Background
Vascular calcification is a major cause of increasing mortality in patients with diabetes, atherosclerosis, hypertension, and chronic kidney disease (CKD) [
1,
2]. The prevalence of vascular calcification increases with age, and it is approximately 60% for individuals > 70 years of age [
3,
4]. Cumulative evidence suggests that vascular calcification is a strictly regulated process that is similar to bone formation [
5,
6]. Its characteristics include the deposition of calcium phosphate in arteries, the phenotypic transformation of vascular smooth muscle cell (VSMCs) into osteoblast-like cells, and the expression of bone-related proteins [
7,
8]. Increased stiffness and decreased elastic recoil in the aortic wall lead to reduced coronary perfusion and concentric ventricular hypertrophy [
9]. However, the underlying mechanisms of vascular calcification have not been established.
Oxidative stress is a critical regulator of many age-related diseases, including vascular calcification [
10]. The production of reactive oxygen species (ROS) and the oxidative modification of various biomolecules induce the transformation of VSMCs from the contractile type to the osteogenic type, which is accompanied by calcification [
7]. For example, hydrogen peroxide (H
2O
2) is a classic oxidant stressor that promotes vascular cell calcification by increasing the expression of the osteogenic transcription factor runt-related transcription factor 2 (Runx2) [
11]. The reduction in ROS by 4-hydroxy-2,2,6,6,-tetramethyl piperidinoxyl (tempol), a membrane-permeable antioxidant, blocks VSMCs differentiation into osteoblast-like cells [
12]. The transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2), which belongs to the Cap'n'collar/basic region leucine zipper (CNC-bZIP) transcription factor family, plays a negative role in VSMCs calcification by inhibiting oxidative stress and interacting with the osteogenic transcription factor Runx2 [
13‐
15].
Panax quinquefolius saponin (PQS) is the main active component of
Panax quinquefolius. Emerging evidence suggests that PQS exerts pleiotropic beneficial effects on cardiovascular diseases and diabetes, and its protective effects may be mostly attributable to its antioxidant effects [
16‐
18]. One previous study found that PQS protected the myocardium against myocardial infarction by reducing oxidative stress injury and suppressing excessive endoplasmic reticulum stress [
19].
Panax quinquefolius also inhibited oxidative stress-induced cardiomyocyte death by activating the Nrf2 signaling pathway [
20]. However, whether PQS prevents VSMCs calcification is not known. Therefore, the present study tested the hypothesis that PQS blocked VSMCs calcification via activation of Nrf2.
Methods
Materials and reagents
Standardized PQS was supplied by Jilin Yisheng Pharmaceutical Co., Ltd. (Jilin Province, China). Dulbecco's modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco (Grand Island, NY, USA). TRIzol reagent and a Prime Script RT Reagent Kit were purchased from Invitrogen (Carlsbad, CA, USA). Alizarin red S was obtained from Sigma (cat. no. A5533, St. Louis, MO, USA). A Dual-Luciferase Reporter Assay System was purchased from Promega (cat. no. E1910, WI, USA). Rabbit polyclonal anti-Nrf2 (cat. no. sc-13032, H300; 1:500), anti-β-actin (cat. no. sc-47778; 1:1000) and goat anti-rabbit IgG (cat. no. sc-2004; 1:5000) were purchased from Santa Cruz (Dallas, TX, USA). Primary antibodies against proteins including Runx2 (cat. no. ab23981; 1:1000), bone morphogenetic protein 2 (BMP2) (cat. no. ab14933, H300; 1:1000), SM22α (cat. no. ab14106; 1:1000) and heme oxygenase-1 (HO-1) (cat. no. ab13243; 1:2000) were purchased from Abcam (Cambridge, MA, USA).
Cell isolation and identification
Aortic smooth muscle cells were separated from the thoracic aorta of 6-week-old male Sprague–Dawley (SD) rats. Each rat was anesthetized via abdominal injection of a 1% sodium pentobarbital solution (10 ml/kg), and the thoracic aorta was removed and minced into small pieces (1–2 mm2). The pieces were transferred to digestive enzymes mixing 0.2% trypsin and 0.1% collagenase I solution at 37 °C for 20 min with shaking. The process of digestion was terminated by adding 5 ml 10% fetal bovine serum (FBS). The cells attached to the dish were collected and cultured in DMEM supplemented with 10% FBS and antibiotics in a 95% humidified-air incubator at 37 °C with 5% CO2. VSMCs were identified by positive staining of α-smooth muscle actin and used for the experiments between passages 5–8.
