Background
Infection with HIV-1, the causative agent of AIDS, is characterized clinically by a long asymptomatic period of latency preceding the development of AIDS. Even during this period of clinical latency, the virus replicates continuously and causes new rounds of infection. In recent years, many researchers have focused on adaptive immune responses against HIV infection. To date, the mechanisms that modulate HIV replication during this clinically latent stage are not completely clear and studies of HIV immunotherapy and vaccination have not shown great progress.
The importance of innate immunity in HIV infection is becoming increasingly apparent [
1‐
3]. Innate immunity serves as the first line of defense against microbial pathogens and is also responsible for the initiation of inflammatory responses through the release of a variety of cytokines, chemokines, and antimicrobial factors. Monocytes, the precursors of macrophages and dendritic cells, are involved in the innate immune response via cognate interactions and production of proinflammatory cytokines, such as interferons (IFNs), IL-12, IL-6 and tumor necrosis factor alpha (TNF-α). In particular, toll-like receptors (TLRs) that are expressed on monocytes can signal cytokine release, cellular activation, and up-regulation of the MHC Class I or Class II [
4], and thus help link the innate and the adaptive immune responses.
TLRs are a family of pattern recognition receptors that mediate essential mechanisms of innate immunity against microbial pathogens [
5‐
7]. TLRs are grouped by their preferences for conserved structural motifs of microorganisms. TLR3, 7, 8, and 9 are implicated in anti-viral defense [
5,
8]. A recent study reported that TLR7/8 can recognize uridine-rich ssRNA (ssRNA40) derived from the HIV-1 long terminal repeat (LTR) [
9], suggesting that TLR7/8 may be involved in HIV infection as other investigators have previously reported [
10,
11].
It is still unknown whether TLR7/8 expression in monocytes is related to disease progression in HIV-infected patients or whether it represents a protective factor in those patients who are slow disease-progressors. Both TLR7 and 8 recognize single-stranded viral RNA (ssRNA) [
12,
13], lead to NF-κB activation [
14], and promote the production of cytokines such as IL-12 and TNF-α [
15]. NF-κB is critical for the transcription of most immune response genes, inducing both types I and II cytokines [
16]. Ironically, there are NF-κB binding sites located within the HIV LTR [
14] that can bind NF-κB and enhance HIV replication. Thus, the role of TLR7/8 signaling in monocytes' response to HIV replication merits further investigation.
In this study, we examined monocyte expression of TLR7 and 8 mRNA from subjects with HIV over the course of disease progression. We also assessed TLR7/8-dependent cytokine secretion and HIV replication in monocytes stimulated with the synthetic TLR7/8 ligand R-848. We demonstrate that HIV disease progression is influenced by TLR7/8 expression and signaling in monocytes, offering additional targets in the pursuit of treatments and cures for AIDS.
Methods
Study subjects
Sixty-three HIV-1-infected subjects from Liaoning and Henan provinces in China were enrolled in the study. All had been previously diagnosed using an anti-HIV antibody screening test (Vironostika, Organon Tednika, The Netherlands) which was confirmed by immunoblot-based testing (Gene Lab Diagnostics, Singapore). HIV-infected subjects were classified into three clinical groups. Subjects in the first group were characterized as "slow progressors" (SPs), with persistent CD4
+ cell counts greater than 500 cells/μl, no anti-retroviral therapy, and no clinical signs of disease for at least 10 years. Subjects in the second group were characterized as "chronic HIV infection subjects", who had CD4
+ cell counts between 200 and 500 cells/μl with no antiretroviral therapy and no AIDS-defining symptoms. Patients in the third group were labeled "AIDS subjects", consisting of patients with < 200 CD4
+ cells/μl and/or the appearance of opportunistic infections or AIDS-defining symptoms according to the World Health Organization classification. According to these criteria, the study included 20 SPs, 25 chronic HIV infection subjects, 18 AIDS subjects and 18 HIV-negative healthy persons (Table
1). All control subjects had normal blood cell counts, normal levels of hemoglobin, and normal liver function and did not have any history of immune system disease. Blood samples from subjects were obtained when opportunistic infection was not present. Samples from HIV-infected and control subjects were always handled in parallel. All subjects included here gave informed consent and written approval was obtained from the appropriate hospital ethics committees. All investigations were conducted according to Helsinki Declaration guidelines.
