Hepatocellular carcinoma (HCC) develops in a complex microenvironment characterized by chronic inflammation. In recent years, cholesterol metabolic abnormalities have been implicated the importance in cancer cell physiology. This study was designed to investigate the relationship between inflammation and cholesterol accumulation in HCC cells.
Methods
Human HCC cells HepG2 and Huh7 were cultured and stimulated with lipopolysaccharide (LPS) for 24 h. The changes of HCC cells related to cholesterol metabolism including intracellular cholesterol concentrations, cholesterol uptake, and the expression of cholesterol-related genes 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), LDL receptor (LDLR), sterol regulatory element-binding transcription factor 2 (SREBF2), and proprotein convertase subtilisin/kexin 9 (PCSK9) were comparatively analyzed. Simultaneously, the effects of nuclear factor-kappa B (NF-κB) signaling pathway on cholesterol metabolism were clarified by knocking-down of nuclear factor kappa-B kinase subunit alpha (IKKα) and TGF-beta-activated kinase 1 and MAP3K7-binding protein 3 (TAB3) via RNAi and microRNA (miR)-195. Subsequently, the roles of cholesterol accumulation in LPS induced pro-inflammatory effects were further investigated.
Results
Pro-inflammatory factor LPS significantly increased intracellular cholesterol accumulation by upregulating the expression of HMGCR, LDLR, and SREBF2, while downregulating the expression of PCSK9. These effects were revealed to depend on NF-κB signaling pathway by knocking-down and overexpression of IKKα and TAB3. Additionally, miR-195, a regulator directly targeting IKKα and TAB3, blocked the effects of cholesterol accumulation, further supporting the critical role of pro-inflammation NF-κB signaling in regulating cholesterol accumulation. Intriguingly, the accumulation of cholesterol conversely exerted an augmented pro-inflammation effects by further activating NF-κB signaling pathway.
Conclusions
These results indicated that pro-inflammation effects of NF-κB signaling could be augmented by a positive feedback via enhancing the cholesterol accumulation in liver cancer cells.
Abkürzungen
DIL-LDL
Low density lipoprotein labeled with 1,1′-Dioctadecyl-3,3,3′,3′-tetramethyl-indocarbocyanideperchlorate
TGF-beta-activated kinase 1 and MAP3K7-binding protein 3
Background
Metabolic reprogramming in the uncontrolled proliferation of cancer cells has been thought to play important roles in cancer biology [1]. Recently, many studies have demonstrated that cholesterol accumulate in a series of human cancers, including breast [2], colon [3], prostate [4], HCC [5], and others [6]. In addition, enzymes involved in cholesterol metabolism have been reported abnormal expression in cancer tissues [7, 8]. For instance, cholesterol acyltransferase (ACAT)2, is found to be induced and promotes esterification of excess oxysterols for secretion to avoid cytotoxicity in a subset of hepatocellular carcinomas (HCCs) for tumor growth [9], suggestive of a specific cholesterol metabolic pathway in HCCs. On the one hand, cholesterol is needed for the synthesis of membranes, signaling molecules, lipid raft formation, and other factors to support the rapid growth of tumor cells [8]. On the other hand, cholesterol oxidized products, namely oxysterols, exhibit inhibitory activities in cell growth and promote cell apoptosis and dampen antitumor responses [10‐12]. However, mechanism and pathological significance underlying the aberrant cholesterol metabolism are still elusive.
Epidemiological studies have shown that 80% of HCCs develop in fibrotic or cirrhotic livers as a consequence of chronic liver injury [13, 14]. The NF-κB pathway, the key link of inflammatory responses, plays an important role in HCC promotion by increasing proliferation and preventing apoptosis [15]. In the inactive state, NF-κB transcription factors are complexed in the cytoplasm, either with members of the inhibitor of κB (IκB) family (in the canonical pathway) or with the NF-κB precursor p100 (in the non-canonical pathway). Lipopolysaccharide (LPS), a component of the gram-negative bacterial wall, could activate NF-κB pathway and stimulate inflammatory responses. Previous studies have demonstrated that LPS/NF-κB signaling pathway promotes atherosclerotic progression and macrophage foam cell formation by increasing intracellular cholesterol accumulation [16, 17]. These reports inspired us to hypothesize whether there is a crosstalk between NF-κB signaling and cholesterol metabolism in cancer cells.
