Background
Gastric cancer is the second leading cause of cancer-related death globally [
1], with a particularly high incidence in China, accounting for nearly half of all new cases worldwide [
2]. Despite the decline in the incidence and mortality of gastric cancer in the past decades, the 5-year survival rate of gastric cancer patients remains poor. Therefore, comprehensive elucidation of the complex molecular mechanisms responsible for GC development and progression are urgently needed.
TRIM24 (also known as TIF1α), belongs to the tripartite motif protein family, was reported to be aberrantly activated in a wide variety of cancers, including breast, head and neck, hepatocellular carcinomas and lung cancer [
3‐
7]. Mounting evidence showed TRIM24 has a key role in the modulation of the biological and clinical behavior of tumor cells through interaction with tumor-suppressive or oncogenic pathways [
8‐
13]. For example, TRIM24 binds and activates PIK3CA gene engaged oncogenic PI3K/AKT signaling pathway in prostate cancer and glioma [
14,
15]. Moreover, TRIM24 accelerates tumor development and progression through promoting phosphorylated p53 ubiquitination and degradation [
16‐
18]. In our previous study, we found TRIM24 was upregulated in GC and its overexpression promoted tumor malignant behaviors via activation of Wnt/β-catenin pathway [
19]. Despite the well-defined outcome of TRIM24 overexpression in cancers, the mechanism underlying its upregulation in gastric cancer remains completely unknown.
MicroRNAs (miRNAs), are small non-coding RNAs that negatively regulate their target gene expression at post-transcriptional levels by directly binding to the 3′ untranslated regions (3′UTRs) [
20‐
22]. Numerous evidence regarding miRNAs has unveiled a new dimension to our understanding of tumorigenesis and its associated physiological processes, such as proliferation, cell cycle, apoptosis and invasion [
23‐
28]. Of note, a subset of miRNAs has been linked to gastric cancer progression due to their roles in the regulation of oncogenes or tumor suppressor genes involved in GC tumorigenesis, such as miR-362, miR-223, miR-506 and miR-144 [
29‐
32]. Given the important oncogenic role of TRIM24 in GC, we decided to investigate whether TRIM24 expression is regulated by specific miRNAs, with the underlying hypothesis that these regulatory miRNAs could also be critical in GC pathogenesis.
In this study, miR-511, bioinformatically predicted as a regulating miRNA of TRIM24, was found to be downregulated and inversely correlated with TRIM24 expression in GC tissues and cell lines. We further found that upregulation of miR-511 inhibited GC proliferation, and the inhibition of miR-511 had opposite effects. Moreover, our study demonstrated that TRIM24 was a functional target gene of miR-511, and miR-511 inactivated PI3K/AKT and Wnt/β-catenin pathways by suppressing TRIM24. Taken together, our data unveiled the importance of miR-511/TRIM24 axis in gastric carcinogenesis, which may provide potential strategies for the treatment of GC.
Methods
Patients and tissue samples
Primary gastric cancer tissues and their paired adjacent normal tissues were obtained from 12 patients who received surgery resection at the Department of Surgery of the First Affiliated Hospital of Nanchang University. Following resection fresh tissue samples were frozen in liquid nitrogen and stored at −80 °C. Clinicopathological characteristics of patients were confirmed by two experienced pathologists and summarized in Additional file
1: Table S1. None of these patients received any chemotherapy and radiotherapy before surgery.
Cell lines and cell culture
Five human gastric cancer cell lines (AGS, BGC823, MGC803, HGC-27and SGC7901) and normal gastric epithelial cell line GES-1 were obtained from Sun Yat-Sen University Cancer Center. Cells were cultured in RPMI-1640 medium (Hyclone, Logan, USA) with 10% fetal bovine serum (FBS; Hyclone, Logan, USA), 100 U/mL penicillin, and 100 μg/mL streptomycin (Invitrogen, USA) in a humidified chamber at 37 °C and a 5% CO2 environment.
