Skip to main content
Erschienen in: Virology Journal 1/2018

Open Access 01.12.2018 | Research

Quantification and kinetics of viral RNA transcripts produced in Orthohantavirus infected cells

verfasst von: Julia Wigren Byström, Jonas Näslund, Fredrik Trulsson, Magnus Evander, Olivia Wesula Lwande, Clas Ahlm, Göran Bucht

Erschienen in: Virology Journal | Ausgabe 1/2018

Abstract

Background

Rodent borne viruses of the Orthohantavirus genus cause hemorrhagic fever with renal syndrome among people in Eurasia, and hantavirus cardiopulmonary syndrome in the Americas. At present, there are no specific treatments or efficient vaccines against these diseases. Improved understanding of viral transcription and replication may instigate targeted treatment of Orthohantavirus infections. For this purpose, we investigated the kinetics and levels of viral RNA transcription during an ongoing infection in-vitro.

Methods

Vero E6 cells were infected with Puumala Orthohantavirus (strain Kazan) before cells and supernatants were collected at different time points post infection for the detection of viral RNAs. A plasmid containing primer binding sites of the three Orthohantavirus segments small (S), medium (M) and large (L) was constructed and standard curves were generated to calculate the copy numbers of the individual transcripts in the collected samples.

Results

Our results indicated a rapid increase in the copy number of viral RNAs after 9 h post infection. At peak days, 2–6 days after infection, the S- and M-segment transcripts became thousand and hundred-fold more abundant than the copy number of the L-segment RNA, respectively. The presence of viral RNA in the cell culture media was detected at later time-points.

Conclusions

We have developed a method to follow RNA transcription in-vitro after synchronous infection of Vero cells. The obtained results may contribute to the understanding of the viral replication, and may have implications in the development of antiviral drugs targeting transcription or replication of negative stranded RNA viruses.
Hinweise

Electronic supplementary material

The online version of this article (https://​doi.​org/​10.​1186/​s12985-018-0932-8) contains supplementary material, which is available to authorized users.
Abkürzungen
Gn and Gc
Amino- and carboxy-terminal portions of the polyprotein
HCPS
Hantavirus cardiopulmonary syndrome
HFRS
Hemorrhagic fever with renal syndrome
Kz
Puumala Orthohantavirus strain Kazan
MOI
Multiplicity of infection
N protein
Nucleocapsid protein
nt
Nucleotide
PBMC
Peripheral blood mono-nucleated cells
PUUV
Puumala Orthohantavirus
qRT-PCR
Quantitative real-time PCR
RdRp
RNA-dependent RNA polymerase
RNP
Ribonucleoproteins
UmU
Puumala Orthohantavirus strain Umea/hu

