Background
Influenza A virus (IAV), a negative-sense single strand RNA virus, is a highly contagious agent that causes upper and lower respiratory tract infection resulting in 200,000 hospitalizations and 36,000 deaths in the United States per year [
1,
2]. IAV is responsible for seasonal epidemics and, infrequently, global pandemics. In 2009, a new pandemic caused by an H1N1 influenza strain emerged and spread globally, the first influenza pandemic in more than 40 years.
Although recognizing and responding to pathogens in a non-specific manner, the innate immune system provides immediate protection against infection. Cells of the innate immune system detect viral infection largely through pattern recognition receptors (PRRs) present either on the cell surface or within distinct intracellular compartments. The innate immune system responds to influenza through three classes of PRRs. The member of the first class of PRRs that most cells use to detect IAV is the cytosolic sensor, retinoic acid inducible gene I (RIG-I) [
3]. The second PRR class, endosomal Toll-like receptors (TLRs), are also involved. TLR3, a double-strand RNA sensor, may be used by some epithelial cells to detect the viral replicative intermediate dsRNA [
4]. Immune cells such as macrophages and dendritic cells (DCs) that are also present in the respiratory system, detect viruses using PRR’s, and produce proinflammatory cytokines upon activation. Myeloid DCs mainly sense IAV through RIG-I and TLR3, while plasmacytoid dendritic cells (pDCs) use TLR7 to recognize influenza genomic RNA upon release in late endosomes [
5]. Finally, the third class of PRRs, the nucleotide-binding domain and leucine-rich-repeat-containing proteins (NLRP), including NLRP3, and nucleotide-binding oligomerization domain 2 (NOD2), may serve as intracellular mediators of IAV initiated host-cell signaling via the regulation of caspase-1 [
6‐
8]. NLRP are mainly involved in regulation of IL-1β maturation through the formation of a biochemical complex called the inflammasome [
9]. The inflammasome regulates activation of caspase-1, and the subsequent cleavage of the IL-1β and IL-18 precursors into their functional forms, which are then released from the cell [
6].
PRRs are critical for recognition of IAV and initiation of the early antiviral response through induction of interferons (IFNs) and proinflammatory cytokines that contain the infection [
10]. Activation of these PRR receptors is the primary signal for production of proinflammatory cytokines and chemokines which are released to recruit and activate leukocytes [
11]. To establish a productive infection and cause disease, IAV must overcome host innate immune responses that are rapidly activated during infections. The acute surge of cytokine release leads to intense infiltration with, and activation of, inflammatory cells. Highly pathogenic IAV strains, including pandemic strains and avian influenza, are usually associated with excessive cytokine responses [
12,
13].
RIG-I is essential for IFN induction during RNA virus infections of non-pDC cell-types, and mice that are deficient in RIG-I-like receptor signaling pathways are extremely susceptible to RNA viruses [
14‐
16]. Cigarette smoke (CS), as well as second-hand smoke, increases the susceptibility to pulmonary infection with pathogens including IAV, rhinovirus, respiratory syncytial virus and various bacterial pathogens [
17‐
19]. In particular, epidemiological studies have shown that influenza infection is seven times more frequent and is much more severe in smokers than nonsmokers [
20]. We have shown that CS suppresses the RIG-I gene and protein expression in human and mouse lung, and inhibits the antiviral innate immune response [
21‐
23]. In vitro studies demonstrated that overexpression of RIG-I in guinea pig cell lines inhibited avian IAV H5N1 replication [
24]. In this report, we generated a RIG-I transgenic (TG) mouse strain that expresses the RIG-I gene product under the control of the lung-specific surfactant protein C (SPC) promoter to determine if RIG-I overexpression improves the host innate response and outcomes during IAV infection in vivo.
Methods
Preparation of influenza virus stock and plaque assays
H1N1 influenza virus, A/PR/34/8 (PR8), was passaged in Madin–Darby canine kidney (MDCK) cells. Virus was grown in MDCK cells in DMEM/F12 with ITS+ (BD Biosciences, Franklin Lakes, NJ) and trypsin, harvested at 72 h postinfection, and titered by plaque assay in MDCK cells. There was no detectable endotoxin in the final viral preparations used in the experiments as determined by limulus amebocyte lysate assay (Cambrex, Walkersville, MD). The lower limit of detection of this assay is 0.1 EU/ml or approximately 20 pg/ml LPS. For determination of viral titers in infected mice, whole mouse lungs were collected and homogenized in 1 ml of ice cold PBS. Solid debris was pelleted by centrifugation and viral titer was determined using a standard plaque assay on MDCK cells [
22]. Results were expressed as PFU/ml of extract.
