Introduction
Heart failure is the end stage of almost all cardiac diseases, resulting in increased morbidity and mortality. Cardiac remodelling, including hypertrophy and fibrosis, is the major independent risk factor for heart failure, which usually develops in response to hypertension, myocardial infarction, valvular heart disease, and endocrine disorders [
6,
26,
44]. In recent decades, distinct signal transduction pathways have been identified to be involved in the development of cardiac remodelling [
12,
15,
23,
24]. Among the most prominent signal transducers are the mitogen-activated protein kinase (MAPK), calmodulin-dependent phosphatase, and JAK–STAT signalling pathways [
3,
11,
18], which are largely associated with G protein-coupled receptor (GPCR)-mediated signalling [
56].
GPCRs constitute a large family of receptors that sense molecules outside the cell and activate intracellular signal transduction pathways. These receptors have been widely implicated in the cardiovascular system [
54]. Perturbations in GPCR signalling could lead to pathological changes and contribute to various cardiovascular diseases, including hypertension, arrhythmia, and myocardial ischemia. Nearly one-third of the current pharmaceuticals on the market targeting GPCRs, such as angiotensin II receptor blockers, β-adrenergic receptor blockers, and luteinizing hormone-releasing hormone agonists, have had great success in treating human diseases [
7,
32,
33]. Therefore, a better understanding of the modulatory mechanism of GPCRs in hypertrophic hearts might have great significance for improving the treatment of cardiac hypertrophy and heart failure.
Regulators of G protein signalling (RGS) were originally identified for their ability to accelerate the activity of Gα GTPase, which could reduce the amplitude and duration of GPCR effects. On the basis of target specificity, protein stability, and subcellular localization, the RGS protein superfamily is divided into four subfamilies: R4/B, R7/C, R12/D, and R2/A [
13]. To date, at least 20 RGS proteins have been identified in cardiomyocytes and fibroblasts [
25,
43,
51,
64,
68]. Previous studies demonstrated that several types of RGS proteins are involved in multiple pathophysiological processes in the heart, such as arrhythmia, heart failure, and hypertension [
19,
46,
49,
50,
65,
66]. For example, Klaiber et al. demonstrated that RGS2 was involved in the anti-hypertrophic effects of cardiac atrial natriuretic peptide (ANP) [
28].
RGS14, belonging to the R12/D subfamily, is a complex with multi-domain structures. Differing from other RGS, RGS14 contains two G-interacting domains: the RGS domain and the carboxyl terminal GoLoco domain. In addition, a tandem of two
Ras-binding domains with affinity for the small GTPases
Ras and
Rap is located between the RGS and GoLoco domains [
57,
58,
69]. It has been reported that RGS14 plays essential roles in cellular mitosis [
8,
40,
41], birth process promotion [
29], and phagocytosis by activating αMβ2 integrin [
34]. Studies also revealed a role for RGS14 in suppressing synaptic plasticity in hippocampal CA2 neurons by integrating G protein and the MAPK signalling pathway [
30,
61]. However, the exact role of RGS14 in the heart, particularly in response to stress stimuli, has not been investigated, although the expression of RGS14 in heart tissues has been confirmed by many studies [
25,
55,
68]. Therefore, it is attractive and meaningful to determine the role and the underlying mechanism of RGS14 in pathological cardiac remodelling. In the present study, we explored if RGS14 expression was altered in hypertrophic hearts and further investigated the crucial role of RGS14 in cardiac remodelling by gain-of-function and loss-of-function approaches. The potential downstream mechanism of RGS14 in cardiac remodelling was well investigated.