Calcification induction and cell treatment
VSMCs were seeded in culture dishes and maintained in DMEM with 10% FBS. After confluency, cells were incubated in calcification medium containing 3 mM Pi for 6 days to induce calcification. The first day of culture in the calcification medium was defined as day 0. PQS was added to the culture medium at different concentrations during the calcification period. The treatment medium was changed every 2 days. Cells cultured in DMEM supplemented with 10% FBS without Pi and PQS were used as the blank group.
Cell viability assay
Cell viability was determined using an MTS assay kit (Promega, WI, USA) according to the manufacturer’s instructions. VSMCs were seeded 96-well plates and incubated for 24 h. The culture medium was removed and replaced with DMEM with or without PQS at different concentrations (0, 25, 50, 100 and 200 μg/ml) for 24 h. Then, the medium was removed, followed by incubation with 100 μl of fresh 10% FBS medium and 20 μl of MTS cell viability reagents. After incubation at 37 °C for 1 h, the absorbance at 490 nm was measured using a multiwell spectrophotometer. All values were normalized to the control group.
Alizarin red staining
Alizarin red staining was used for the quantitative detection of calcium deposition in VSMCs. Briefly, after treatment for 6 days, the cells were washed with phosphate-buffered saline (PBS) 3 times, fixed in 4% neutral formalin for 30 min and stained with 1% alizarin red (pH 4.2) for 5 min at room temperature. The cells were washed with PBS 3 times to remove nonspecific staining and the cells were photographed under light microscopy.
Alkaline phosphatase (ALP) activity assay
To quantify intracellular calcium deposition, ALP activity was determined using an Alkaline Phosphatase Assay Kit (cat. no. P0321M, Beyotime Biotechnology, Hangzhou, China) in accordance with the manufacturer's instructions. Briefly, lysis buffer (20 mM Tris, pH 7.5; 150 mM NaCl; 1% Triton X-100) was added to the cells, which were incubated for 30 min at 4 °C and centrifuged at 111.8 rcf for 10 min. The supernatants were transferred to a 96-well plate and incubated with para-nitrophenyl phosphate (pNPP) for 10 min at 37 °C. The stop solution was added to the reaction mixture, and ALP activity was determined using a microplate reader at an absorbance wavelength of 405 nm (BioTek Synergy, VT, USA). The amount of total protein in the lysate was quantified using a bicinchoninic acid (BCA) assay kit (Sigma, MO, USA). The ALP activity was normalized to the protein content. The specific activity to produce 1 nmol of p-nitrophenol was defined as one unit, and the values of ALP activities are expressed as units/mg protein.
Reactive oxygen species (ROS) assay
Intracellular ROS levels were measured using a ROS Assay Kit (cat. no. S0033M, Beyotime Biotechnology, Hangzhou, China) according to the instructions. VSMCs were incubated with Pi (3 mM) in the presence or absence of PQS for 48 h and then treated with 10 μM DCFH-DA at 37 °C for 20 min. The cells were washed with DMEM 3 times, and the fluorescence intensity of the cell lysates was measured using a fluorescence microplate reader at an excitation wavelength of 488 nm and an emission wavelength of 525 nm. The results are expressed as a percentage of the control value.
Nrf2 transcriptional reporter assay
An Nrf2 transcriptional reporter assay was performed using a Dual-Luciferase Reporter Assay System. Briefly, VSMCs were transfected with ARE-luc (firefly luciferase) plasmids containing the Nrf2 reporter gene with Lipofectamine 2000. After 48 h of transfection, the luciferase activity was determined using a Dual-Glo Luciferase Assay System. The pRL-TK-luc (Renilla luciferase) plasmids were used as an internal control, and Nrf2 transcriptional activity was expressed by normalizing the luciferase values to the empty vector control values.
Small interfering RNAs transfection
The small interfering RNA (siRNA) for Nrf2, Keap1 and the negative control were purchased from GenePharma (Shanghai, China). Cells were transiently transfected with siRNAs using the Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions. After 48 h, cells were cultured in calcification medium with or without PQS and utilized for the further experiments.
Quantitative real-time PCR (RT-PCR)
According to the manufacturer's instructions, total RNA from cultured cells was isolated with TRIzol reagent and used to synthesize cDNA with a reverse transcription kit. A SYBR Premix Ex Taq Kit (Takara, Dalian, China) was used to perform RT-PCR according to the manufacturer's protocol. The cycling conditions used were as follows: predenaturation at 95 °C for 30 s followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s. The amplification of mRNA was analyzed using the 2
−ΔΔCt method. The expression levels of target genes were normalized to the mRNA levels of the internal reference β-actin. The primer sequences of the genes are listed in Table
1.