Table 1
Details of study subjects in each group
SPs(20) | 8/12 (47: 33-56) | 637 (563-722) | 47500 (24500-407750 | 5 | 0 | 0 |
HIV chronic(25) | 11/14 (44: 30-54) | 411 (328-487) | 11000 (2005-75000) | 5 | 1 | 0 |
AIDS(18) | 7/11 (48: 37-59) | 107 (55-151) | 4100 (790-16000) | 4 | 1 | 4 |
Control(18) | 9/9 (46: 36-54) | 823 (524-1135) | NDd
| 0 | 0 | NDd
|
Isolation, culture, and stimulation of monocytes
Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats of heparinized blood by Ficoll-Hypaque (Amersham Biosciences) density gradient centrifugation; monocytes were further isolated using CD14
+-conjugated magnetic beads (Miltenyi Biotech, Germany) for the positive selection according to the manufacturer's instructions. The purity of the monocyte population was > 97% as determined by flow cytometry with phycoerythrin (PE)-conjugated anti-CD14 antibody (BD Pharmingen). Cell viability of monocytes at isolation was > 90% as determined by trypan blue. Monocytes were cultured in RPMI-1640 supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 25 mM HEPES, 100 IU/ml penicillin G and 100 μg/ml streptomycin, and were cultured at 5 × 10
5 cells/0.5 ml/well on 48-well flat bottom tissue culture plates following the protocol described by Bekeredjian-Ding et al. [
15]. The antibiotics were added to prevent bacterial growth; cultures grown in media lacking antibiotics did not display different TLR7/8 expression. Monocytes were stimulated with the TLR7/8 agonist R-848 (resiquimod, Alexis) at 2.5 μg/ml [
15] or medium alone (controls) in cultures at 37°C, 5% CO
2 for 24 h, at which point monocyte cytokine secretion was fully functional and the levels of TLR 7/8 expression were also evaluated. Cell-free supernatants were harvested after a 24-h culturing period and the concentrations of IL-12p40 (the bioactive form of IL-12) and TNF-α were determined using an ELISA assay (R&D and eBioscience, respectively). All supplemented media were found free of endotoxin (lack of TNF-α induction in monocytes) [
17]. HIV RNA load in supernatant was also measured to assess viral replication before and after culture of monocytes from HIV-infected patients. Monocytes were washed three times after separation and before culture; HIV RNA was not detected in any initial monocyte culture. Monocytes were cultured in 48 well plates with approximately 5 × 10
5 cells/0.5 ml/well which was sufficient to produce enough virus in 48 h to exceed detection limits [
18].
HIV RNA load measurement
HIV-1 RNA levels in culture supernatants were extracted from each sample with the Nuclisens extractor (bioMérieux) and quantified using the Nuclisens EasyQ (version 1.1) assay (bioMérieux) following the manufacturer's instructions.
Determination of CD4+ cell counts
CD4+ cell counts were measured using a FACS Calibur flow cytometer (Becton-Dickinson). A single-platform lyse/no-wash procedure was performed using Trucount tubes and TriTEST CD4-FITC/CD8-PE/CD3-PerCP reagents (BD Biosciences).
Measurement of TLR7/8 mRNA expression
Total RNA was extracted from monocytes using the RNeasy Protect Mini Kit (QIAGEN) according to the manufacturer's protocol. The concentration of total RNA extracted from monocytes was determined by measuring optical density at 260/280 nm. Reverse transcriptase polymerase chain reaction was carried out using a kit from the Takara according to the manufacturer's protocol. The RT reaction consisted of 500 ng of total RNA, 0.5 μl Oligo dT (50 μmol), 0.5 μl random hexamers (100 μmol), 2 μl 5 × PrimeScript Buffer, adjusted to 10 μl with Rnase-Free dH2O. Reaction conditions were set at 37°C for 15 min, 85°C for 5 s, and 4°C until finished. The resulting cDNA was stored at -20°C for subsequent polymerase chain reaction (PCR) amplification. Expression analysis was performed using quantitative real-time PCR with SYBR Green I (TakaRa, Japan) on an ABI 7500 real time PCR system (Applied Biosystem Inc., USA). Primers for TLR7 and TLR8 were designed using Primer Express program (ABI) and their specificity was examined with BLAST queries in the National Center for Biotechnology Information (NCBI) database. The following 5' to 3' oligoucleotides were used: For TLR7, AATGTCACAGCCGTCCCTAC (sense) and GCGCATCAAAAGCATTTACA (antisense); for TLR8, TGTGATGGTGGTGCTTCAAT (sense) and ATGCCCCAGAGGCTATTTCT (antisense). Thermal cycler parameters included 40 cycles at 95°C (5 s) and 60°C (34 s). The dissolution curve conditions were 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s. All gene-specific mRNA expression values were normalized against the housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH). After amplification, melting curves were generated automatically by the ABI 7500; only those showing a single high production peak were considered to be valid amplifications. PCR amplification of the RNA sample alone (without reverse transcriptase treatment) was performed as a control; no products of the TLR7/8 gene were detected indicating that there was no relevant DNA contamination of the RNA sample.