Background

Orthohantavirus genus in the hantaviridae family comprises more than 20 rodent borne viruses pathogenic to humans. Rodents, bats, moles and shrews have been recognised to carry distinct members of the Orthohantavirus genus [1]. The geographical distribution of the various strains of these viruses follow the distribution of the respective animal species [2]. Humans acquire infection via inhalation or direct contact with rodent faeces, urine and saliva. Globally, 150–200,000 persons are infected each year [3, 4]. The virus infects the endothelium of various organs with symptoms of disease mainly from the kidneys and lungs [4]. Consequently, Orthohantavirus infections may lead to hemorrhagic fever with renal syndrome (HFRS) in Europe and Asia, or to the more lethal hantavirus cardiopulmonary syndrome (HCPS) in the Americas. The severe forms of HFRS has a case fatality rate of up to 12%, whereas the milder forms vary between 0.08% to 0.4% [5]. In Europe, more than 10,000 cases of HFRS are diagnosed annually, with increasing numbers, most of these cases are caused by Puumala Orthohantavirus (PUUV) [5]. HFRS caused by PUUV infection is characterized by symptoms such as fever, headache and abdominal pain with cardiovascular and gastrointestinal involvement [6, 7]. There are no efficient vaccines or specific treatments available against Orthohantavirus infections, which is highly needed due to the emergence of these potentially life-threatening diseases. To facilitate development of antivirals against Orthohantaviruses, a detailed understanding of the viral replication is required.
Orthohantavirus genomes are tri-segmented negative single-stranded RNA consisting of the Small (S), Medium (M) and Large (L) RNA segments [8, 9]. The S-segment encodes the nucleocapsid (N) protein consisting of 429–433 amino acid residues (about 50 kDa in size) and appears to be conserved between different Orthohantaviruses. The N protein plays a pivotal role in the life cycle of the virus and is the major antigen for the immune response, and abundantly expressed during the early phases of infection [2, 10]. The N protein coats the viral RNAs and protects it from degradation. All viral RNA segments are coated with the N protein by forming ribonucleoproteins (RNPs), thus establishing a favourable environment for replication, transcription and virus assembly. The RNPs are subsequently enclosed by an envelope consisting of a lipid bilayer with the surface glycoproteins embedded. This viral envelope is derived from the host cell membrane during the budding process of the virus. Each functional virion contains genomic RNA of the three segments, with molecules of the viral RNA-dependent RNA polymerase (RdRp) being attached to the viral RNA segments (Fig. 1). However, the generation and isolation of reassortant clones, and unstable diploid genomes, have been produced and isolated in-vitro [11, 12].
The M-segment encodes a polyprotein that is cleaved post translation into the glycoproteins Gn and Gc (N- and C-terminal portions of the polyprotein). These proteins, about 73 kDa and 56 kDa in size, are found at the surface of the cell and acquired by budding of viral ribonucleocapsids through the cellular membrane. This step enables enveloped viruses to cross the membrane barrier of cells. In a similar manner, the viral envelope permit viruses to enter cells discreetly through receptor attachment and virus-cell membrane fusion. Following endocytosis, these enveloped RNA viruses are directed to the endosomal compartment where a pH-dependent conformational change of the viral envelope glycoproteins mediate the fusion between the viral and endosomal membranes. Hence, viral envelopes allow virus assembly and disassembly during cell exit and entry, respectively. This striking duality is crucial for virus cell-to-cell transmission and dissemination within hosts [9, 1315].
The L-segment is in average the most conserved part of the genome sequence of Orthohantavirus and encodes the RNA-dependent RNA polymerase (RdRp), the L protein (~ 240 kDa) [16]. This viral polymerase, possess transcriptase, replicase and endonuclease functions, but lacks the capacity to synthesize 5′cap sequences [9, 13, 14]. Similar to RdRp of related viruses, Orthohantavirus L protein acquires 5′cap sequence from cellular mRNA transcripts by a mechanism called “cap snatching”. The resulting short oligonucleotides containing the 5′cap is then used by the RdRp as a primer for synthesis of viral transcripts. While translation of mRNA requires a cap primer to allow translation of viral proteins, replication copies of the entire template does not depend on primers for initiation.
In this paper, we have investigated the kinetics and levels of viral RNA encoded from the three different segments at different time-points after synchronous infection of cells. Our findings may provide new insights into the Orthohantavirus replication cycle. Despite the diversity in the infection cycle of many negative stranded RNA viruses, we are hopeful that there are common mechanisms that can be targeted by anti-viral inhibitors. As it is challenging to develop drugs against each of these viruses, antiviral agents with broad spectrum antiviral activity could be the prime strategy to cope with this challenge [17].

