Background
Despite the numerous clinical trials that have been conducted, there are doubts about the efficacy and safety of Aducanumab, a monoclonal antibody that targets
β-amyloid. It is the first new drug approved for the treatment of AD since 2003 [
1]. Recently the repurposing of anticancer agents in treatment of Alzheimer's disease is of increasing interest. They also target
β-amyloid. The promising results of preclinical studies have triggered several clinical trials [
2,
3]. Moreover, Type 2 diabetes mellitus (T2D) has been identified as a high-risk factor for AD [
4]. The impairment of insulin signaling has been found in AD brain. There is increasing evidence suggests that insulin resistance has crucial role in AD pathogenesis, probably due to high GSK3β activation causing intra and extracellular amyloid-Beta (Aβ) accumulation and tau phosphorylation [
5‐
7]. Misfolding and aggregation of diverse proteins and their accumulation as amyloid in different organs is the hallmark feature in a group of chronic, degenerative diseases such as Alzheimer’s and Parkinson’s disease [
8].
Recent scientific studies have shown that many food plants, medicinal plants and spices contain bioactive components such as piperine, curcumin, thymoquinone, crocin, capsaicin, polysaccharides, polyphenols, and other bioactive metabolites, which have been shown to have anticancer, anti-Inflammatory, antioxidant and immunomodulatory effects[
9‐
11]. In addition.several studies reported that many natural polyphenols, which have antioxidant, anti-inflammatory and anti-diabetic properties, have beneficial effects against protein aggregates found in AD. Phenolic molecules have been reported to have dual activity as inhibitors of amyloid aggregation and antioxidants [
12‐
14].
Conyza dioscoridis (L.) Desf. (Family Asteraceae) is widely grown in Egypt, Middle East and some African countries. The plant has a good reputation in folk medicine as a remedy for rheumatic pains, epilepsy in children and colds [
15].
C.dioscoridis is a source of many bioactive compounds as essential oils, polyphenols mostly flavonoids as quercetin, quercetin 3-
O-β-D-glucopyranoside, kampferol,quercetin 3-
O-6'-α-L-rhamnopyranosyl-β-D-glucopyranoside, phenolic acids, as well as protein protease inhibitor [
16,
17]. Previous studies have reported that C
. dioscoridis extract exhibits antioxidant, anti-inflammatory, anti-nociceptive, anti-hyperglycemic, and anti-diabetic activity [
15‐
19]. Interestingly, several studies demonstrated the anticancer activity of the bioactive components and the crude extract of C.
dioscoridis [
20‐
25]. Several protease inhibitors from C.
dioscoridis have been purified and characterized. These protease inhibitors showed cytotoxic activity equal to the crude extract. They have been identified as potential antitumor targets because of their involvement in proteostasis [
24,
25]. Recently, El-Gamal et al. (2021) confirmed that C.
dioscoridis extract has anticancer and anti-aging activities as it showed significant inhibitory activity against hyaluronidase collagenase, tyrosinase and elastase [
22].
Scopolamine-induced amnesia is one of the most commonly used pharmacological models related to AD [
26]. This model has augmented our knowledge about the role of the cholinergic system in cognitive function. However, this model is not associated with the development of pathological AD hallmarks or disease progression in the cholinergic and cognitive dysfunctions [
27]. The recent experimental approach provided evidence that high-fat diet causes insulin resistance and AD-like pathology [
7,
28‐
30]. The efficacy of
C. dioscoridis extract on AD-like alteration in type 2 diabetes rats characterized by brain insulin resistance and cognitive impairment by scopolamine has not yet been investigated. In the present work, we aimed to determine the efficacy of PCDE on AD-like alterations, particularly amyloid-beta (Aβ) and P-tau accumulation, induced in T2D rats by a high-fat, high-fructose diet combined with a single small dose of STZ (25 mg/kg i.p.), as well as estimation of its effect on cognitive impairment caused by a single injection of scopolamine.
Animal groups
Scopolamine model
Animals were randomly divided into 6 groups (n = 6 per group). Treated groups received a standard drug, donepezil HCl (DON) or PCDE once daily for 6 days and before the injection of scopolamine for testing the cognitive performance. Group, I was injected with i.p. saline, received oral Tween 80 1% in saline (vehicle) and served as normal control (NC + veh). Group II was injected with scopolamine hydrobromide (2 mg/kg; i.p.), received oral Tween 80, and served as positive control (SCO + veh). Group III was injected with scopolamine hydrobromide (2 mg/kg; i.p.) and received donepezil HCl (4 mg/kg; p.o.) as a standard anti-Alzheimer drug (SCO + DON). Groups IV, V and VI were injected with scopolamine hydrobromide (2 mg/kg, i.p.) and received PCDE, orally by gavage, emulsified in Tween 80 (1% v/v) at doses of 50 mg/kg (SCO + CD50), 100 mg/kg (SCO + CD100) and 150 mg/kg (SCO + CD150) respectively.