RNA extraction and quantitative reverse-transcriptase PCR analysis
In this study, total RNA was extracted from frozen tissue samples and cells by using TRIzol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. The complementary DNA (cDNA) was synthesized using a reverse transcription kit (TransGen Biotech, Beijing, China). RT-PCR was performed using the ABI 7500 real-time fast PCR system (Applied Biosystems, Foster City, USA) and SYBR Green quantitative PCR SuperMix (Invitrogen, Carlsbad, USA). The cycling conditions were set as previously described [
28]. Primers for miR-511 and TRIM24 were purchased from Genepharm Company (Shanghai, China). U6 or GAPDH were used as internal controls and all data were analyzed using the 2
-△△Ct method. Primer sequences are presented in Table
1.
Table 1
Primer sequences used in quantitative real-time PCR
miR-511 | forward: 5′- AGTGCTGGTGTCTTTTGCTCTG -3′ reverse: 5′- TATGGTTGTTCACGAGTCCTTCAC -3′ |
TRIM24 | forward: 5′- CATATGCAGCAACAGCAACCG -3′ reverse: 5′- GAAAGCCATCTGTAGGGGGT -3′ |
U6 | forward: 5′- AGAGCCTGTGGTGTCCG -3′ reverse: 5′- CATCTTCAAAGCACTTCCCT -3′ |
GAPDH | forward: 5′-CATCACCATCTTCCAGGAGCG-3 reverse: 5′-TGACCTTGCCCACAGCCTTG-3′ |
Western blot
Briefly, cells were lysed in lysis buffer consisting 50 mM Tris/HCl (pH 7.5), 150 mM NaCl, 1 mM dithiothreitol (DTT), 1 mM EDTA, 0.5% Nonidet P-40 (NP-40), 0.2 mM phenylmethylsulfonyl fluoride (PMSF), 10 μM pepstatin A and 1 mM leupeptin. Equal amount of clear cell lysates were separated by 10% SDS-PAGE and electroblotted onto PVDF membrane (Bio-Rad Laboratories, Hercules, USA). Membranes were blocked with 5% BSA solution and then incubated with the following primary antibodies overnight: TRIM24 (1:1000, Abcam, ab70560, USA), phospho-AKT (p-AKT) (1:1000, Cell Signaling Technology, #9297, USA), AKT (1:1000, Cell Signaling Technology, #9272, USA), β-catenin (1:1000, Cell Signaling Technology, #9562, USA), cyclinD1 (1:1000, Cell Signaling Technology, #2978, USA), c-Myc (1:1000, Cell Signaling Technology, #5605) and β-actin (1:1500, Abcam, #6267, USA). The following day, membranes were washed with TBST and then incubated with horseradish peroxidase (HRP)-conjugated corresponding second antibodies for 1 h at room temperature. β-actin was used as an internal control and protein bands were analyzed using Image J software (Rawak Software, Germany).
Cell transfection
In this study, MGC803 and HGC-27 cells were transfected with miR-511 mimics (sense:5′-GUGUCUUUUGCUCUGCAGUCA-3′, antisense:5′-AGUGCAGAGCAAAAGACACUU-3′) and negative control (NC, sense:5′-UUCUCCGAACGUGUCACGUTT-3′, antisense:5′-ACGUGACACGUUCGGAGAATT-3′). Then SGC7901 cells were transfected with miR-511 inhibitor (5′-UGACUGCAGAGCAAAAGACAC-3′) and inhibitor negative control (inhibitor NC, 5′-CAGUACUUUUGUGUAGUACAA-3′). TRIM24 expression vector without 3′-UTR (TRIM24-no UTR) was constructed by inserting its CDS sequence into the psiCHECK2 vector (Promega, USA). qRT-PCR analysis and Western blot were performed to confirm the transfection efficiency.
CCK-8 assay
To assess the cell viability, the Cell Counting Kit-8 (CCK-8) (Dojindo Molecular Technologies, USA) was used according to the manufacturer’s instructions. After transfection for 24 h, cells were seeded in 96-well plates. The cell viability was detected by adding WST-8 at a final concentration of 10%, and the absorbance of these samples were measured at 450 nm on a Microplate reader (Molecular Device, SpectraMax M5e, USA) every 24 h for 5 days. The data derived from triplicate samples are presented as mean ± SD.