Methods and materials
Reagents
Foetal calf serum (FCS) was obtained from HyClone (Shanghai, China). The antibodies and their commercial sources are listed below: Cell Signaling Technology (Beverly, MA): U0126 (#9903), anti-mitogen-activated protein kinase 1/2 (MEK1/2) (#9122), anti-phospho-MEK1/2 (#9154), anti-extracellular signal-regulated protein kinase 1/2 (ERK1/2) (#4695), anti-phospho-ERK1/2 (#4370), anti-c-Jun N-terminal kinase 1/2 (JNK1/2) (#9258), anti-phospho-JNK1/2 (#4668), anti-p38 (#9212), and anti-phospho-p38 (#4511); Santa Cruz Biotechnology, Inc.: anti-ANP (#sc20158) and anti-β-myosin heavy chain (β-MHC) (#sc53090); Aviva Systems Biology: anti-RGS14 (#OAAF04168); and Bioworld Technology: anti-GAPDH (#MB001). The bicinchoninic acid (BCA) protein assay kit was obtained from Pierce (Rockford, IL, USA). All other reagents, including the cell culture reagents, were purchased from Sigma.
Source of human hearts
The failing human heart samples were obtained from the left ventricle (LV) of dilated cardiomyopathy (DCM) patients after heart transplantation. The control samples were collected from the LV of normal heart donors who died because of an accident. The Institutional Review Board (IRB) of the Third Xiangya Hospital, Central South University approved the study. The relatives of the heart donors signed informed consent.
Mice
The Animal Care and Use Committee affiliated with the IRB of the Third Xiangya Hospital, Central South University approved all animal experimental protocols. All animals were housed in a light—(12 h light/12 h dark), temperature-controlled environment, and humidity-controlled environment. Food and water were available ad libitum. The animal models used in this study are described below.
Cardiac-specific RGS14-overexpressing mice
Full-length mouse RGS14 Complementary DNA (cDNA) (OriGene, MC204443) was ligated into the chicken β-actin gene (CAG) promoter expression vector, which was linearized and purified using the QIAquick Gel Extraction Kit (Qiagen, 28704). This DNA construct was microinjected into fertilized mouse embryos (C57BL/6J background). Founder transgenic mice were identified by tail DNA amplification and then bred with C57BL/6J mice. Tail genomic DNA was identified using polymerase chain reaction (PCR). The following primers were used for the PCR amplification of the CAG gene promoter: forward, 5′-CCCCCTGAACCTGAAACATA-3′; reverse, 5′-CTGCGCTGAATTCCTTCTTC-3′. The expected size for the amplification product was 579 bp. The RGS14 flox mice were crossed with α-MHC-MerCreMer transgenic mice (Jackson Laboratory, 005650) to generate cardiac-specific RGS14-TG mice. Four independent transgenic lines were established. To induce RGS14 expression specifically in the heart, 6-week-old double transgenic mice were injected intraperitoneally with tamoxifen (80 mg/kg per day; Sigma, T-5648) for 5 consecutive days to cause Cre-mediated CAT gene excision. CAG-CAT-RGS14/MHC-Cre mice without tamoxifen administration (CRMC) served as the control group.
Generation of RGS14 knockout mice
Directive sequences of the target site for the
RGS14 gene in the mouse were predicted by the online CRISPR design system (
http://crispr.mit.edu) (Fig.
3a). A pair of oligomers (oligo1, TAGGGGCCTGGGAACCTGCAGTGC; oligo2, AAACGCACTGCAGGTTCCCAGGCC) was cloned into the BsaI restriction site of the pUC57-single guide RNA (sgRNA) expression vector (Addgene, 51132). DNA was amplified by PCR with primers spanning the T7 promoter and sgRNA regions (forward primer, GATCCCTAATACGACTCACTATAG; reverse primer, AAAAAAAGCACCGACTCGGT). The sgRNA was transcribed by the MEGAshortscript kit (Ambion, AM1354) and purified by the miRNeasy Micro kit (Qiagen, 217084). The Cas9 expression plasmid (Addgene 44758) was linearized with PmeI and used as the template for in vitro transcription using the T7 Ultra Kit (Ambion, AM1345). Cas9 and sgRNA mRNA injections of single-cell embryos were performed by the FemtoJet 5247 microinjection system. Genomic DNA was extracted, and a 405 bp DNA fragment overlapping the sgRNA target site was amplified by PCR with the following primers:
RGS14-F, 5′-CTGTGTGGACACTCCCATCC-3′; and
RGS14-R, 5′-ACCACAGAGAGAAGCAGCAC-3′. The purified PCR product was denatured and reannealed in NEB Buffer 2 to form heteroduplex DNA that was digested with T7EN (NEB, M0302L) for 45 min and analyzed by 3.0 % agarose gel (Fig.