T2D model for induction of type 2 diabetes and AD-like alterations
After confirmation of hyperglycemia following STZ injection, diabetic rats were randomly divided into 6 groups of 10 rats each. Animals of different experimental groups started receiving the specified oral treatments or vehicle once daily for another 8 weeks while they were constantly fed with the HF/HFr diet. Group I was fed with conventional chow, once injected with 0.1 M citrate buffer (0.1 ml, pH 4.4; i.p.) and served as normal control (NC + veh). Group II was fed with HF/HFr diet for 8 weeks, injected once with STZ (25 mg/kg; i.p.) dissolved in 0.1 M citrate buffer, received oral Tween 80 (1% v/v) daily for 8 weeks and served as T2D control (positive control; T2D + veh). Group III was fed with HF/HFr diet for 8 weeks, injected once with STZ (25 mg/kg; i.p.) and received daily oral donepezil HCl (4 mg/kg) as a standard drug (T2D + DON). Groups IV, V and VI were fed with HF/HFr diet for 8 weeks, injected once with STZ (25 mg/kg; i.p.) and received daily PCDE orally by gavage, emulsified in Tween 80 (1% v/v) at doses of 50 mg/kg (T2D + CD50), 100 mg/kg (T2D + CD100) and 150 mg/kg (T2D + CD150); respectively. At the end of the diet and treatment period, the effect of different treatments on learning and memory was investigated by the passive avoidance (PA) and Morris water maze (MWM) tests.
Quantifying the gene expression of glutamate receptor subunits in the hippocampus of T2D rats using quantitative real-time polymerase chain reaction (qRT-PCR)
These experiments were performed to determine the effect of treatment on the hippocampal gene level of AMPAR (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor) subunits GluR1 and the NMDA (
N-methyl-D-aspartate) receptor subunits NR1, NR2A, NR2B, NR2C, and NR2D. Hippocampal specimens dissected from the right hemispheres of rat brain were processed for extraction of total RNA using Direct-zol™ RNA MiniPrep kit in accordance with the manufacturer’s instructions. Samples were treated with DNase to prevent DNA contamination. RNA concentrations were determined using a NanoDrop® (Epoch Microplate Spectrophotometer, Biotek, VA, USA). SensiFAST™ cDNA Synthesis Kit was used to prepare the complementary DNA (cDNA) needed for qRT-PCR. Real-time polymerase chain reactions were carried out using sybrgreen dye and gene-specific primers (Table
1). Β-actin and GAPDH mRNA levels were used as the reference genes. Analysis of results was conducted with the aid of 7500 fast biosystem software using the comparative cycle threshold method (comparative ct method) [
54].
Table 1
Primer sequences for qRT-PCR reaction
β-actin | TGACAGGATGCAGAAGGAGA | TAGAGCCACCAATCCACA | |
GAPDH | CCATCCCAGACCCCATAAC | GCAGCGAACTTTATTGATG | |
GluR1 | GCTTCATGGACATTGACTTA | ATCTCAAGTCGGTAGGAGTA | |
NR1 | CTTCCTCCAGCCACTACCC | AGAAAGCACCCCTGAAGCAC | |
NR2A | AGGACAGCAAGAGGAGCAAG | ACCTCAAGGATGACCGAAGA | |
NR2B | TGAGTGAGGGAAGAGAGAGAGG | ATGGAAACAGGAATGGTGGA | |
NR2C | GGGCTCCTCTGGCTTCTATT | GACAACAGGACAGGGACACA | |
NR2D | CCCAAATCTCACCCATCCT | GAGAGGTGTGTCTGGGGCTA | |
Statistical analysis
Data are expressed as the mean ± standard error (SE). Statistical analysis was performed by a one-way analysis of variance (ANOVA), followed by Tukey's post hoc test, using GraphPad Prism 5.03 (GraphPad Software, Inc.). For all statistical comparisons, a P-value < 0.05 was considered statistically significant. No sample calculation was performed.
Discussion
Two experimental animal models were adopted in the current study to induce AD-like cognitive impairment in rats, the acute scopolamine model and the chronic HF/HFr/ diet -STZ (T2D) model. The significant finding of the present research showed that in model scopolamine-injected animals, there was an increase in cholinesterase activity in hippocampus and abnormal oxidant-antioxidant balance with impairing the cognitive function. In T2D model HF/Hfr diet with a single dose of STZlead to cognitive dysfunction, peripheral hyperglycemia, hypercholesterolemia, and insulin resistance (increased HOMA –IR index) together with increased hippocampal GSK-3β and the increase of the deposition of the Aβ1-42 and p-Tau. Moreover, this diet with STZalso caused alterations in different cell processes, such as an increase in oxidative stress (decrease in GSHand SOD and increase in MDA), pro-inflammatory reactions (TNF-α, IL-1β,) and a caspase -3 activity, an indicator of neurodegeneration. In addition, these results showed that there was an increase in the activity of hippocampal ChE with suppression of gene expression of glutamate receptors. These results are supported by similar findings by many researchers [
28‐
30,
55]. PCDE reversed the induced memory impairment with improvement in oxidative status in the scopolamine model, whereas it ameliorates all features of AD-like alterations in T2D model. DON was more effective than PCDE in reducing ChE activity which is consistent with other studies [
56]
Insulin resistance characterized by high levels of GSK-3β in the brain and high HOMA-IR index in serum where the reduced insulin signal lead to increases in GSK-3β activity which increase the tau phosphorylation. Therefore, an increase in GSK-3β activity is essential in the pathogenesis of Alzheimer's disease [
57,
58]. Many studies suggested that the pathological hallmarks of type 2 diabetes-related dementia are tau-related neurofibrillary tangles and not amyloid-beta plaques [
59‐
61]. Intervention for AD may be more successful through inhibiting insulin resistance and abnormal GSK-3β activity [
7,
43,
60,
61]. PCDE in the present study reduced insulin resistance and hippocampal GSK-3β activity and improved all toxic consequences features of AD that have been detected in the T2D animal model. Our results show that PCDE have ant-diabetic activity which is in line with previous published literature [
15,
18,
19]. This effect may contribute to the reduction of aggregation of amyloid beta and attenuation of signs of AD in a T2D rat’s model.