For the colony formation assay, MGC803, HGC-27 and SGC7901 cells (500 per well) were seeded in a 60 mm-dish at 24 h post-transfection and cultured in RPMI 1640 medium containing 10% fetal bovine serum for 10 days. Only colonies which reached more than 50 cells were fixed with 10% formaldehyde for 15 min and dyed with 8.0% crystal violet for 15 min. Each experiment was repeated three times.
EdU incorporation assay
The effect of miR-511 on cell proliferation was also examined by EdU (5-Ethynyl-2′-deoxyuridine) incorporation assay. Briefly, 24 h after transfection, indicated cells were incubated with 50 μM EdU for 2 h at 37 °C according to the manufacturer’s instructions (R11053.4, Apollo 567, RiboBio, China). Cells were then washed with PBS for three times, and fixed with 4% formaldehyde for 30 min at room temperature. Next, 0.5% Triton X-100 was applied for 10 min at room temperature to permeabilize cells. After washing with PBS for three times, cells were incubated with 1 × Apollo reaction cocktail for 30 min. DNA was stained with DAPI (4′,6-diamidino-2-phenylindole) for 30 min and results were visualized with a Zeiss confocal microscope (LSM 700, USA).
Flow cytometry analysis
Indicated cells were harvested by trypsinization, washed with cold PBS and fixed in 70% cold ethanol in PBS. Before staining, cells were spun down in a cooled centrifuge and resuspended in cold PBS. Next, 100 μL of RNase was added and cells were incubated at 37 °C for 30 min. Finally, cells were stained with PI (propidium iodide, Thermo Fisher Scientific, P1304MP, USA) for 30 min at 4 °C and 5 × 104 cells were analyzed by flow cytometry (Beckman-Coulter, Fullerton, CA, USA).
Dual-luciferase reporter assay
Prediction of miR-511 target genes was performed by two independent miRNA databases: miRanda (
http://www.microrna.org/) and TargetScan (
http://targetscan.org). The full length 3′-UTR of the TRIM24 gene and a mutant variant was amplified by PCR and cloned into the luciferase reporter psiCHECK2 vector (Promega, Madison, USA). The wild-type plasmid (TRIM24-Wt-3′UTR) was created containing the full-length 3′-UTR of TRIM24 with miR-511 complementary sequence. In addition, a mutant-type plasmid (TRIM24-Mut-3′UTR) with a degenerate 3′UTR was created by replacing AAAGACA with UUUCUGU in the miR-511 complementary sequence. GC cells were seeded in 2 × 10
5 cells per well in 12-well plates and transiently co-transfected with reporter plasmids (1 μg) and 100 nM of miR-511 mimics or miR-511 inhibitor using Lipofectamin 2000 (Thermo Fisher Scientific, #11668027, USA) for 48 h. The luciferase activity was measured using the Dual-luciferase Reporter Assay Kit (Promega, Madison, USA, E1910) according to the manufacturer’s protocols. Renilla luciferase was used for normalization and all experiments were performed three times.
Statistical analysis
Statistical analysis was performed using SPSS17.0 (Chicago, IL, USA). All data are presented as mean ± SD and each experiment was repeated in triplicate. Student’s t-test or variance (ANOVA) was employed to determine statistical significance. A p value < 0.05 or less was considered statistically significant.
Discussion
TRIM24, as a founding member of TRIM family, has been identified as being involved in physiologic and pathological processes, including cell growth, apoptosis, invasion and cancer development. Recent studies shed important insights into the expression and function of TRIM24 in carcinogenesis [
33,
34]. Others and our previous study showed that TRIM24 expression was abnormally upregulated in GC as compared with adjacent gastric tissues, indicating the potential role of TRIM24 in GC progression. To date, few studies have investigated the mechanism underlying TRIM24 overexpression in GC. In this study, we identify miR-511 as a negative regulator of TRIM24 in GC tumorigenesis.