Methods

DNA constructs and preparation of RNA standards

Sequences from PUUV strain Umea/hu, [18, 19] and PUUV strain Kazan [20] containing the S-segment nucleotides 80–326; M-segment (nt 37–438 and 3178–3357) and L-segment (nt 2640–2736 and 2935–3385), (Fig. 2a) were produced by Eurofins, MWG Operon, Germany, (Additional file 1: Figure S1). The above primer binding regions of the three segments were selected as target sequences for primers, and cloned side-by-side into the pCR™II-TOPO® vector (Invitrogen, Carlsbad, CA, US) resulting in the plasmid pCR™II-TOPO®pUmU/Kz, (Fig. 2b).
Primer pairs were designed and evaluated against the above sequences, and pairs giving the lowest Ct value against the corresponding S-, M- and L- regions are shown in Table 1. The primer pairs were designed with the aim of having approximately the same melting temperature (Tm), and minimizing primer dimer formation and self-annealing loops (cut-off values of − 5 kcal/mol for the Gibbs free energy [ΔG] of oligonucleotide interactions). Primer dimer interactions were investigated using Oligo Analyser 3.0 online tool (Integrated DNA Technologies, Inc.) and the predicted Tm and oligonucleotide interactions were found using the internet based software OligoCalc [21]. The selected primers were finally used for quantitative real-time PCR (qRT-PCR) of PUUV strain Kazan infected cells.
Table 1
Primers towards the S, M and L segments of PUUV
Segment
Primer name
Sequence
Binding
S-Primer
PuKzSF2
GAARTGGACCCGGATGACGTTAAC
139–162
PuKzSR2
CKGGACACAGCATCTGCCATTC
233–254
M-Primer
PuKzMF1
AACTTAGTCCAGTTTGTCTGTATCTG
48–73
PuKzMR1
CCAATAGTRTGTGGACATTCCATTTT
131–156
L-Primer
PuKzLF1
CAAAGGGCACAAGCAAGAATTGTTAG
2659–2684
PuKzLR3
GTWATAAAAAAACCTCTATCAGC
2704–2726
The plasmid pCR™II-TOPO®pUmU/Kz containing equal proportions of the primer binding sites of the S-, M- and L-segments of PUUV strain Umea/hu and PUUV strain Kazan virus was linearized using EcoRV, downstream the SP6 promoter and the insert, and subsequently used for RNA transcription by the Riboprobe Combination System SP6/T7 RNA Polymerase (Promega, Wisconsin, USA), essentially as described before [22]. Finally, the DNA was removed after transcription with RNase free DNase, as specified in the protocol for Riboprobe Combination System SP6/T7 RNA Polymerase, and the concentration of the produced RNA was determined using a NanoDrop® ND-1000 Spectrophotometer (Saveen Werner, Malmö, Sweden). The RNA copy numbers were calculated from the obtained results, and diluted to a fixed concentration (1010 copies per mL) before storage at − 80 °C. Standardized amounts of in-vitro produced RNA was used in combination the S, M and L primers and qRT-PCR to produce three standard curves, one for each segment sequence. The obtained standard curves were finally used to calculate the copy numbers of S-, M- and L-segments in samples of infected cells.

Cell culture, infections and RNA isolation

Twenty-four well plates were seeded with 170,000 cells per well (Vero E6, ATCC® CRL-1586). The cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Sigma-Aldrich, St. Louis, MO, USA) containing 4.5 g/L D-glucose, 20 mM HEPES, 5% Fetal Bovine Serum (FBS), 0.75 g/L sodium bicarbonate and penicillin streptomycin at 37 °C, in a humidified atmosphere containing 5% CO2. The following day PUUV strain Kazan virus was diluted in serum free DMEM and used to infect cells at a multiplicity of infection (MOI) of 10, in a total volume of 200 μL in each well. After 2 h incubation at 37 °C, the media was removed and the cells were washed four times with 1 mL serum free DMEM per well before 1 mL DMEM containing 2% FBS was added. At indicated time points the supernatants and the carefully washed cells were collected separately and kept frozen at − 80 °C until analysis. The cells from individual wells were lysed in 350 μL RA1 Lysis Buffer (Macherey-Nagel GmbH & Co. KG, Düren, Germany) containing 3.5 μL β-mercaptoethanol. Total RNA was extracted and purified from cell lysates using a Nucleospin RNA kit (Macherey-Nagel GmbH & Co. KG) and from cell culture media using QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) according to the instruction of the manufacturer. The RNA of each sample was collected in 60 μL RNase free water.

PCR conditions

The RNA expression levels of S-, M- and L-segments were quantified by qRT-PCR (StepOnePlus Real-Time PCR System, Applied Biosystems, Foster City, CA, USA) using the primers described in Table 1. The qRT-PCR was carried out in multiplate® PCR plates™ 96-well, clear wells (Bio-Rad Laboratories, Hercules, Ca, USA Inc.) containing 2 μL RNA, 200 nM of each primer, 12 μL of KAPA master mix components (KAPA SYBR® Fast Universal One-Step qRT-PCR Kit, KAPA Biosystems, Boston, MA, USA), and water to a final volume of 20 μL. The PCR cycling condition consisted of an initial 5 min incubation at 42 °C, for cDNA synthesis and 5 min at 95 °C for enzyme activation. This was followed by 40 cycles, each consisting of a denaturation step at 95 °C, for 3 s and an annealing/extension step at 60 °C for 25 s.