Aggregation of amyloid beta (Aβ) and tau or protein misfolding disorders are the hallmarks of AD [
62]. Cellular dysfunction and tissue damage may be resulted from the accumulation of these amyloidogenic proteins which causes the clinical onset in patients through the production of inflammation, oxidative stress, and cell death [
63]. Inhibition of protein misfolding disorders will inhibit the cellular damage. Many non-toxic natural phenolic compounds, derived from herbs and food have been shown to reduce misfolded aggregates [
12,
13]. Our result showed a significantly lower Aβ deposition as with DON and reduced p-tau more than with DON. The effect of DON used as a reference drug documents the effect of PCDE on Aβ and tau protein [
64‐
66]. Polyphenols decrease amyloid, tau, α-syn, and synphilin-1 deposits, by inhibition of their formation or by disaggregation of them [
67‐
69]. PCDE is rich in many phenolic compounds which may induce disaggregation of aggregated p-tau and amyloid. Moreover, protein protease inhibitors from PCDE may play a crucial role in amyloid scavenging because dysregulation of proteases is implicated in the pathogenic process of many human diseases such as AD [
22,
24].
A high-fat diet increases hippocampal oxidative stress and depresses antioxidant defense system [
70,
71]. High-fat diet leads to sustained hyperglycemia, which is the main mediator of increased reactive oxygen species production [
72]. Many studies have shown that the tissue level of CAT and SOD are reduced in the brain of STZ-diabetic rats [
73]. Scavenging oxygen radical is the most important target for potential Alzheimer's disease modifying agent [
74‐
77]. Furthermore, several studies demonstrated that inflammatory cytokines such as TNF-α and IL-6 are significantly associated with the severity of cognitive impairment and can be used to predict the severity of cognitive impairment [
78].
Our present study showed that PCDE has antioxidant and anti-inflammatory activities. It increased the reduced hippocampal levels of GSHand SOD and decreased the high level of MDAin T2D and scopolamine models. These results suggest that PCDE acts at different levels and inhibits the secondary processes induced by the aggregation of amyloid beta (Aβ) and tau, such as oxidative stress and inflammation. Many studies showed that the phenolic compounds and crude extract of PCDE have strong antioxidant and anti-inflammatory activities [
16‐
19]. In addition, natural agents with anticancer activities could inhibit inflammation markers at different doses levels [
79]. Inhibitory activity of PCDE against hyaluronidase collagenase, tyrosinase and elastase may play important role in inhibition of inflammation and scavenging of free radicals [
22].
Hypercholesterolemia may play a role in the development of cognitive impairment through acceleration of the accumulation of amyloid beta peptides [
80‐
82]. Park et al. [
83] demonstrated that hypercholesterolemia accelerated Aβ accumulation and tau pathology, which was accompanied by microglial activation and subsequent aggravation of memory impairment induced by Aβ25-35. Also, some clinical investigations reported that high, LDL-C levels in middle age was a potential risk factor for the subsequent occurrence of cognitive dysfunction in later life [
84]. Ma et al. [
85] demonstrated that higher blood levels of total cholesterol and low-density lipoprotein cholesterol in late-life were associated with faster global cognitive impairment. Our study showed that seventeen weeks of the dietary regimen with HF/HFr diet produced a marked increase in serum cholesterol levels and administration of 3 doses of PCDE decreased significantly the higher levels of cholesterol in T2D rats compared to diabetic control rats. The current study suggests that the PCDE and protein protease inhibitors may have a role in inhibiting amyloidogenesis through reduction of hypercholesterolemia and inhibition of aggregation of amyloid and p-tau. It has multiple beneficial activities.
It has been shown that NMDA (N-methyl-D-aspartate) receptor-dependent long-term potentiation in hippocampal pyramidal neurons, is thought to underlie the formation of neuronal circuits during learning and memory [
86]. Furthermore, activation of NMDARs by Aβ accumulation may occur in the early stages of Alzheimer's disease, then Aβ enhances the cellular endocytosis of NMDARs and reduces the expression of NMDARs [
87,
88]. In line with these studies, our results showed that treatment with PCDE for 8 weeks resulted in a correction in the expression of reduced glutamate receptors located in the hippocampus of T2D rats with cognitive impairment.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.