3b). These mice were sequenced to select for frameshift mutations (Fig.
3c). The following primers were used to screen F1 and F2 offspring:
RGS14-F, 5′-CTGTGTGGACACTCCCATCC-3′; and
RGS14-R, 5′-ACCACAGAGAGAAGCAGCAC-3′. Finally,
RGS14 knockout (
RGS14-KO or
RGS14
−/−) mice were generated and identified as shown in Fig.
3d, e. Littermate controls of the
RGS14-KO mice were wild-type mice (WT or
RGS14
+/+).
Cardiac-specific CaMEK1-TG and CaMEK1/RGS14 double TG mice
To obtain CaMEK1 flox mice, the coding sequence of mouse MEK1 S218D/S222D cDNA was ligated into the CAG promoter expression vector. This DNA construct was microinjected into fertilized mouse embryos (C57BL/6J background), and the resulting TG mice were PCR-genotyped using tail genomic DNA and the following primers: forward, 5′-CCCCCTGAACCTGAAACATA-3′; and reverse, 5′-CTGCGCTGAATTCCTTCTTC-3′. The expected size for the amplification product was 515 bp. The CaMEK1 flox mice were crossed with α-MHC-MerCreMer transgenic mice, which were obtained from the Jackson Laboratory (No. 005650), to generate CAG-MEK1/MHC-Cre mice. Tamoxifen (80 mg/kg per day; Sigma, T-5648) was then injected into the CAG-MEK1/MHC-Cre mice containing the CaMEK1 gene at 6 weeks of age for 5 consecutive days. CAG-MEK1/MHC-Cre mice without tamoxifen administration (CMMC) served as the control group. Finally, the CRMC mice were crossed with the CMMC mice and treated with tamoxifen to generate CaMEK1/RGS14 double transgenic (DTG) mice.
Aortic banding surgery
Aortic banding (AB) was performed as described previously [
22,
37]. Briefly, mice were anesthetized using an intraperitoneal injection of sodium pentobarbital (50 mg/kg, Sigma) and ventilated with room air using a small animal ventilator (model VFA-23-BV, Kent Scientific, USA). The mice were kept warm on a heating pad until they regained consciousness. The left chest was opened after blunt dissection at the second intercostal space, and the thoracic aorta was identified. We tied the thoracic aorta to a 27 G or 26 G needle with a 7-0 silk suture depending on the body weight. The needle was removed quickly after the ligation, and the thoracic cavity was closed. Finally, the adequacy of aortic constriction was determined by the Doppler analysis. The mice in the control group were subjected to the same procedure without ligation of the aorta.
Echocardiography evaluation
After the indicated times, the surviving mice were anesthetized using 1.5–2 % isoflurane and then subjected to echocardiography to examine cardiac function and structure, as previously described [
21]. Briefly, a Mylab30CV ultrasound system switched to M-mode tracings with a 15 MHz probe was used to determine echocardiography. The LV end-diastolic dimension (LVEDd), LV end-systolic dimension (LVESd), and LV fractional shortening [FS (%) = (LVEDd-LVESd)/LVEDd × 100 %] were measured from the short axis of the LV at the level of the papillary muscles.
Histological analysis and immunofluorescence staining
The animals were sacrificed 4–8 weeks after the AB or sham surgery. The hearts were harvested, arrested in diastole with 10 % potassium chloride solution, fixed with 10 % formalin, dehydrated, and embedded in paraffin. Paraffin-embedded hearts were cut transversely into 4–5 μm sections. Sections at the mid-papillary muscle level were stained with hematoxylin and eosin (H&E) and picrosirius red (PSR) to calculate the cardiomyocyte cross-sectional area (CSA) and collagen deposition volume, respectively. Fluorescein isothiocyanate-conjugated wheat germ agglutinin (WGA) was used to visualize the size of the cardiomyocytes. The immunofluorescence analysis was performed using the standard immunocytochemical techniques. Cardiomyocyte CSA, interstitial collagen deposition and perivascular collagen deposition were measured using the Image-Pro Plus 6.0 software.