Anzeige
In the present study, we investigated the relationship between inflammation and cholesterol metabolism, and found that pro-inflammatory factor Lipopolysaccharide (LPS) increased intracellular cholesterol accumulation through NF-κB pathway in HCC cells. Cholesterol accumulation conversely promoted LPS/NF-κB pathway and inflammatory responses.
Methods
Cell culture
Human HCC cells HepG2 and Huh7 were purchased from Cell Bank of the institute of Biochemistry and Cell Biology, China Academy of Sciences, Shanghai, China. Cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% (v/v) fetal bovine serum (Gibco, BRL, USA), 10ug/mL streptomycin sulfate and 100ug/mL penicillin G. All cells were incubated at 37 °C in a humidified atmosphere containing 5% CO2.
LDL preparation
LDL was purchased from AngYu Biotechnologies (Shanghai, China). It is isolated from blood bank produced human plasma. It is purified via ultracentrifugation to homogeneity determined by agarose gel electrophoresis. Each lot is analyzed on agarose gel electrophoresis for migration versus LDL.
Measurement of intracellular cholesterol
Total cellular cholesterol measurement was determined with a detection kit from Applygen (Peking, China) according to the manufacturer’s protocol. Intracellular lipids were extracted using a chloroform-methanol (2:1) mix and dried under vacuum. Total cholesterol contents were measured by an enzymatic assay. The value was normalized against total protein concentration from each sample, as determined with Bicinchoninic Acid assay (Beyotime biotechnology, China).
Anzeige
DIL-LDL uptake
The low density lipoprotein labeled with 1,1′-Dioctadecyl-3,3,3′,3′-tetramethyl- indocarbocyanideperchlorate (DIL-LDL) (Biomedical Technologies Inc., MA, USA) uptake represented the ability of cell cholesterol uptake. HCC cells were treated with different addressment, then changed to serum-free medium and incubated with 10ug/ml DIL-LDL at 37 °C for 5 h. The cells were detached by trypsin, washed and suspended by PBS and analyzed by flow cytometry using FL2 emission filter (FACScan, BD Biosciences, San Jose, CA, USA). Data were analyzed with FlowJo software.
Total RNA isolation and quantitative real-time quantitative PCR
Total RNA, containing miRNA, was isolated from HCC cells with TRIzol reagent (Invitrogen, CA, USA) according to the provided protocol. For mRNA analysis, complementary DNA was synthesized using reverse transcription reagent kit (TaKaRa, Japan) from RNA of 500 ng. Primers for PCR were shown in Table 1. Quantitative PCR amplification was performed by ABI7500 real-time fluorescent measurement system (Applied Biosystems, USA) using PCR amplification Kit (TaKaRa, Japan). Values are derived from at least 3 separate experiments performed in duplicate and normalized to β-actin expression. The 2-△△Ct method was used for the data analysis [18]. For miRNA analysis, the first-strand cDNA was synthesized using the reverse transcriptase with miRNAs-specific stem-loop primer (RiboBio, Guangzhou, China). PCR amplification was conducted in ABI7500 real-time fluorescent measurement system (Applied Biosystems, USA) using the Bulge-Loop miRNA qRT-PCR Starter Kit (RiboBio, Guangzhou, China) according to the protocol provided. The relative expression level of miRNA was normalized to that of endogenous control U6 by using 2-△△Ct method.
