Background
Oral cancer is one of the most common cancers worldwide, accounting for 2% of all cancer cases. Over 90% of oral malignancies were diagnosed as oral squamous cell carcinoma (OSCC), which arise from the epithelial mucosa of the oral cavity [
1‐
3]. Beyond genetic susceptibility caused by gene mutation, multiple environmental factors have been considered to contribute to the initiation of OSCC [
4]. Tobacco, alcohol, and betel nut chewing remain the major culprits with a well-established synergistic effect for the tumorigenesis of OSCC. The highest incidence of OSCC is observed in South Asian countries and regions, such as India, Sri Lanka, and the south-central of China, which are caused by the high rates of cigarette smoking and areca nut use in these areas [
5‐
7]. Although the improvements in early diagnosis and surgical treatment over the past decades, OSCC usually progresses rapidly and presents high mortality rates, especially in patients with an advanced stage, and no targeted therapy is used in clinic for OSCC treatment currently [
3,
6‐
9]. Thus, a better understanding of the mechanisms of OSCC oncogenesis and development of novel anti-tumor targets and drugs, are still the urgent demand for OSCC treatment.
Survivin is an evolutionarily conserved eukaryotic protein that plays a critical role in cell cycle G2/M transition and apoptosis inhibition [
10]. Together with the Aurora B kinase, survivin constitutes an integral component of chromosomal passenger complex (CPC) which guarantees proper chromosomes and segregation during mitosis [
10,
11]. Beyond the key role in cell division, as a member of the inhibitor of apoptosis protein family (IAPs), survivin is frequently overexpressed in human cancers and confers the unlimited cell proliferation and apoptosis resistance [
11‐
14]. Previous reported showed that survivin is predominantly localized in the cytoplasm of cancer cells and is generally believed to function as apoptotic suppressor to maintain survival of cancer cells. In contrast, the smaller fraction of nuclear localized survivin is considered to act as a component of CPC complex to promote cell cycle progression, suggesting that the different subcellular pools of survivin exhibit distinct biological functions [
13‐
16]. Thus, as an oncoprotein that is both essential for mitosis and apoptosis inhibition, survivin seemed a promising novel target for anti-cancer treatment. Although overexpression of survivin is positively correlated with poor prognosis in multiple human cancers, the function of survivin in human OSCC remains undefined.
In this study, we investigate the biological function of survivin in human OSCC cells. With a compound screening, we identified the natural product, xanthohumol, as a potential survivin inhibitor for OSCC treatment. We determined the anti-tumor effect of xanthohumol in OSCC cells and elucidate the underlying mechanisms using the in vitro and in vivo models.
Materials and methods
Reagents and cell culture
Chemical reagents, including DMSO, SDS, NaCl, and Tris base, were purchased from Sigma-Aldrich (St. Louis, MO). MG132 and cycloheximide (CHX) were obtained from Thermo Fisher Scientific (Waltham, MA). The DMEM, RPMI-1640 medium, and Fetal Bovine Serum (FBS) for cell culture were purchased from Invitrogen (Grand Island, NY). Human oral squamous cell carcinoma (OSCC) cells, including CAL27, SCC15, SCC25, and SCC9 were purchased from American Type Culture Collection (ATCC, Manassas, VA). The cells were maintained according to ATCC protocols in a 37 °C humidified incubator with 5% CO2. The ionizing radiation acquired resistance cell lines CAL27-IR and SCC25-IR were established in our laboratory by exposing CAL27 and SCC25 cells to gradually increasing dose of ionizing radiation for approximately 6 months. Briefly, CAL27 and SCC25 cells were serially irradiated with 2Gy of X-rays to a final dose of 80 Gy. Cells were cultured with DMEM medium and maintained at a 37 °C humidified incubator with 5% CO2. The irradiated cells were passaged into new culture flask when growing to approximately 80% confluence. Reirradiation of Xrays was repeated over a period of 6 months (starting at 2 Gy and ending with 8 Gy for each irradiation, the dose was gradually increased for each month by 2 Gy), for a total dose of 80 Gy. Immortalized oral epithelial cell hTERT-OME was purchased from Applied Biological Materials (ABM) Inc. (Richmond, BC, Canada). The HaCat cells were purchased form Thermo Fisher Scientific (Waltham, MA). All cells were subjected to mycoplasma analysis every 2 months. Primary antibodies against Survivin (#2808), cleaved-PARP (#9532), VDAC1 (#4661), Bax (#14796), cleaved-caspase 3 (#9664), cytochrome C (#11940), ubiquitin (#43124), β-actin (#3700), ubiquitin (#3936), p-Survivin Thr34 (#8888), α-tubulin (#3873), p-Akt Ser473 (#4060), p-Wee1 Ser642 (#4910), His-tag (#12698), HA-tag (#2367), p-CDK1 Tyr15 (#4539), and p-CDK1 Thr161 (#9114) were obtained from Cell Signaling Technology, Inc. (Beverly, MA). Antibodies against Ki67 (ab16667) and FbxL7 (#ab59149) were purchased from Abcam (Cambridge, UK). Flag-tag (F3165) antibody was obtained from Sigma Aldrich (St. Louis, MO). Lipofectamine® 2000 (Thermo Fisher Scientific) was used for plasmid transfection following the manufacturer’s instructions.