Quantitative real-time PCR and western blotting
Total mRNA was isolated from heart tissues or neonatal rat cardiomyocytes (NRCMs) using TRIzol reagent (Invitrogen). cDNA, which was obtained by reverse transcription of RNA, was synthesized using the Transcriptor First Strand cDNA Synthesis kit (Roche). Quantitative real-time PCR was performed using SYBR Green (Roche), and the relative expression of the target genes was calculated. GAPDH was measured and used for normalization. Cardiac tissue and cultured cardiomyocytes were lysed in RIPA lysis buffer, and the protein concentration was determined with a BCA protein assay kit. The proteins (50 μg) were resolved via SDS-PAGE (Invitrogen) and transferred to a PVDF membrane (Millipore), which was then subsequently blocked with milk. After overnight incubation with the indicated primary antibodies at 4 °C, the membranes were washed at least three times and then incubated with a secondary antibody for 1 h at room temperature. Finally, enhanced chemiluminescence-treated membranes were visualized using a FluorChem E imager (ProteinSimple, FluorChem E). The results were normalized to GAPDH.
Cardiomyocyte and cardiac fibroblast culture and infection with recombinant adenoviral vectors
The heart ventricles of 1- to 2-day-old Sprague–Dawley rats were enzymatically dissociated into individual cardiomyocytes in PBS containing 0.03 % trypsin and 0.04 % type II collagenase. Fibroblasts were then removed by a differential attachment technique, and the NRCMs were plated at a density of 1 × 106 cells/well in six-well plates and cultivated in DMEM/F12 medium containing 20 % FCS, penicillin/streptomycin, and bromodeoxyuridine to inhibit fibroblast proliferation. The cardiomyocytes were maintained in serum-free DMEM/F12 for 12 h and then treated with angiotensin II (Ang II, 1 μM) for 24 or 48 h to induce hypertrophy.
To obtain cardiac fibroblasts, the adherent non-myocyte fractions obtained during pre-plating were grown in DMEM containing 10 % FCS to confluence and passaged with trypsin-EDTA. All experiments were performed on cells from the first or second passages. Cardiac fibroblasts were placed in DMEM medium containing 0.1 % FCS for 24 h before the stimulation by Ang II for 24 h, and the expression of RGS14 was investigated.
Finally, cardiomyocytes were infected with adenoviral RGS14 (AdRGS14) to overexpress RGS14, and an adenoviral vector encoding the green fluorescent protein gene (AdGFP) was infected into cardiomyocytes as a control group. Adenoviral short hairpin RGS14 (AdshRGS14) constructs were obtained and infected into cardiomyocytes to knockdown RGS14 expression, and an adenoviral short hairpin RNA (AdshRNA) was used as the non-targeting control. NRCMs were infected with different adenoviruses in diluted medium for 12 h.
Treatment of mice with U0126
U0126, an inhibitor of MEK1/2, was dissolved in dimethyl sulfoxide (DMSO) at a volume of 1 ml per 100 g of body weight and it was injected intraperitoneally into mice every 3 days (1 mg/kg) after AB. The control group was injected with a similar volume of DMSO.
Statistical analysis
The results are expressed as the mean ± standard deviation (SD). All data were analyzed using Student’s two-tailed t test and analysis of variance (ANOVA) to compare the means of two groups of samples and multiple groups, respectively. The T approximation test was used for the analysis when the sample was less than 7. All statistical analyses were performed with the SPSS software (version 17.0). P < 0.05 was considered statistically significant.