Table 1
Primers for PCR used in this study
Gene Name
Forward primer (5′ → 3′)
Reverse primer (5′ → 3′)
PCSK9
AGACCCACCTCTCGCAGTC
GGAGTCCTCCTCGATGTAGTC
LDLR
GCTACCCCTCGAGACAGATG
CACTGTCCGAAGCCTGTTCT
SREBF2
GGTTGTCGGGTGTCATGGG
TTGCAGCATCTCGTCGATGT
HMGCR
GAGCGTGCGTAAGGTGAGG
ACAGAATCCTTGGATCCTCCAG
IKKα
GGCTTCGGGAACGTCTGTC
TTTGGTACTTAGCTCTAGGCGA
TAB3
AGCAGCCCACAGCTTGATATT
ACTAGGAGAATGGATACCCAGGT
MiR-195
GTCATTCCCTATTTCTTCTGCC
ATTGGACCATCTTCCCTCTGT
VCAM1
GGGAAGATGGTCGTGATCCTT
TCTGGGGTGGTCTCGATTTTA
MMP9
GGAGGTTCGACGTGAAGG
GGAACATCCGGTCCACCT
IL8
AGACAGCAGAGCACACAAGC
ATGGTTCCTTCCGGTGGT
TNFα
CTCGAACCCCGAGTGACAA
GCTGCCCCTCAGCTTGAG
IκBα
CATTGACATCAGCACCCAAG
CCACTCCATCCTGAAGGCTA
P100
CTCCTCTAGGCCCATGTCAG
AGCCTGGTAGACACGTACCG
β-actin
CGTGGACATCCGTAAAGACC
ACATCTGCTGGAAGGTGGAC
Western blot
HCC cells were lysed in cell lysis buffer containing 1nM PMSF for 30 min at 4 °C. Lysates were collected by centrifugation at 12,000 rpm for 30 min at 4 °C. Proteins from cell lysates were separated on the SDS-PAGE and transferred onto PVDF membrane (Immobion-P Transfer Membrane, Millipore Corp., Billerica, MA, USA). The membrane was blocked with TBST containing 5% non-fat dry milk for 1 h and further incubated overnight at 4 °C with primary antibodies against PCSK9, LDLR, HMGCR, SREBF2 (Abcam, Cambridge, MA, USA), NF-κB p65, phospho-NF-κB p65, IKKα, TAB3 (Cell Signaling Technology, USA) and β-actin (Santa Cruz, CA, USA). After that, the membrane was incubated with horseradish peroxidase (HRP)-linked secondary antibodies (Santa Cruz Biotechnology, USA) for 2 h at room temperature. All protein bands were visualized using an electrochemiluminescence kit (Thermo, USA). Intensity of each protein band was quantified by Quantity One 4.6.2 software (Bio Rad).
MiRNA inhibitor or mimic transfection
For transfections in 12-well plates, the HCC cells were seeded at a density of 1 × 105 cells/well and incubated overnight and then transfected with 50 nM miR-195 mimic or 100 nM miR-195 inhibitor (GenePharma, Shanghai, China) using lipo2000 Transfection Agent (Invitrogen, USA) according to the manufacturer’s instructions. The corresponding negative sequence of mimic or inhibitors (GenePharma, Shanghai, China) were transfected with the same concentration as controls. At 24 h after the transfection, cells were harvested or further incubated with LPS (1000 ng/mL) for the following experiments.
RNA interference
Gene silencing was performed by infecting HCC cells with siRNA oligonucleotides (GenePharma, Shanghai, China). The siRNA sequences were shown in Table 2. For transfections in 12-well plates, 1.0 × 105 cells were seeded per well and incubated overnight, then transfected with 80nM TAB3-siRNA, IKKα-siRNA or negative sequence using lipo2000 Transfection Agent (Invitrogen, USA) according to the manufacturer’s protocol. At 24 h after the transfection, cells were harvested or further incubated with LPS (1000 ng/mL) for the following experiments.
Table 2
The sequences of siRNA used in this study
Identifier
Sense Primer Sequence (5′ → 3′)
Anti-sense Primer Sequence (3′ → 5′)
NC siRNA
CCACCUCUGAUCGAUUUAUdTdT
dTdTAUAAAUCGAUCAGAGGUGG
IKKα siRNA
GCAGGCUCUUUCAGGGACAdTdT
dTdTCGUCCGAGAAAGUCCCUGU
TAB3 siRNA
CCAAAGGUUCCAUGAAGAAdTdT
dTdTGGUUUCCAAGGUACUUCUU
ELISA
HCC cells were stimulated with LPS (1000 ng/ml) for 24 h in serum-free medium in the presence or absence of LDL (200ug/ml). The concentrations of IL-8 and TNF-α in culture supernatants were measured with ELISA kits (R&D Systems, USA) according to the manufacturer’s instruction. Absorbance was recorded at 450 nm using a microplate reader.