MTS assays
MTS assay was performed as described previously [
17]. Briefly, human OSCC cells were seeded in 96-well plates at a concentration of 2 × 10
3/well. Cells were treated with DMSO control or xanthohumol for various time points (0, 24, 48, and 72 h), cell viability was determined by MTS assay (G3581, Promega, Madison, WI).
Anchorage-independent cell growth
The anchorage-independent cell growth assay was performed as described previously [
18]. Briefly, the Eagle’s basal medium containing 10% FBS, 0.6% agar, and different concentration of xanthohumol was loading to a six-well plate as an agar base. Human OSCC cells were counted at the concentration of 8000 cells/ml and seeded into 6-well plates with 0.3% Basal Medium Eagle agar containing 10% FBS and xanthohumol. The cultures were maintained at 37 °C in a 5% CO
2 incubator for 2 weeks and colonies were counted.
Western blotting
Whole-cell extract (WCE) was prepared with RIPA buffer (#PI89901, Thermo Fisher Scientific) supplemented with protease inhibitors and concentrated by BCA protein assay. Western blotting was performed as previously described [
19]. Briefly, A total of 30 μg WCE was mixed with loading buffer and boiled at 95 °C for 5 min, followed by SDS-PAGE electrophoresis and electrotransfer. The non-fat milk (5%) was used for membrane blocking at room temperature for 30 min and the membrane was incubated with the primary antibody at 4 °C overnight. After incubation with anti-rabbit/mouse IgG HRP second antibody, the target protein was visualized by chemiluminescence.
Immunohistochemical staining (IHC)
The tissues from xenograft tumors were fixed in 10% neutral-buffered formalin and subjected to immunohistochemical staining as described previously [
20]. First, the tissue slides were deparaffinized, followed by rehydration using various concentrations of ethanol. Antigen retrieval was performed by boiling the slides with the sodium citrate buffer (10 mM, pH 6.0) for 10 min. The slides were incubated with 3% H
2O
2 in methanol for 10 min to deactivate endogenous peroxidase. After washing with PBS, slides were blocked with 50% goat serum albumin in PBS for 1 h at room temperature, followed by incubation with primary antibody (4 °C, overnight) and second antibody (room temperature, 45 min) in a humidified chamber. The target protein was visualized by DAB substrate and hematoxylin was used for counterstaining.
Natural compound screening
The 70 compounds of interest were selected from the Natural Product Library (Cat. No. L1400–01/02) from Selleck Chemicals (Houston, TX). CAL27 cells were seeded in a 96-well plate. After overnight incubation, cells were treated with 1 μM of DMSO (control) or natural compounds for 48 h. Cell viability was examined by the MTS assay. Tested compounds are listed in Supplementary Table
1.