Statistical analysis
Data are depicted as means ± SEM or given as median values (IQRs). All statistical tests used for data analysis were performed using the SPSS Version 11.5 software package (SPSS, Inc. Chicago). Differences among the groups were compared using the Fisher's least significant difference test (LSD) and correlation was determined using the Pearson test for unpaired and normal data. Differences between groups were compared using the Mann-Whitney U test, and correlation was analyzed using the Spearman rank test for unpaired and non-normal data. Wilcoxon signed rank tests were used for comparisons of non-normal paired data. Probability values were two-sided and considered to be significant when p < 0.05.
Discussion
This study, to our knowledge, represents the first analysis of the expression of TLR7/8 on monocytes during HIV disease progression and the role of TLR7/8 triggering in monocytes on viral replication.
Monocytes are vital members of the innate immune system as they are precursors to professional antigen presenting cells (APCs). However, monocytes have been implicated as a viral reservoir during HIV infection based on the detection and recovery of replication-competent virus from circulating monocytes isolated from HIV-positive individuals [
20,
25,
26]. In our study, we isolated blood monocytes from nine HIV-infected subjects and cultured the samples in vitro. Monocytes from six of nine HIV-infected subjects exhibited HIV replication, which indicates that peripheral blood monocytes of HIV-infected patients contain replication-competent HIV particles.
Recently, Almodovar et al. [
27] reported that peripheral blood monocytes do not seem to be latent sources of HIV in the presence of suppressive HAART (highly active retroviral therapy); however, in the absence of suppressive HAART, monocytes may become infected with HIV. In our study, although all nine patients were HAART-naïve, three did not show HIV replication which suggests that inhibition of HIV replication may be host-mediated [
28,
29]. However, we cannot rule out that this result could be explained by our 48-h culture protocol, which may have been insufficient to allow detectable viral replication in these three samples.
Several studies have demonstrated that, even in individuals with viral loads suppressed below detection for prolonged periods of time, HIV-1 still continues to replicate at very low levels in monocytes and that infected monocytes can transmit HIV-1 to other susceptible cells [
20,
26,
30]. Suppression or elimination of HIV in infected subjects' monocytes would be an important method of preventing rebound infection. In our study, we provide evidence that TLR7/8 triggering by the TLR7/8 agonist, R-848, can suppress HIV replication in monocytes. Moreover, a TLR7/8-initiated pathway can induce a protective adaptive immune response that leads to suppression of the pathogen [
31‐
33], which indicates that there are multiple roles for TLR7/8 in an antiviral response.
The mechanism of HIV-1 latency in monocytes is not fully understood. Given that the TLR7/8 receptors on monocytes can recognize viral ssRNA and thus mediate an antiviral immune response, we considered whether the replication of HIV could be inhibited by triggering the TLR7/8 signaling pathway. Our data demonstrate that R-848 can inhibit HIV replication in monocytes cultured from HIV-infected subjects, which suggests that this inhibition is related to the TLR7/8 signaling pathway and is dependent on monocytes themselves and not on input from other cell types.
We also investigated whether inhibition of replication could be related to the role of proinflammatory factors secreted by monocytes after agonist stimulation. Several studies have reported that TNF-α may induce HIV replication in vitro [
34,
35]. Other studies have noted a general increased in circulating TNF-α during HIV infection [
36,
37] We compared HIV-infected and healthy subjects by examining TNF-α and IL-12p40 in monocyte culture supernatants. We observed reduced TNF-α secretion by monocytes from HIV-infected patients following stimulation with R-848. In this respect, our results differ from previous results that show increased monocyte TNF-α secretion due to stimulation with gp120 and HIV virions [
38‐
40]. As R-848 has a molecular structure similar to ssRNA, it is ideal for studying TLR7/8 signaling. However, R-848 cannot substitute for treatment with gp120 or complete HIV virions. Other components of the HIV virion may provide a significant source of stimulus for innate immune activation [
41].
Among the six patients with positive HIV replication, we found that patients with lower CD4
+ cell counts had higher HIV replication levels, which supports the findings of Innocenti et al. [
42]. The higher HIV replication levels indicated that the monocytes contained high levels of HIV DNA as compared to monocytes from subjects with high CD4
+ cell counts (which is an established indicator of host immune status). Thus, we hypothesized that TLR7/8 expression may vary HIV infection stage.