Statistical analysis
Data analysis was performed using SPSS16.0 statistical software (SPSS Inc, Chicago, IL). Student’s t-tests were used to assess significant differences among study groups. P < 0.05 was considered statistically significant. All experiments have been performed at least three times.
Results
Role of NF-κB signaling in cholesterol accumulation
To assess whether cholesterol metabolism could be affected by NF-κB pathway in HCC cells, we monitored intracellular cholesterol levels in response to LPS at dosages ranging from 0 to 1000 ng/ml in serum free (SF) medium or complete medium (CM) or CM with LDL loading (200 μg/ml). As shown in Fig. 1a and b, LPS significantly increased the intracellular cholesterol concentration in a dose-dependent manner in HepG2 and Huh7 HCC cells. And the effects were not affected by constitutive cholesterol levels. Furthermore, we found that uptake of 3,3′-dioctadecylindocarbocyanine-low density lipoprotein (DIL-LDL) in HCC cells was stimulated by LPS, suggesting that it may increase native LDL cholesterol uptake via LDLR (Fig. 1c and d).
×
Anzeige
Next, we examined the effect of LPS on the expression of proprotein convertase subtilisin/kexin 9 (PCSK9), LDLR, HMGCR and sterol regulatory element-binding transcription factor 2 (SREBF2) in HCC cells (Fig. 2a-c). After treatment with various concentrations of LPS for 24 h, PCSK9 mRNA and protein levels in HCC cells were significantly downregulated, and the expression of LDLR, HMGCR and SREBF2 were upregulated in a dose-dependent manner. In addition, LPS promotes the expression of IKKα, TAB3 and phosphorylated P65 (Fig. 2c), demonstrating the role of NF-κB pathway in HCC intracellular cholesterol accumulation.
×
IKKα and TAB3 regulates LPS-induced cholesterol accumulation
To further examine whether LPS mediated cholesterol accumulation by NF-κB pathway, we synthesized siRNAs specifically against nuclear factor kappa-B kinase subunit alpha (IKKα) and TGF-beta-activated kinase 1 and MAP3K7-binding protein 3 (TAB3) and overexpressed IKKα and TAB3 in HepG2 and Huh7 cells. The down- and up-regulated efficacy of TAB3 and IKKα was confirmed by quantitative real-time PCR and western blotting (Fig. 3a and b). Twenty-four hours after transfection, HCC cells were treated with LPS (1000 ng/ml) for 24 h, and PCSK9, LDLR, HMGCR, and SREBF2 expression, total cellular cholesterol levels, and uptake of DIL-LDL were measured at the endpoints. As expected, down-regulation of TAB3 and IKKα increased PCSK9 expression and decreased LDLR, HMGCR, and SREBF2 expression, while up-regulation of TAB3 and IKKα decreased PCSK9 expression and increased LDLR, HMGCR, and SREBF2 expression (Fig. 3c-e). Additionally, down-regulation of TAB3 and IKKα abrogated the effects of LPS on cholesterol accumulation (Fig. 4a–c). These findings indicated that TAB3 and IKKα were indeed functional in LPS-induced cholesterol accumulation.
×
×
MiR-195 regulates cholesterol accumulation and cholesterol-related gene expression induced by LPS
Previous findings have shown that miR-195 decreases the activity of NF-κB signaling and the expression of NF-κB downstream effectors by directly targeting TAB3 and IKKα [19]. To further investigate the involvement of NF-κB signaling in cholesterol metabolism, the cells overexpressing or knocking down miR-195 were established by transfecting with miR-195 mimic, mir-195 inhibitor. As shown in Fig. 5a, these cells achieved more than a 100-fold upregulation and 80% downregulation of mRNA expression, respectively (Fig. 5a). Twenty-four hours after transfection with miR-195 mimic, miR-195 inhibitor, or negative control, HCC cells were treated with 1000 ng/mL LPS for another 24 h and then analyzed for intracellular cholesterol levels and related gene expression. Relative to the controls, mRNA and protein expression levels of PCSK9 were downregulated by LPS, and LDLR, HMGCR, and SREBF2 expression was upregulated. Overexpression of miR-195 increased PCSK9 expression and decreased LDLR, HMGCR, and SREBF2 expression, while knockdown of miR-195 decreased PCSK9 expression and increased LDLR, HMGCR, and SREBF2 expression (Figs. 5b–d). In addition, overexpression of miR-195 inhibited the total intracellular cholesterol level (Fig. 6a and b) and DIL-LDL uptake (Fig. 6c). These data indicate that miR-195 negatively regulates LPS-induced cholesterol accumulation and expression of cholesterol-related genes.