Generation of survivin knockout stable cell lines
Two different single-guide RNAs (sgRNAs) were used to generate CRISPR-Cas9-based survivin knockout constructs (sgSurvivin#1forward, 5′- CAGTTTGAAGAATTAACCCT-3′, reverse, 5′-AGGGTTAATTCTTCAAACTG-3′, sgSurvivin#2 forward, 5′- GAACATAAAAAGCATTCGTC-3′, reverse, 5′-GACGAATGCTTTTTATGTTC-3′). The sgSurvivin plasmid was transiently transfected to the OSCC cells. Puromycin (1 μg/mL) was added to cell culture medium and maintained for 3 weeks for signal clone selection. The Fbxl7 siRNA (sc-62,306), Akt1/2 siRNA (sc-43,609), and siCtrl (sc-37,007) were purchased from Santa Cruz Biotechnology (Dalla, TX). The primers for survivin qRT-PCR analysis is forward: CCACTGAGAACGAGCCAGACTT, reverse: GTATTACAGGCGTAAGCCACCG.
Ubiquitination analysis
The Ubiquitination analysis was performed as described previously [
21]. Briefly, for endogenous ubiquitination detection, cells were lysed with modified RIPA buffer (20 mM NAP, pH 7.4, 150 mM NaCl, 1% Triton, 0.5% Sodium-deoxycholate, and 1% SDS) supplemented with 10 mM N-Ethylmaleimide (NEM) and protease inhibitors. The lysates were sonicated for 30 s, boiled at 95 °C for 15 min, and diluted with 0.1% SDS containing RIPA buffer, then centrifuged at 16000×g for 15 min at 4 °C. The supernatant was subjected to IP with survivin antibody, survivin ubiquitination was determined by IB analysis. For Nickel pull-down assay, cell lysates were prepared with lysis buffer (6 M guanidine-HCl, 0.1 M Na2HPO4/NaH2PO4, 0.01 M Tris/HCl, pH 8.0, 5 mM imidazole, and 10mMβ-mercaptoethanol) supplemented with protease inhibitors and 10 mM N-Ethylmaleimide (NEM). The lysates were sonicated for 30 s, followed by incubation with 50 ml Ni-NTA-agarose (QIAGEN Inc., Valencia, CA) for 4 h at room temperature. The beads were washed with specific washing buffer and boiled with 2 × SDS loading buffer containing 200 mM imidazole and subjected to western blotting.
Immunofluorescence (IF)
Cells (5 × 103/well) seeded in a chamber slide were treated with vehicle control, XN (5 μM, 24 h), IR (4 Gy), or a XN and IR combination. Cells were maintained in the incubator for another 72 h. Cells were fixed with 4% paraformaldehyde and permeabilized in 0.5% Triton X-100 for 20 min, followed by blocking in 5% BSA for 1 h and overnight incubation with γ-H2AX antibody at 4 °C in a humidified chamber. Alexa Fluor 488 dye-labeled anti-rabbit IgG was used as the secondary antibody. Nuclei were counterstained with DAPI (cat. #P36935, Thermo Fisher Scientific). The following antibodies were used for IF: γ-H2AX (cat. #ab11174, 1:100), goat anti-rabbit IgG Alexa Fluor 488 (cat. #ab150077, 1:500).
The cells were treated with vehicle control, XN, IR, or a XN and IR combination and seeded into a 6-cm plate (400 cells/well). The cultures were maintained for 2 weeks at 37 °C in a 5% CO2 incubator. The colonies were fixed with 4% paraformaldehyde, stained with 0.5% crystal violet, and counted under a microscope. Three independent experiments were performed as indicated.
In vivo tumor growth assay
The in vivo animal study was approved by the Institutional Animal Care and Use Committee (IACUC) of Central South University (Changsha, China). (2 × 106) cells were s.c.injected into the 6-week-old athymic nude mice (n = 6) at the right flank to generate the xenograft mouse model. Compound treatment was initiated when tumor volume reached at 100 mm3. Xanthohumol (10 mg/kg) was administrated by i.p. injection every 2 days, whereas the control mice were treated with vehicle control. For irradiation treatment, the tumor bearing mice were randomly divided into four groups (n = 6): 1,vehicle control (0.5% dimethyl sulfoxide, 100 mL/every 2 days, i.p.); 2, local ionizing radiation (2 Gy/ twice per week, irradiated with X-rays using X-RAD 320, Precision X-ray, Inc.,); 3, Xanthohumol (10 mg/kg/ every 2 days, i.p.); 4, Xanthohumol (10 mg/kg/ every 2 days, i.p.) + local ionizing radiation (2 Gy/ twice per week). Tumor volume was recorded with and determined with the formula: length × width × width/2. Tumor mass was subjected to IHC staining.