Table 1
Primer sequences for real-time PCR
Nrf2 | GCTATTTTCCATTCCCGA | 109 | NM_031789 |
ATTGCTGTCCATCTCTGTCAG |
HO-1 | AGAGTTTCTTCGCCAGAGG | 127 | NM_012580 |
GAGTGTGAGGACCCATCG |
Runx2 | TCGGAAAGGGACGAGAG | 101 | NM_001278483 |
TTCAAACGCATACCTGCAT |
BMP2 | AAGCCAGGTGTCTCCAAG | 209 | NM_017178 |
AAGTCCACATACAAAGGGTG |
SM22α | CTGTAATGGCTTTGGGCAGT | 97 | NM_031549 |
CTCTTATGCTCCTGGGCTTTC |
β-actin | ATGGTGGTATGGGTCAGAAGG | 264 | NM_031144 |
TGGCTGGGGTGTTGAAGGTC |
Western blot analysis
Total cell protein was extracted in RIPA lysis buffer containing protease inhibitors, and the concentration of protein was quantified using a BCA assay kit according to the manufacturer's protocol. Equal amounts of protein were separated by 10% SDS-PAGE and transferred to PVDF membranes, which were blocked in 5% milk for 2 h and incubated with specific primary antibodies overnight at 4 °C. After washing 3 times in TBST, the membranes were incubated with the appropriate secondary antibodies at room temperature for 1 h. The protein bands were visualized with enhanced chemiluminescence reagent.
Statistical analysis
Unless otherwise indicated, data were obtained from at least 3 separate experiments performed in triplicate. Measurement data are presented as the mean ± standard deviation (SD). Analyses were performed using SPSS 17.0 statistical software (IBM Corporation, Armonk, NY, USA). Statistical significance was determined using one-way ANOVA followed by Tukey’s t test. A value of p < 0.05 indicated statistical significance.
Discussion
In the present study, we investigated the effects of PQS on VSMCs calcification in vitro and the underlying mechanisms. We demonstrated that PQS effectively prevented the Pi-induced mineralization process and inhibited the expression of osteogenic marker genes by reducing oxidative stress, activating the expression of Nrf2 and decreasing the protein level of Keap1. Blockade of Nrf2 partially abolished the beneficial effects of PQS on calcification. Taken together, our findings suggest that PQS inhibits VSMCs calcification and is associated with attenuation of oxidative stress via the Nrf2/Keap1 pathway.
Inorganic phosphate is essential for many cellular processes, and elevated serum phosphorus plays an important role in the progression of vascular calcification [
21]. In this study, high concentrations of Pi were used to induce VSMCs calcification, which is morphologically similar to that observed in the calcified human aortic media and heart valves [
22,
23]. The underlying molecular mechanisms might be related to VSMCs phenotypic transition mediated by phosphate cotranspor Pit-1 and apoptosis mediated by a secreted prote Growth arrest-specific gene 6 (Gas6) [
24,
25]. Oxidative stress is caused by ROS generation that exceeds local antioxidant capacity. Accumulating studies have demonstrated that oxidative stress is involved in many of the molecular events of vascular calcification [
26‐
28]. For example, selenite prevents vascular calcification by inhibiting oxidative stress-induced activation of the phosphatidylinositol 3-kinase (PI3K)/AKT and extracellular regulated kinase (ERK) signaling pathways and endoplasmic reticulum stress, which leads to decreased osteoblastic differentiation and apoptosis of VSMCs [
26]. The inhibition of dynamin-related protein 1 (DRP1), which is a key regulator of mitochondrial fission, attenuates oxidative stress-mediated mitochondrial dysfunction, matrix mineralization, and cytoskeletal rearrangement, which reduces cardiovascular calcification [
27]. Quercetin attenuates VSMCs apoptosis and calcification by inhibiting oxidative stress and decreasing mitochondrial fission [
28]. In the presence of high Pi concentrations, ROS homeostasis is imbalanced, and overproduction of ROS leads to a cell apoptosis cascade and eventually different vascular pathologies, including VSMCs osteochondrogenic transdifferentiation, inflammation, and extracellular matrix remodeling [
29,
30]. We found that PQS treatment reduced the production of ROS and vascular calcification caused by Pi in a dose-dependent manner. This result suggests that PQS protects VSMCs against oxidative injury during the process of calcification.