×
×
Next, we investigated the phosphorylation status of p65 and the expression levels of TAB3 and IKKα, which were the direct gene targets of miR-195. We observed that overexpression of miR-195 significantly inhibited the phosphorylation status of p65 and the expression levels of TAB3 and IKKα, while knockdown of miR-195 increased the phosphorylation status of p65 and the expression levels of TAB3 and IKKα (Fig. 7), supporting our findings that NF-κB pathway played an important role in HCC intracellular cholesterol accumulation.
LDL, containing 49% cholesterol, could increases intracellular cholesterol contents in HCC cells (Fig. 8a). To elucidate the influence of cholesterol accumulation in inflammatory responses, we investigated the phosphorylation status of NF-κB signaling pathway and the expression levels of 20 NF-κB downstream effectors in the absence or presence of LDL loading. LPS at 1000 ng/ml activated NF-κB signaling pathway and stimulated the expression of NF-κB downstream effectors, while the phosphorylation level of p65 and IKKα (Fig. 8b) and the mRNA abundance of six effectors (Fig. 8c and d) and cytokines production (Fig. 8e and f) was further increased by LDL at 200ug/ml in both HepG2 and Huh7 cells. The data suggest that accumulated cholesterol increases LPS/NF-κB-induced inflammatory effects by increasing p-IKKα in HCC cells.
×
Discussion
HCC, among the most malignant of human cancers [20], develops in a complex microenvironment characterized by chronic inflammation [13, 14]. Emerging evidence has demonstrated that perpetuating hepatic inflammation promotes HCC initiation and progression [13, 21, 22]. Meanwhile, cholesterol metabolic abnormalities have been implicated the importance in cancer cell physiology in recent years [2‐4, 23]. However, the relationship between the aberrant cholesterol metabolism and inflammation in HCCs are not completely understood. In the present study, we demonstrated that LPS/NF-κB pathway induced a significant increase in the intracellular cholesterol concentration and in DIL-LDL uptake in HCC cells, suggesting a key role of NF-κB pathway in promoting cholesterol accumulation. Additionally, the cholesterol accumulation conversely promoted LPS/NF-κB-induced inflammatory effects, indicating a positive feedback of inflammation and cholesterol metabolism (Fig. 9).
×
MicroRNAs (miRNAs) are a class of small non-coding RNAs, which repress translation or induce cleavage of target mRNAs by base pairing with their 3′ untranslated regions. MiR-195 is a member of the miR-15/16/195/424/497 family [24]. It has been reported that miR-195 suppresses cancer development and is downregulated in multiple types of cancer, such as prostate [25, 26], lung [27], osteosarcoma [28], HCCs [29], and so forth. Genome-wide screening suggests that miR-195 mediates NF-κB activity by directly targeting the expression of IKKα TAB3 in HCCs [19]. Here, we demonstrated that not only miR-195 but also its targeted genes TAB3 and IKKα mediate LPS/NF-κB-induced cholesterol accumulation and cholesterol-related gene expression, providing further evidence that NF-κB pathway play an important role in HCC intracellular cholesterol accumulation.