Discussion
We performed an exploratory study to determine the role of RGS14 in cardiac remodelling and its underlying mechanism by gain-of-function and loss-of-function approaches. Our major findings demonstrated that the disruption of RGS14 resulted in an exaggerated pathological cardiac remodelling response, whereas the overexpression of RGS14 alleviated the cardiac hypertrophy and dysfunction induced by aortic banding operation. Furthermore, the results supported that RGS14-mediated cardio-protection was at least partly attributed to inhibition of the MEK–ERK1/2 signalling pathway. For the first time, our results demonstrated a critical role of RGS14 in the pathophysiology process of cardiac remodelling and heart failure.
RGS proteins are believed to reduce the duration and power of GPCRs’ effects and, therefore, participate in pathophysiology processes [
13,
54]. Previous studies have demonstrated that RGS14 is expressed in the heart, although its function in the cardiovascular system remains unknown [
25,
55,
68]. We first observed that the protein level of RGS14 was decreased in the hearts of DCM patients, which suggested that RGS14 might be involved in the process of cardiac hypertrophy. Because biomechanical stress and neurohumoral factors are major triggers of cardiac hypertrophy, aortic banding and angiotensin II were used to treat animal models and NRCMs, respectively. The results showed that RGS14 was significantly decreased after aortic banding or angiotensin II stimulation. Furthermore,
RGS14 knockout aggravated cardiac hypertrophy after aortic banding, and RGS14 cardiomyocyte-specific overexpression significantly alleviated cardiac remodelling in vivo, which revealed a protective role of RGS14 in cardiac remodelling.
Molecular mechanism research revealed that MAPK signalling mediated the effect of RGS14 on cardiac hypertrophy. The MAPK cascade comprises a sequence of successive kinases, including p38, JNKs, and ERKs [
18,
39,
45]. All three major MAPK pathways are activated in cardiac tissue in pressure overload-induced animal models and in humans with heart failure [
14,
16]. It has been reported that JNK is an important mediator of pathological cardiac hypertrophy, although in the animal model with a loss of functional MEK4 (up-stream of JNK), JNK shows controversial effect on cardiac remodelling [
10,
35]. P38 plays an essential role in fibrosis, apoptosis, inflammation, and the production of cytokines, but the existing data concerning the role of p38 in hypertrophy in the heart are difficult to reconcile [
1]. We found that the activation of MEK–ERK1/2 was inhibited by cardiac RGS14 overexpression, whereas the deletion of RGS14 further enhanced the activation of MEK–ERK1/2 after chronic pressure overload. However, RGS14 did not affect the phosphorylation of p38 and JNK1/2, which indicated that ERK1/2 was the sole downstream target of RGS14 in cardiac remodelling. Furthermore, U0126 mitigated the aggravated effects of RGS14 deficiency on cardiac remodelling, whereas targeted MEK1 activation negated the protective effects of RGS14 on cardiac remodelling. Taken together, mechanistic inhibition of MEK–ERK1/2 signalling could largely account for the cardio-protective effect of RGS14 on pathological cardiac remodelling in the current study.
It is well accepted that the MEK–ERK1/2 signalling pathways are central mediators of cardiac hypertrophy [
16,
18,
27,
38,
42]. In the present study, the inhibition of MEK reversed the poor outcomes of cardiac hypertrophy, fibrosis, and dysfunction, whereas the overexpression of MEK1 in
CaMEK1 transgenic mice promoted cardiac hypertrophy. These results suggested a promoting role of MEK–ERK1/2 in pressure overload-induced remodelling. There are reports demonstrating that activated MEK–ERK1/2 signalling resulted in concentric hypertrophy in MEK1 transgenic mice. Mice lacking ERK1/2 in the heart by a genetic approach showed eccentric cardiac growth with and without the AngII stimulation [
4,
5,
27]. Therefore, it appeared that MEK–ERK1/2 induced a compensatory mechanism from eccentric to concentric status in cardiac hypertrophy. The effectiveness and specificity of the pharmacological inhibitory and loss-of-function approach in ERK might account for this difference. Furthermore, MEK–ERK might play different roles in cardiac remodelling when receiving different stimuli. Experiments on baseline activation, post-stimulus peak activation, or activation amplitude of MEK–ERK would provide new insight into the role of MEK–ERK pathway in cardiac function.