Indeed, we found that TLR7 and TLR8 expression levels in monocytes declined as a function of the severity of HIV infection (i.e. slow progression to chronic HIV infection to AIDS). TLR7 expression was decreased significantly at each subsequent stage of HIV infection, while TLR8 expression decreased significantly from baseline levels only at the AIDS stage. Different levels of TLR7/8 expression in different stages of HIV infection suggest that their role in monocyte function also varies according to HIV infection stage. To test this difference further, we used the TLR7/8 ligand R-848 [
19] to activate the TLR7/8 signaling pathway [
43] in vitro. Our findings show that TNF-α and IL-12p40 secretions were decreased significantly at each subsequent HIV infection stage, which indicated that the decreased TLR7 expression of monocytes should be linked to a lower response to R-848. Meanwhile, our findings also show that TLR7 expression levels are decreased significantly after monocytes are stimulated by R-848 in vitro, which corresponds to the observed pattern of TLR7 expression levels in monocytes across disease progression stages.
This data suggests that TLR7 is more responsive and hypersensitized to its ligands, while TLR8 expression in monocytes in vitro was stable after stimulation with R-848, which corresponds to the conserved in vivo TLR8 expression in monocytes of subjects from the SPs and HIV chronic stages. Hence this study reveals differences in TLR7 and TLR8 expression in monocytes from HIV-infected subjects both in vivo and after in vitro stimulation; however, further studies are needed to elucidate a mechanistic explanation of altered TLR expression in HIV-infected monocytes.
TLR 7/8 may recognize HIV ssRNA. Binding of the appropriate ligands results in the recruitment of the adaptor protein Myeloid Differentiation Factor 88 (MyD88)followed by various IL-1 receptor-associated kinase (IRAK) family members. TNF receptor-associated factor 6 (TRAF6) is also recruited and finally the NF-κB and mitogen-activated protein kinases (MAPKs) are activated. These events result in the induction of inflammatory cytokines and chemokines [
44]. Thus, TLR 7 binding to its ligand could result in the production of cytokines; decreased TLR 7 expression would theoretically lead to a drop in cytokine secretion. However, our study found no correlation between TLR expression and TNF or IL-12 secretion (data not shown). We speculate that the expression level of TLR 7 may influence the frequency with which ligands are recognized; the higher the level of TLR expression, the greater chance that a ligand such as ssHIV RNA will be detected.
Our study demonstrates that TLR 7/8 activation elicits an antiviral response in primary monocytes with increased TLR 7 expression at the initial disease (SP stage); thus, we can speculate that at the time of initial HIV-infection, HIV ssRNA may be recognized by TLR 7 and activate signaling pathways resulting in MyD88 activation and subsequent production of proinflammatory cytokines such as IFNs which could increase TLR 7/8 expression [
45]. Persistent immune activation in HIV is thought to contribute to pathogenesis by progressively disturbing cytokine expression, functional organization of the immune system [
46], and decreasing TLR expression (AIDS stage). Further studies are needed to examine this possibility. Interestingly, our observation of decreased TLR7 and TLR8 mRNA expression in monocytes differs from the increase in TLR7 and TLR8 mRNA expression as Lester et al. reported [
47] in PBMCs, which suggests that monocytes experience a unique change in TLR7/8 expression distinct from other PBMCs.
Our study is preliminary and since it is performed in restricted conditions its extrapolation to clinical applications is challenging. It has several limitations. First, the number of cases is limited and this should be taken into consideration when interpreting the results. Nevertheless, to our knowledge, no other study has reported that R-848 inhibited HIV replication specifically in monocytes nor have other studies documented the association between TLR7/8 expression in monocytes and HIV disease progression. Second, TLR7/8 expression was only measured at the mRNA level; analysis of protein levels will increase our understanding of the phenomenon. However, Song et al. [
10] have confirmed that enhanced expression of TLR7 mRNA in CD8
+ T cells corresponds to increased TLR7 protein expression. Finally, we have not yet undertaken sophisticated mechanistic studies of the variations in TLR7/8 signaling pathway which may occur during progressive stages of HIV infection.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
HS and WQG conducted the experiments. HN, HLC, YP and MJB carried out all the test. MJB, QHH and MZ participated in the statistical analysis of the study. HS and ZNZ provided a critical review of the manuscript. HS designed the study and supervised the laboratory procedures and the data analysis. HN analyzed and interpreted the results and wrote the manuscript. All authors contributed to writing the manuscript and approved its final version.