PCSK9, the ninth member of the proteinase K subfamily of subtilases, plays an important role in post-transcriptional degradation of LDLR, which decreases intracellular cholesterol uptake [30‐32]. Decreased PCSK9 and increased LDLR expression have been demonstrated in HCC tissues, supporting a constant cholesterol supply in the HCC microenvironment [33]. HMGCR is the rate-limiting enzyme in de novo synthesis of cholesterol in vivo. Recent studies have reported that HMGCR is upregulated in several types of cancer including gastric [34], ovarian [7] and breast cancers [35], suggesting that HMGCR plays an oncogenic role. SREBF2 is a membrane-bound transcription factor that regulates cholesterol homeostasis in cells. It has been demonstrated that PCSK9, LDLR, and HMGCR expression are co-regulated by SREBF2 [36‐38]. When cholesterol levels fall, SREBF2 is activated to up-regulate the expression of genes responsible for cholesterol synthesis, such as HMGCR, and for cholesterol uptake, such as LDLR. In this study, the expression of PCSK9, LDLR, HMGCR, and SREBF2 were investigated in HCC cells after stimulation with LPS. We found that LPS significantly inhibited the expression of PCSK9 and increased LDLR, HMGCR, and SREBF2 expression, suggesting that LPS may increase native LDL cholesterol uptake via LDLR and promote de novo cholesterol synthesis via HMGCR.
Anzeige
There are growing evidences that cholesterol, as an important molecule, impacts upon cancer cell physiology, however, the concrete role of cholesterol in cancer progression remains elusive and controversial. Analyses of the cancer Genome Atlas (TCGA) database revealed a correlation between increased activity of the cholesterol synthesis pathway and decreased survival in patients with sarcoma, acute myeloid leukemia and melanoma [39, 40], supporting the concept that cholesterol promotes carcinogenesis. However, some epidemiological studies have reported objective observation that poor prognosis in HCC patients were linked to decreased serum cholesterol [41, 42]. In this study, we have suggested that cholesterol further activated the NF-κB signaling pathway and promotes the expression of NF-κB target genes, indicating the pro-inflammatory effects of cholesterol in HCC cells.
Conclusions
In summary, we have experimentally demonstrated that LPS/NF-κB signaling pathway triggers an increase in intracellular cholesterol levels by promoting the expression of HMGCR and LDLR in HCC cells. Cholesterol accumulation conversely promotes LPS/NF-κB induced pro-inflammatory effects. MiR-195, as a regulator of NF-κB pathway, inhibited cholesterol accumulation by decreasing the expression of TAB3 and IKKα. These data provide us with a better understanding of the relationship between LPS/NF-κB pathway and cholesterol abnormalities in cancer cells.
Acknowledgements
Not applicable.
Funding
This study was sponsored by grants from the National Natural Science Foundation of China (Nos. 81272732 and 81572395), the Shanghai Leading Talent Projects (No. 048, 2013), the Shanghai Leading Academic Discipline Project (Project Number: B115), and the Shanghai Science and Technology Commission (Project Number: 14XD1401100).
Availability of data and materials
Not applicable.
Authors’ contributions
JLX and LSW conceived and designed the study. MYH, WHZ, YYD performed the experiments. TTF, WQT, BL, GLC, BWY, PXH analyzed the data. All authors read and approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Consent for publication
Not applicable.
Ethics approval and consent to participate
Not applicable.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Nun gibt es auch Resultate zum Gesamtüberleben: Eine adjuvante Pembrolizumab-Therapie konnte in einer Phase-3-Studie das Leben von Menschen mit Nierenzellkarzinom deutlich verlängern. Die Sterberate war im Vergleich zu Placebo um 38% geringer.
Das Risiko für Rezidiv oder Tod von Patienten und Patientinnen mit reseziertem ALK-positivem NSCLC ist unter einer adjuvanten Therapie mit dem Tyrosinkinase-Inhibitor Alectinib signifikant geringer als unter platinbasierter Chemotherapie.
Patienten, die zur Behandlung ihres Prostatakarzinoms eine Androgendeprivationstherapie erhalten, entwickeln nicht selten eine Anämie. Wer ältere Patienten internistisch mitbetreut, sollte auf diese Nebenwirkung achten.
Müssen sich Schwangere einer Krebstherapie unterziehen, rufen Immuncheckpointinhibitoren offenbar nicht mehr unerwünschte Wirkungen hervor als andere Mittel gegen Krebs.
Update Onkologie
Bestellen Sie unseren Fach-Newsletterund bleiben Sie gut informiert.