Animals
The pSPCA plasmid was a generous gift from Dr. G. Hoyle (University of Louisville). It contains a 3.7 kb fragment from the human SPC promoter and a 0.5 kb fragment containing the SV40 intron and polyA site. We used this plasmid to create an SPC-RIG-I DNA construct containing promoter sequences from the human SPC gene, and coding sequences from the mouse RIG-I cDNA. The mouse RIG-I cDNA was excised from the pBabe-puro-RIG-I vector, a gift from Dr. Maya Shmulevitz (University of Alberta), with Sal I and Cla I and cloned downstream of the SPC promoter. Transgenic mice were generated by microinjection of the linear SPC-RIG-I construct into fertilized C57BL/6 one-cell mouse embryos.
All mice were genotyped and bred under pathogen-free conditions in the animal facility at the Oklahoma University Health Sciences Center. Mice were housed at 20 °C on a 12 h light/dark cycle in sterile microisolator cages and fed ad libitum with sterile chow and water. The Institutional Animal Care and Use Committee of the Oklahoma University Health Sciences Center approved all of the protocols for the animal experiments.
Whole-body CS exposure
Whole-body CS exposure was performed as described [
22]. Mice were exposed to the smoke of 3R4F reference cigarettes (University of Kentucky, Lexington, KY) for 5 h per day. Mice receiving CS were gradually brought up to the target exposure over a period of 2 weeks, and treated 5 days/week for 6 weeks. Treatment was administered by placing mice in a Plexiglas smoking chamber (Teague Enterprises, Davis, CA). Smoke exposure was standardized to total suspended particles = 90 mg/m3, carbon monoxide = 350 ppm, 11% mainstream and 89% sidestream smoke in the chamber of the machine. These parameters were verified by determining carboxyhemoglobin (COHb) levels using an IL-682 CO-Oximeter (Instrumentation Laboratories, Lexington, MA). “Nonsmoking” (NS) treatment groups were conducted for the same periods of time, but mice were exposed to filtered room air.
Influenza virus infection
IAV infection was performed under isofluorane anesthesia. IAV PR8 stock was diluted in PBS to make lethal and non-lethal doses of the virus. The mice were infected with IAV immediately after the last CS exposure. The virus solutions (50 μl) were administered by intranasal instillation as the animal was held in a vertical position. Control animals received PBS. For the survival test, the mice were monitored daily for 16 days, and clinical symptoms (shaking, lethargy, piloerection) and weight recorded daily.
Bronchoalveolar lavage (BAL)
Mice were sacrificed using isofluorane. BAL was performed using a closed thorax technique by exposing the trachea, nicking the bottom of the larynx and inserting a 3/4-in. 22-gauge cannula into the proximal trachea. The proximal end of the trachea was tied off, and 0.6 ml of sterile PBS was gently introduced into the lungs and recovered. This was repeated 3 times for a total instilled volume of 1.8 ml. Return volume varied by <10% between samples. BAL fluid (BALF) was centrifuged to remove cells. Cells obtained were plated on slides using a Cytopro Cytocentrifuge (Wescor, Logan, UT) and stained with DiffQuik (Dade Behring, Newark, DE) for determination of cell populations. Differential counts were made with ≥400 cells/sample using 2 slides/mouse. The BALF was pooled and frozen.
Multiplex immunoassay
Cytokine protein levels in the BALF and serum were determined by multiplex immunoassay (Affymetrix, Santa Clara, CA). The assay was run on a Bio-Plex 200 multiplex system (Bio-Rad, Hercules, CA).
RIG-I protein levels by immunoblotting
The mouse lungs were harvested and homogenized, and then lysed in 500 μl of cold lysis buffer (150 mM NaCl, 50 mM Tris, pH 8.0, 10 mM EDTA, NaF, sodium pyrophosphate, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, and 10 μg of leupeptin/ml). Lung homogenates were clarified by centrifugation at 10,000×g, at 4 °C for 10 min, and the clarified lysates were mixed with SDS-PAGE sample buffer (60 mM Tris, pH 6.8, 10% glycerol, and 2.3% SDS) and heated to 95 °C for 5 min. The samples were separated by electrophoresis using a 4–15% gradient gel and transferred to polyvinylidene fluoride (PVDF) membranes. For the detection of proteins, the membranes were immunoblotted with rabbit polyclonal antibody specific for RIG-I (Abcam, Cambridge, MA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; R&D Systems). The membranes were incubated with horseradish peroxidase-labeled goat anti-rabbit IgG (Cell Signaling Technology, Beverly, MA) and chemiluminescent reagents (Pierce Biotechnology, Rockford, IL). Blots were developed using the Syngene G:box Bioimaging System and GeneTools software (Syngene, Frederick, MD) and quantified using ImageQuant software (BD/Molecular Dynamics, Bedford, MA).