Blood analysis
The EDTA-coated tubes were used for Mouse blood collection by cardiac puncture. The red blood cells (RBC), hemoglobin (Hb), white blood cells (WBC), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and blood urea nitrogen (BUN) were analyzed at the Laboratory of the Third Xiangya Hospital of Central South University (Changsha, Hunan, China).
Statistical analysis
The statistical analysis was conducted with GraphPad Prism 5 (San Diego, CA). The Student’s t-test or one-way ANOVA was used to evaluate the difference between tested groups, and a probability value of p < 0.05 was used as the criterion for statistical significance. The experiment was performed triplicate, and all quantitative data are expressed as mean ± sd.
Discussion
As the smallest member of the IAP family protein, survivin is frequently overexpressed in human cancers, including lung [
24], prostate [
25], colorectal [
25], breast [
26], ovarian [
27], and liver [
28] cancer. Previous studies have revealed that beyond regulation of cell division and mitosis, overexpression of survivin in cancer cells inhibits both extrinsic and intrinsic apoptosis signaling. Even the underlying mechanisms of survivin-mediated apoptosis suppression remains unclear, the interaction between survivin and the initiator or effector caspases directly or indirectly is considered to contribute to this process [
10]. Importantly, the C-terminus of survivin is dispensable for cell division, whereas the N- terminus is required for apoptosis [
29]. Moreover, a high level of survivin is related to enhanced angiogenesis, tumor invasion and metastasis, and chemo/radioresistance, and downregulation of survivin reversed these functions [
25,
30,
31]. For example, overexpression of survivin confers insulin-like growth factor-induced lapatinib resistance in head and neck squamous carcinoma cells (HNSCC) [
32]. Knockdown of survivin or pharmaceutical inhibition of survivin suppressed metastasis of ovarian cancer [
27]. Furthermore, reduction of survivin expression by Brexpiprazole sensitizes glioma cells to osimertinib treatment [
33]. In addition, suppression of survivin promotes the tumor-killing effect of radiotherapy in prostate cancer [
34] and head and neck squamous cell carcinoma (HNSCC) [
35,
36]. In the present study, we found that survivin is highly expressed in OSCC tumor tissues and cells, depletion of survivin expression by sgRNA blunted the malignant phenotypes in OSCC cells, including in vitro cell proliferation, colony formation, and in vivo tumor development. This evidence indicates that survivin is a promising target for OSCC clinical treatment in the future.
The expression of survivin in human cancer cells is tightly controlled at multiple levels, including transcription, translation, and posttranslational modification [
10]. A panel of prooncogenic transcription factors, such as Sp1, NF-kB, STAT3, E2F1, and KLF5, have been demonstrated to bind with survivin promoter and enhance survivin expression in various tumors, whereas p53, forkhead box O3 (FOXO3), and early growth response 1 transcription factor (Egr-1) are negative regulators of survivin [
10,
37]. Beyond transcriptional and translational regulation, recent reports revealed that survivin undergoes various posttranslational modifications, including phosphorylation, acetylation, and ubiquitination. Phosphorylation is required for survivin stabilization, subcellular trafficking, and biological activation. Several protein kinases have been demonstrated to phosphorylate survivin on multiple sites, such as Aurora-B kinase, polo-like kinase (Plk1), protein kinase A (PKA), cyclin-dependent kinase 1 (Cdk1), and casein kinase II (CKII) [
10]. Phosphorylation on Thr34 is required for prevention of ubiquitination-induced survivin destruction [
38]. Our data showed that the natural compound, xanthohumol, inhibited survivin Thr34 phosphorylation in an Akt-Weel-CDK1 signaling dependent manner. Mutation of Thr34 to Ala promoted survivin ubiquitination and reduced protein half-life, which may contribute to xanthohumol-mediated anti-tumor activity in vitro and in vivo. However, based on our current data, we could not exclude the possibility that xanthohumol reduced survivin phosphorylation on other serine or threonine sites. It would be interesting to figure out the downstream kinase targets of xanthohumol and identify other phosphorylation sites that are required for survivin stabilization.