Results

Using a selection of primer pairs (Table 1), designed against the different PUUV RNAs, and predetermined copy numbers of in-vitro transcribed RNA, three amplification curves were produced, one from each of the S-, M- and L-segment primer pairs, (Fig. 3). The three nearly parallel curves, indicated a similar efficiency of amplification, from about 2000 copies of M- and L-transcripts and S transcripts to 2 × 108 copies, when using the in-vitro produced RNA and the S-, M- and L-segment specific primer pairs.
When the kinetics of viral RNA production was analysed in Vero E6 cells infected with a MOI of 10 with PUUV strain Kazan, and the copy numbers of each of the three RNAs at different time points post infection was determined by qRT-PCR, the results indicated an increase in viral RNA production 9 h post infection. We noticed that the maximum copy number of transcripts from the S-segment and L-segments was found at day 2 with close to 2 billion (1.95 × 109) copies/mL (S-segment) and nearly 1.5 million (1.43 × 106) copies/mL (L-segment), with a decline after 2–3 days (Fig. 4).
The M transcripts reached its maximum (1.72 × 108 copies/mL) later, at day 8. Interestingly, in contrast to the rapid appearance and decline of the L transcripts, the RNA produced from the S- and M-segments showed a prolonged period of transcription, (Fig. 4a-c). At peak days, the transcripts of the S- and M-segments became thousand and hundred-fold more abundant than transcripts of the L-segment, respectively (Figs. 4 and 5).
The RNA content in the supernatant of the infected cells was also analysed in parallel with the samples of the cells to follow the secretion of virions into the cell culture media. As shown by the graphs, a lower quantity of viral RNA copies was detected in the cell culture media during the timeframe of the experiments, in comparison to the corresponding samples of the cells. These results indicated a similar trend as observed from the infected cells, but the increase in number of viral RNA copies in the cell culture media became apparent later, after 24 h of post infection, (Fig. 4d-f).

Discussion

The kinetics of viral replication specifically Orthohantaviruses needs to be investigated further, and there is lack of published data on the virus replication mechanisms that can support our current study.
In this study, an investigation of the kinetics and levels of individual RNAs of PUUV strain Kazan was conducted after synchronous infection of Vero E6 cells, as a marker for Orthohantavirus replication. Our results showed a rapid increase in viral RNA production in all samples of infected cells. Interestingly, the transcripts of the S- and M-segments became more abundant than transcripts of the L-segment both within the cell and in the cell supernatant. However, the viral RNA in supernatants were in general at lower levels. Virions with at least one S, M and L segment will be able to produce progeny virions upon infection, but we do not know the frequency of complete Orthohantavirus virions from our study. On the other hand, co-infection with complementing particles may result in productive infection, and for another 3-segmented negative sense RNA virus, Rift Valley fever virus, the majority of produced virions lacked one or more genome segments [23].
The differences in the kinetics and levels of transcription/replication may reflect the requirement of viral components during the synthesis and release of new virus particles. As an example, the delayed and prolonged viral RNA production from the M-segment, in comparison to the other segments, might reflect the need for the glycoproteins at later stages of viral replication. Thereafter, the transcription/replication of the different viral RNAs stagnated at different copy numbers and decreased thereafter. The reduction of RNA copy numbers, after reaching the plateau values, could be the result of cell death and release of nucleases resulting in degradation of viral RNA. This post transcriptional degradation may influence the observed levels and ratios of the different RNAs, both in the cell lysates and RNA in the cell culture media.
We believe that our key findings could provide a basis for a better understanding of the replication kinetics of viral RNA transcripts across the different segments of Orthohantavirus. This may aid in the search for useful therapeutic compounds which may yield to better patient management and novel treatments.