Nrf2, a master transcription factor, suppresses oxidative stress by controlling the expression of numerous antioxidant and detoxification genes, including HO-1, glutathione (GSH), and thioredoxin (TXN) [
31]. Under normal conditions, Nrf2 binds to Keap1, which is an important regulator of the ubiquitylation and degradation of Nrf2. Under perturbed conditions such as oxidative stress, Keap1 is inactivated, which results in Nrf2 dissociation and nuclear translocation [
32]. In summary, Nrf2 decreases intracellular ROS levels through its antioxidant activity and plays a fundamental role in maintaining cellular redox homeostasis. According to the results of previous studies, activation of Nrf2 may be beneficial to attenuate VSMCs calcification [
33‐
35]. Alpha-lipoic acid, an Nrf2 activator, attenuates calcification in VSMCs and mice by restoring mitochondrial function and the intracellular redox state via its antioxidant potential [
36]. Dimethyl fumarate (DMF) stimulates Nrf2 activity to attenuate VSMCs calcification by inhibiting osteogenic genes [
15]. Our data revealed that the expression levels of Nrf2 and HO-1 were significantly increased after 6 days of stimulation by PQS, which suggested that Nrf2 is critically involved in the development of VSMCs calcification. Nrf2 knockdown by siRNA increased calcium deposition, reversed the expression of Runx2 and suppressed the inhibitory effect of PQS on calcification in VSMCs. The finding that PQS inhibits VSMCs calcification by activating Nrf2 and suppressing oxidative stress establishes a direct mechanistic link between PQS-mediated vascular protective effects and antioxidative activity. Sheng et al. discovered that the activation of the Nrf2-ARE signaling pathway may inhibit vascular calcification via the suppression of Runx2 and BMP2 [
37]. Our results are in accordance with other findings that the expression of osteogenic marker genes, including Runx2 and BMP2, is highly correlated with Nrf2 levels during VSMCs calcification. Keap1 plays a critical role in the inhibition of Nrf2 activity. PQS inhibited Keap1 expression, which might be the mechanism of elevated Nrf2 expression. However, Nrf2 activity is also regulated via Keap1-independent or other pathways, including the βTrCP-CUL1 complex, the WD40 repeat-containing protein 23 (WDR23) complex, and P62 transcription [
38‐
40]. Future studies should focus on delineating other signaling pathways, especially those closely correlated with cell apoptosis and inflammation in ginseng.
Panax quinquefolius, also called American ginseng in Asia, is native to the United States and Canada [
41]. It is an important herb that has been widely used to prevent and treat diseases for hundreds of years [
42]. PQS exerts protective effects against cardiovascular diseases by attenuating oxidative stress injury, protecting ischemic and reperfused myocardial tissue, increasing energy storage in the myocardium, reducing myocardial apoptosis, and improving ventricular reconstruction [
20,
43,
44]. Rb1, Rg1, and Rb2 are the main ginsenosides in ginseng that exhibit a remarkable antioxidant effect via the activation of the Nrf2 pathway [
45‐
48]. In addition, Sun et al. reported that ginsenoside Rb3 protects cardiomyocytes against hypoxia/reoxygenation-induced oxidative stress by activating the antioxidation signaling pathway of PERK/Nrf2/HMOX1 [
49]. PQS treatment significantly attenuated the elevation of malonyldialdehyde (MDA) and superoxide dismutase (SOD) induced by intermittent high glucose in human umbilical vein endothelial cell (HUVECs) through the phosphatidylinositol 3-kinase kinase (PI3K)/Akt/GSK-3β pathway [
50]. All these studies demonstrate that the Nrf2 pathway is considered a key molecular mechanism by which PQS attenuates oxidative stress injury in many organs and tissues. Unfortunately, so far there is no data about PQS for the treatment of vascular calcification in human. However, PQS are major bioactive components of Xinyue capsule which is a patented Chinese herbal medicine and is used as adjunct to conventional therapy on cardiovascular diseases for over ten years in China [
51]. Previous study demonstrated that in patients with stable coronary artery diseases (CAD) after percutaneous coronary intervention (PCI) within the preceding 3 to 12 months, Xinyue capsule (100 mg PQS, three times a day) reduced the incidence of primary composite endpoint in addition to conventional treatment [
52]. Our study demonstrated that PQS inhibited high phosphate-induced VSMCs calcification in vitro, further studies are needed to determine whether PQS prevents vascular calcification in vivo and to provide theoretical evidence for PQS as a potential therapy in patients with vascular calcification.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.