown in Fig. 2, the expression of P3H4 was also significantly upregulated in the TCGA database (37.77 ± 28.27 vs 13.60 ± 7.67, p < 0.001). This finding revealed that P3H4 may play a significant role in bladder cancer.

To further explore whether P3H4 expression is related to clinicopathological factors of bladder cancer, we divided 389 patients with bladder cancer from the TCGA database into high P3H4 expression (n = 195) and low P3H4 expression (n = 194) groups according to the median value of P3H4. The results from the TCGA cohort indicated that P3H4 expression was significantly associated with age, race category, histologic grade, tumor histologic subtype, and AJCC stage (p < 0.05, Table 1). The average age was greater in the high P3H4 expression group than in the low P3H4 expression group (69.25 ± 10.18 vs 66.39 ± 10.87, p = 0.008). Similar results were also found in our local cohort (71.55 ± 7.71 vs 66.32 ± 7.92, p = 0.032, Additional file 1: Table S1). Interestingly, the race category was also different between the two groups (p = 0.001). The high P3H4 expression group had a higher histologic grade and more non-papillary type percentage than the low P3H4 expression group (98.45% vs 90.63% and 73.82% vs 61.66%, p = 0.001 and 0.011, respectively). The most significant finding is that high P3H4 expression corresponded to advanced AJCC stage (p = 0.005). Gender, BMI, angiolymphatic invasion, extracapsular extension, Karnofsky performance score, lymph node metastasis, and metastasis showed no significant correlation with P3H4 expression (p > 0.05). Overall, high P3H4 expression may play an important role in bladder cancer.

To further investigate the prognostic role of P3H4 in bladder cancer, we performed Kaplan–Meier and Cox regression analyses. Kaplan–Meier analysis showed that survival prognosis was different between the high and low P3H4 expression groups. The high P3H4 expression group had a shorter overall survival (OS) than the low P3H4 expression group (p = 0.009, Fig. 3). The cumulative 5-year OS in the high P3H4 expression group was 35.1%, which was much lower than that in the low P3H4 expression group (48.3%). Univariate and multivariate Cox regression analyses were then performed. Univariate Cox regression analysis showed that age (hazard ratio (HR) = 1.04, 95% CI = 1.023–1.057, p < 0.001), angiolymphatic invasion (HR = 1.619, 95% CI = 1.177–2.226, p = 0.003), lymph node metastasis (HR = 2.071, 95% CI = 1.47–2.918, p < 0.001), tumor histologic subtype (HR = 0.628, 95% CI = 0.433–0.909, p = 0.014), metastasis (HR = 4.507, 95% CI = 2.131–9.532, p < 0.001), AJCC stage (HR = 1.708, 95% CI = 1.402–2.08, p < 0.001), and P3H4 (HR = 1.504, 95% CI = 1.104–2.048, p = 0.01) were associated with OS (Table 2). However, other factors, including gender, BMI, race category, extracapsular extension, Karnofsky performance score, and histologic grade, were not significantly related to OS (p > 0.05, Table 2). Moreover, multivariate Cox analysis indicated that only age (HR = 1.037, 95% CI = 1.019–1.054, p < 0.001), AJCC stage (HR = 1.560, 95% CI = 1.265–1.923, p < 0.001), and P3H4 (HR = 1.413, 95% CI = 1.016–1.966, p = 0.04) were independent factors of poor OS in bladder cancer (Table 3). Taken together, the results indicate that P3H4 is a poor independent prognostic factor of bladder cancer and worthy of further study.