Conclusions

We have developed a method to follow Orthohantavirus transcription/replication in-vitro after synchronous infection of Vero cells. By using our method we can monitor the production and levels of the individual viral RNAs of the RNPs during an ongoing infection.

Acknowledgements

This study was supported by grants from: the Medical Faculty, Umeå University; the County Council of Västerbotten; the Swedish Foundation for Strategic Research; the Swedish Forum for Biopreparedness Diagnostics (FBD) and the Swedish Defence Research Agency, CBRN Defence and Security, Umeå, Sweden. The authors would like to thank Iris Spyckerelle for technical assistance, Dr. Jonas Klingström for the Puumala Orthohantavirus strain Kazan virus strain and Marie Lindkvist for the schematic picture of a Orthohantavirus particle.

Funding

Not applicable.

Availability of data and materials

Not applicable.

Authors’ information

Not applicable.
Not applicable.
Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Holmes EC, Zhang YZ. The evolution and emergence of hantaviruses. Curr Opin Virol. 2015;10:27–33.CrossRefPubMed Holmes EC, Zhang YZ. The evolution and emergence of hantaviruses. Curr Opin Virol. 2015;10:27–33.CrossRefPubMed
2.
Zurück zum Zitat Jonsson CB, Figueiredo LT, Vapalahti O. A global perspective on hantavirus ecology, epidemiology, and disease. Clin Microbiol Rev. 2010;23:412–41.CrossRefPubMedPubMedCentral Jonsson CB, Figueiredo LT, Vapalahti O. A global perspective on hantavirus ecology, epidemiology, and disease. Clin Microbiol Rev. 2010;23:412–41.CrossRefPubMedPubMedCentral
3.
Zurück zum Zitat Bi Z, Formenty PB, Roth CE. Hantavirus infection: a review and global update. J Infect Dev Ctries. 2008;2:3–23.CrossRefPubMed Bi Z, Formenty PB, Roth CE. Hantavirus infection: a review and global update. J Infect Dev Ctries. 2008;2:3–23.CrossRefPubMed
4.
Zurück zum Zitat Manigold T, Vial P. Human hantavirus infections: epidemiology, clinical features, pathogenesis and immunology. Swiss Med Wkly. 2014;144:w13937.PubMed Manigold T, Vial P. Human hantavirus infections: epidemiology, clinical features, pathogenesis and immunology. Swiss Med Wkly. 2014;144:w13937.PubMed
5.
Zurück zum Zitat Vaheri A, Henttonen H, Voutilainen L, Mustonen J, Sironen T, Vapalahti O. Hantavirus infections in Europe and their impact on public health. Rev Med Virol. 2013;23:35–49.CrossRefPubMed Vaheri A, Henttonen H, Voutilainen L, Mustonen J, Sironen T, Vapalahti O. Hantavirus infections in Europe and their impact on public health. Rev Med Virol. 2013;23:35–49.CrossRefPubMed
6.
Zurück zum Zitat Eckerle I, Jakob E, Hofmann J, Schmidt-Bacher A, Ettinger J, Schnitzler P. Atypical severe Puumala hantavirus infection and virus sequence analysis of the patient and regional reservoir host. Zoonoses Public Health. 2012;59(Suppl 2):110–5.CrossRefPubMed Eckerle I, Jakob E, Hofmann J, Schmidt-Bacher A, Ettinger J, Schnitzler P. Atypical severe Puumala hantavirus infection and virus sequence analysis of the patient and regional reservoir host. Zoonoses Public Health. 2012;59(Suppl 2):110–5.CrossRefPubMed
7.
Zurück zum Zitat Vapalahti O, Mustonen J, Lundkvist A, Henttonen H, Plyusnin A, Vaheri A. Hantavirus infections in Europe. Lancet Infect Dis. 2003;3:653–61.CrossRefPubMed Vapalahti O, Mustonen J, Lundkvist A, Henttonen H, Plyusnin A, Vaheri A. Hantavirus infections in Europe. Lancet Infect Dis. 2003;3:653–61.CrossRefPubMed