MiRNAs are important non-coding RNAs, frequently expressed aberrantly in tumorigenesis. Numerous evidence has defined a role for miRNAs in modulation of the process of GC proliferation, apoptosis, metastasis and multidrug resistance. miR-511 has been reported to be negatively regulated in different cancer types, including lung cancer, hepatocellular carcinoma and ovarian cancer [
35‐
37]. It has also been found to act as a cancer-suppressive miRNA by targeting important oncogenes, such as PIK3R3, TRIB2 and Bax [
37‐
39]. However, some researchers found that miR-511 served as a onco-miR in other cancers, such as HCV-associated diffuse large B-cell lymphoma as well as in human blood monocyte-derived dendritic cells and macrophages [
40,
41]. Based on these reports, it seems that miR-511 displays contrasting roles in different tumor types, implying that the cancer type determines the role of miR-511 as an oncogene or tumor suppressor gene. However, few studies have paid attention to the role of miR-511 in GC. In our study, miR-511 was computationally predicted as a regulatory miRNA of TRIM24. And we further clarified that miR-511 is significantly downregulated in gastric cancer tissues when compared to corresponding non-cancerous gastric tissues. Moreover, the expression patterns of TRIM24 were inversely correlated with those of miR-511 in GC clinical samples and cell lines. Furthermore, TRIM24 was validated as a direct target gene of miR-511 by luciferase reporter assay and Western blot. These data further underscore a potentially important role of miR-511 downregulation, which consequently leads to TRIM24 upregulation in GC tumorigenesis.
In the present study, we further studied the biological functions of miR-511 in GC cells and found that ectopic expression of miR-511 inhibited cell growth, colony formation ability and resulted in G0/G1 arrest in GC cells, whereas miR-511 inhibition displayed opposing phenotypes. To further confirm whether TRIM24 is a functional target of miR-511, we co-transfected miR-511 and TRIM24 and found that regulation of TRIM24 by miR-511 relies on the TRIM24 3′UTR. More importantly, our functional experiments revealed that restoration of TRIM24 expression could attenuate the growth inhibition caused by miR-511 overexpression in GC cells. This provided direct evidence that miR-511 inhibit GC cell proliferation by suppressing TRIM24 expression. In addition, it is worth noting that ectopic expression of TRIM24 did not completely abrogate miR-511-induced effects, implying that other downstream targets may be also involved in miR-511 functions. Collectively, our data present the new evidence to show that miR-511 serves as a tumor suppressor in GC through negatively regulating TRIM24 expression. However, the molecular mechanisms by which miR-511-TRIM24 promotes cell proliferation still need to be further elucidated.
It is well-documented that PI3K/AKT and Wnt/β-catenin pathways participate in a wide variety of cellular process, such as cell growth, cell cycle, differentiation, and tumorigenesis [
42,
43]. Others and our data showed TRIM24 was involved in activation of PI3K/AKT and Wnt/β-catenin pathways [
19,
44]. In this study, based on the results that GC cell proliferation was affected by miR-511 and TRIM24 expression, we studied whether PI3K/AKT and Wnt/β-catenin pathways are also involved in this process. Our results showed that miR-511 overexpression significantly decreased the expression of p-Akt, β-catenin, c-Myc and cyclinD1, suggesting that miR-511 acts as a negative regulator of these two pathways. Previous study also showed that miR-511 acts as a negative regulator of PI3K/AKT pathway in liver cancer [
38]. Further findings showed overexpression of TRIM24 lacking its 3′-UTR significantly restored PI3K/AKT and Wnt/β-catenin pathways in miR-511-transfected GC cells. Taken together, these data imply that miR-511 suppresses PI3K/AKT and Wnt/β-catenin pathways via targeting TRIM24, thus, inactivation of PI3K/AKT and Wnt/β-catenin signaling pathways are also involved in the anti-proliferative effects of miR-511 in GC.
Acknowledgements
This work was in part supported by the Natural Science Foundation of Jiangxi Province, China (20161BAB205240 and 20151BBG70228), the Natural Science Foundation Major Program of Jiangxi Province, China (20161ACB21018, 20152ACB20024), the Graduate Student Innovation Foundation of Jiangxi Province, China (YC2015-B010), and the China Scholarship Council awarded by Ziling Fang.