Previous studies showed that the ubiquitin-proteasome pathway induces survivin degradation in a cell cycle-dependent manner [
39]. So far, two E3 ligases, X-linked inhibitor of apoptosis (XIAP) and F-box Protein Fbxl7, have been identified to play key roles in the regulation of survivin stability. XIAP interacts with X-linked inhibitor of apoptosis (XIAP)-associated factor 1 (XAF1) and activates its E3 ligase activity to catalyze survivin ubiquitination and facilitates apoptosis [
40]. Fbxl7 directly induces survivin ubiquitylation and degradation to orchestrate mitochondria function [
22]. Furthermore, Aurora-A kinase promotes survivin stability through transcriptional and translational regulation of Fbxl7 expression in gastric cancer [
41]. Exception of lysine-48 mediated survivin ubiquitination is required for degradation, lysine-63 linked polyubiquitination chains regulate chromosome alignment and segregation in mitosis. Lysine-63 de-ubiquitination of survivin by hFAM is required for the dissociation of survivin from centromeres. In contrast, ubiquitin-binding protein Ufd1 promoted lysine-63 ubiquitination is required for the association of survivin with centromeres [
42]. Importantly, the deubiquitinase, such as CSN5/Jab1, which removes the K-48 linked ubiquitination chains from survivin, stabilized survivin and promotes non-small cell lung cancer cell growth [
43]. Likewise, the ubiquitin-like protein FAT10 promotes bladder cancer progression by deubiquitination and stabilization of survivin[
44]. Our data showed that the natural compound, xanthohumol, reduced survivin protein level by enhancing Fbxl7-mediated ubiquitination and degradation. Xanthohumol promoted the interaction between Fbxl7 and survivin, which in turn facilitated Fbxl7-mediated survivin destruction and decreased survivin expression in OSCC cells. This mechanism is different from the current survivin suppressant YM155. YM155 robustly inhibits survivin activity via disruption of Sp1-DNA interaction in the survivin core promoter, thus inhibits survivin transcription [
45], whereas xanthohumol is a potential survivin inhibitor which regulates survivin expression through posttranslational modification. Our data suggest that enhancement of the E3 ligase-mediated ubiquitination and reduction of protein stability is a promising anti-tumor strategy for cancer treatment, and xanthohumol exhibited the potential to be used as a proteolysis targeting chimeras (PROTACs) [
46] for novel therapeutic modality in drug discovery.
Xanthohumol is one of the most abundant prenylated flavonoids in hops (
Humulus lupulus L.). Pharmacology studies showed that xanthohumol exhibits multiple biological functions, including anti-inflammatory, antioxidant, antibacterial, and antiviral activity [
47]. Recently, accumulating evidence indicates that xanthohumol possesses the potent anti-cancer efficacy in various tumor models, such as hepatocellular carcinoma, leukemia, melanoma, non-small cell lung cancer, colorectal, ovarian, pancreatic, and cervical cancer [
48]. Mechanistic studies revealed that induction of cell cycle arrest, inhibition of glycolysis, promotion of DNA damage and apoptosis, and suppression of angiogenesis/metastasis contribute to the anti-tumor activity of xanthohumol [
48‐
50]. Beyond that, the combination of xanthohumol with other therapeutic agents enhanced the tumor-killing effect of chemotherapy in various tumor models [
51‐
53]. In this study, we unexpectedly discovered that xanthohumol promoted survivin ubiquitination and degradation, which is required for xanthohumol-mediated tumor suppression in OSCC cells. Importantly, in combination with radiation, xanthohumol overcomes radioresistance in OSCC xenograft tumors. These findings extend our understanding of the anti-tumor mechanisms of xanthohumol and offer a novel alternative opportunity for cancer treatment.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.