8.
Zurück zum Zitat Balsara JJ, Bapat TR, Gada VP, Nandal NV. Chandorkar AG: effect of ergometrine on methamphetamine and apomorphine stereotypy in the guinea-pig. J Pharm Pharmacol. 1985;37:514–7.CrossRefPubMed Balsara JJ, Bapat TR, Gada VP, Nandal NV. Chandorkar AG: effect of ergometrine on methamphetamine and apomorphine stereotypy in the guinea-pig. J Pharm Pharmacol. 1985;37:514–7.CrossRefPubMed
9.
Zurück zum Zitat Ganaie SS, Mir MA. The role of viral genomic RNA and nucleocapsid protein in the autophagic clearance of hantavirus glycoprotein Gn. Virus Res. 2014; Ganaie SS, Mir MA. The role of viral genomic RNA and nucleocapsid protein in the autophagic clearance of hantavirus glycoprotein Gn. Virus Res. 2014;
10.
Zurück zum Zitat Vapalahti O, Kallio-Kokko H, Narvanen A, Julkunen I, Lundkvist A, Plyusnin A, Lehvaslaiho H, Brummer-Korvenkontio M, Vaheri A, Lankinen H: Human B-cell epitopes of Puumala virus nucleocapsid protein, the major antigen in early serological response. J Med Virol 1995, 46:293-303. Vapalahti O, Kallio-Kokko H, Narvanen A, Julkunen I, Lundkvist A, Plyusnin A, Lehvaslaiho H, Brummer-Korvenkontio M, Vaheri A, Lankinen H: Human B-cell epitopes of Puumala virus nucleocapsid protein, the major antigen in early serological response. J Med Virol 1995, 46:293-303.
11.
Zurück zum Zitat Handke W, Oelschlegel R, Franke R, Wiedemann L, Kruger DH, Rang A. Generation and characterization of genetic reassortants between Puumala and Prospect Hill hantavirus in vitro. J Gen Virol. 2010;91:2351–9.CrossRefPubMed Handke W, Oelschlegel R, Franke R, Wiedemann L, Kruger DH, Rang A. Generation and characterization of genetic reassortants between Puumala and Prospect Hill hantavirus in vitro. J Gen Virol. 2010;91:2351–9.CrossRefPubMed
12.
Zurück zum Zitat Rizvanov AA, Khaiboullina SF, St Jeor S. Development of reassortant viruses between pathogenic hantavirus strains. Virology. 2004;327:225–32.CrossRefPubMed Rizvanov AA, Khaiboullina SF, St Jeor S. Development of reassortant viruses between pathogenic hantavirus strains. Virology. 2004;327:225–32.CrossRefPubMed
13.
Zurück zum Zitat Hepojoki J, Strandin T, Lankinen H, Vaheri A. Hantavirus structure--molecular interactions behind the scene. J Gen Virol. 2012;93:1631–44.CrossRefPubMed Hepojoki J, Strandin T, Lankinen H, Vaheri A. Hantavirus structure--molecular interactions behind the scene. J Gen Virol. 2012;93:1631–44.CrossRefPubMed
14.
Zurück zum Zitat Muyangwa M, Martynova EV, Khaiboullina SF, Morzunov SP, Rizvanov AA. Hantaviral proteins: structure, functions, and role in hantavirus infection. Front Microbiol. 2015;6:1326.CrossRefPubMedPubMedCentral Muyangwa M, Martynova EV, Khaiboullina SF, Morzunov SP, Rizvanov AA. Hantaviral proteins: structure, functions, and role in hantavirus infection. Front Microbiol. 2015;6:1326.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Cifuentes-Munoz N, Salazar-Quiroz N, Tischler ND. Hantavirus Gn and Gc envelope glycoproteins: key structural units for virus cell entry and virus assembly. Viruses. 2014;6:1801–22.CrossRefPubMedPubMedCentral Cifuentes-Munoz N, Salazar-Quiroz N, Tischler ND. Hantavirus Gn and Gc envelope glycoproteins: key structural units for virus cell entry and virus assembly. Viruses. 2014;6:1801–22.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Plyusnin A, Elliott RM. Bunyaviridae : molecular and cellular biology. Norfolk, UK: Caister Academic Press; 2011. Plyusnin A, Elliott RM. Bunyaviridae : molecular and cellular biology. Norfolk, UK: Caister Academic Press; 2011.