How RGS14 exhibits an inhibitory effect on the MEK1/2-ERK1/2 cascade in cardiac remodelling remains unclear. In addition to the conserved RGS domain, RGS14 contains the GoLoco domain and two Ras/Rap-binding domains [
9,
57,
58,
69]. The RGS domain and GoLoco motif proteins in RGS14 are referred to bind to Gi and inhibit its guanine nucleotide dissociation [
58]. Gi is best described as the inhibitory isoform of Gα that suppresses adenylate cyclase activity, leading to decreased cAMP accumulation [
2,
63]; however, to our knowledge, there are no data demonstrating that the loss of Gi regulates cardiac remodelling. Several studies have indicated that over-activation of Ras signalling induces pathological cardiac remodelling through the MER-ERK cascade pathway in vivo and in vitro [
17,
20,
42]. In addition, the Ras-binding domain was defined as the binding site of RGS14 when regulating the MAPK signalling pathway in a synaptic plasticity study [
61]. Therefore, it is possible that the Ras-binding domain of RGS14 is responsible for the inhibitory effect of RGS14 on the MEK–ERK1/2 cascade in cardiac remodelling. The specific mechanism distinguishes RGS14 as the special protein among the RGS proteins in cardiac remodelling, although the further implication needs more exploration.
RGS2, 3, 4, and 5, which belong to the R4/B subfamily, have been demonstrated to play a protective role in pressure overload-induced cardiac remodelling [
31,
36,
47,
52,
53,
62]. In the present study, the levels of RGS 2, 3, 4, and 5 were not changed in the
RGS14-KO mice compared with the wild-type mice or in the
RGS14-TG mice compared with the CRMC mice. Therefore, it appeared that there was no complementary mechanism between RGS14 and other RGS proteins in cardiac remodelling.
RGS14 was expressed both in cardiomyocytes and cardiac fibroblasts, although the level of RGS14 was unchanged in fibroblasts in response to angiotensin II stimuli in the current study, suggesting that profibrotic signalling in fibroblasts might not be linked directly to RGS14 in pathological processes. RGS14 overexpression only in cardiomyocytes appeared to be sufficient to protect against pressure overload-induced cardiac remodelling. Previous studies have indicated that activated Ras-MEK–ERK1/2 from cardiomyocytes could markedly reduce fibrosis in response to pressure overload [
60,
67], which might explain the underlying mechanism of RGS14 on cardiac fibrosis. We are unable to exclude the possibility that RGS14 in fibroblasts might contribute to cardiac hypertrophy via other pathways.
A limitation of this study is that the up-stream regulatory mechanism for RGS14-mediated protection of heart hypertrophy was not elucidated, because we only focused on the effect of RGS14 on the development of heart remodelling in this study. Numerous reports have indicated that RGS could be regulated by a variety of factors, including GPCR activation, second messengers, and epigenetic changes in different cell types [
46,
59]. RGS appeared to be a common downstream mediator in heart remodelling. The present study suggested that RGS14 could respond to pressure overload and Ang II, but more details should be studied in future.
Our research demonstrated that RGS14 protected the development of cardiac hypertrophy via suppressing the MEK–ERK1/2 signalling pathway in vitro and in vivo. These observations implied that RGS14 is a newly appreciated partner of GPCRs in the heart. RGS proteins could serve as potential therapeutic targets for cardiac hypertrophy and heart failure.
Acknowledgments
This study was funded by the National Science and Technology Major Projects for “Major New Drugs Innovation and Development” in China (2012ZX09303014-001); the National Key Technology R&D Program (2012BAI37B05); the National Natural Science Foundation of China (81273594, 81503071, 81470535, 81570271); and the Hunan Provincial Innovation Foundation for Postgraduates (CX2014B108). We thank Ding-sheng Jiang, Xiao-jing Zhang, Jun Gong, Rui Zhang, Xue-yong Zhu, Yan Zhang, Ling Huang, Ya Deng, and Xin Zhang for providing experimental technological assistance.