17.
Zurück zum Zitat Debing Y, Neyts J, Delang L. The future of antivirals: broad-spectrum inhibitors. Curr Opin Infect Dis. 2015;28:596–602.CrossRefPubMed Debing Y, Neyts J, Delang L. The future of antivirals: broad-spectrum inhibitors. Curr Opin Infect Dis. 2015;28:596–602.CrossRefPubMed
18.
Zurück zum Zitat Johansson P, Olsson M, Lindgren L, Ahlm C, Elgh F, Holmstrom A, Bucht G. Complete gene sequence of a human Puumala hantavirus isolate, Puumala Umea/hu: sequence comparison and characterisation of encoded gene products. Virus Res. 2004;105:147–55.CrossRefPubMed Johansson P, Olsson M, Lindgren L, Ahlm C, Elgh F, Holmstrom A, Bucht G. Complete gene sequence of a human Puumala hantavirus isolate, Puumala Umea/hu: sequence comparison and characterisation of encoded gene products. Virus Res. 2004;105:147–55.CrossRefPubMed
19.
Zurück zum Zitat Juto P, Elgh F, Ahlm C, Alexeyev OA, Edlund K, Lundkvist A, Wadell G. The first human isolate of Puumala virus in Scandinavia as cultured from phytohemagglutinin stimulated leucocytes. J Med Virol. 1997;53:150–6.CrossRefPubMed Juto P, Elgh F, Ahlm C, Alexeyev OA, Edlund K, Lundkvist A, Wadell G. The first human isolate of Puumala virus in Scandinavia as cultured from phytohemagglutinin stimulated leucocytes. J Med Virol. 1997;53:150–6.CrossRefPubMed
20.
Zurück zum Zitat Lundkvist A, Cheng Y, Sjolander KB, Niklasson B, Vaheri A, Plyusnin A. Cell culture adaptation of Puumala hantavirus changes the infectivity for its natural reservoir, Clethrionomys Glareolus, and leads to accumulation of mutants with altered genomic RNA S segment. J Virol. 1997;71:9515–23.PubMedPubMedCentral Lundkvist A, Cheng Y, Sjolander KB, Niklasson B, Vaheri A, Plyusnin A. Cell culture adaptation of Puumala hantavirus changes the infectivity for its natural reservoir, Clethrionomys Glareolus, and leads to accumulation of mutants with altered genomic RNA S segment. J Virol. 1997;71:9515–23.PubMedPubMedCentral
22.
Zurück zum Zitat Naslund J, Lagerqvist N, Lundkvist A, Evander M, Ahlm C, Bucht G. Kinetics of Rift Valley fever virus in experimentally infected mice using quantitative real-time RT-PCR. J Virol Methods. 2008;151:277–82.CrossRefPubMed Naslund J, Lagerqvist N, Lundkvist A, Evander M, Ahlm C, Bucht G. Kinetics of Rift Valley fever virus in experimentally infected mice using quantitative real-time RT-PCR. J Virol Methods. 2008;151:277–82.CrossRefPubMed
23.
Zurück zum Zitat Wichgers Schreur PJ, Kortekaas J. Single-molecule FISH reveals non-selective packaging of Rift Valley fever virus genome segments. PLoS Pathog. 2016;12:e1005800.CrossRefPubMedPubMedCentral Wichgers Schreur PJ, Kortekaas J. Single-molecule FISH reveals non-selective packaging of Rift Valley fever virus genome segments. PLoS Pathog. 2016;12:e1005800.CrossRefPubMedPubMedCentral
Metadaten
Titel
Quantification and kinetics of viral RNA transcripts produced in Orthohantavirus infected cells
verfasst von
Julia Wigren Byström
Jonas Näslund
Fredrik Trulsson
Magnus Evander
Olivia Wesula Lwande
Clas Ahlm
Göran Bucht
Publikationsdatum
01.12.2018
Verlag
BioMed Central
Erschienen in
Virology Journal / Ausgabe 1/2018
Elektronische ISSN: 1743-422X
DOI
https://doi.org/10.1186/s12985-018-0932-8

Weitere Artikel der Ausgabe 1/2018

Virology Journal 1/2018 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.