Measurement of mRNA expression by quantitative real-time PCR (qRT-PCR)
Total RNA from lung was extracted using a modified TRIzol (Invitrogen, Carlsbad, CA) protocol and spectrophometrically quantitated. The integrity of RNA was verified by formaldehyde agarose gel electrophoresis. Equal amounts (1 μg) of RNA from each sample were reverse-transcribed into cDNA with the oligo (dT) SuperScript II First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). Gene specific primers for mouse PRRs, cytokines and the β-actin housekeeping genes were used. The primers’ sequences are shown in Table
1. qRT-PCR was performed using 100 ng sample RNA and SYBR Green (Quanta Biosciences, Gaithersburg, MD) in a Bio-Rad CFX96™ Touch Real-Time PCR Detection System. Results were calculated and graphed using the ΔCT of the target gene and normalizer, β-actin.
Table 1
List of primers used in RT-PCR
RIG-I | ATTGTCGGCGTCCACAAAG | GTGCATCGTTGTATTTCCGCA |
IFN-β | CCATCAACTATAAGCAGCTCCAGC | CCACCATCCAGGCGTAGCTGTTG |
β-actin | CAGAAGGACTCCTATGTGGGTG | GGATCTTCATGAGGTAGTCTGTC |
TLR3 | CTGGAGCCAGAACTGTGCC | GTTCTTGGAGGTTCTCCAG |
IL-6 | CCGGAGAGGAGACTTCACAG | GGTACTCCAGAAGACCAGAGG |
IFN-λ 2/3 | AGCTGCAGGCCTTCAAAAAG | TGGGAGTGAATGTGGCTCAG |
TLR7 | TTGGTTTGGGGTTTTTTTTG | ATTCCTGATAATGTCTTCTGGACA |
NOD2 | GGAAGGCACCCCATTGGGTTG | GCACAGCATGAACTTGGAGTCG |
TNFα | GCCCAAGGCGCCACATCTCC | CCACTTGGTGGTTTGCTACG |
IP-10 | GGTCCGCTGCAACTGCATCC | GCAATTAGGACTAGCCATCC |
Histologic and immunohistochemical analysis of mouse lung tissue and type II alveolar epithelial cells (AEC II)
At day 6 after IAV infection, mice were sacrificed and lungs were fixed in 4% paraformaldehyde in PBS at room temperature for 30 min, and were then embedded in paraffin. Fixed tissue was hematoxylin and eosin (H & E) stained to assess inflammation and fibrosis. Sections (3–5 μm) were mounted on glass slides and immunoprobed with a rabbit anti-mouse polyclonal antibody for RIG-I (Abcam) or an anti-nucleoprotein (NP) polyclonal antibody [
25].
AEC II were purified and plated on collagen coated glass slides and cultured [
26]. After 1 day, the cells were infected with IAV PR8 at an MOI of 6 and incubated for an additional 24 h to stimulate RIG-I production. The cells were probed with a rabbit anti-mouse polyclonal antibody for RIG-I and a goat anti-mouse polyclonal antibody from SPC (Santa Cruz Biotechnology). Nuclei were stained with DAPI (blue). After washing, the sections were probed with a donkey anti-rabbit secondary antibody conjugated to Alexa Fluor 546 or a donkey anti-goat Alexa-Fluor 488 (all from BD/Molecular Probes). Transmitted light and fluorescent microscopy images were obtained using an Olympus BX51 microscope running Cellsens imaging software (Olympus, Center Valley, PA).
Statistical analysis
Where applicable, the data was expressed as the mean ± standard error of the mean (SEM). Statistical significance was determined by one-way ANOVA with Student-Newman-Keuls post hoc correction for multiple comparisons. Survival significance was determined by Kaplan-Meier estimator analysis. Significance was considered as p < 0.05.
Discussion
The regulatory mechanisms of innate immunity are sophisticated and complex. RIG-I is an important PRR that senses viral infection and activates antiviral and proinflammatory cytokine defenses, which may limit viral replication and increases resistance to infection. Extensive evidence has demonstrated that RIG-I is a key sensor of infection by many RNA viruses. Recent work has also shown that RIG-I directly inhibits viral replication independent of antiviral signaling [
33,
34]. Here, we compared the lung innate response in the lungs during IAV infection between RIG-I TG and WT mice. Our work showed that CS-exposed RIG-I TG mice had improved survival and lost less body weight compared to CS-exposed WT mice following IAV infection. CS-exposed IAV-infected RIG-I TG animals displayed a similar response level of lung inflammation as did NS WT mice. RIG-I overexpression restored the induction of antiviral and inflammatory genes, which were suppressed by CS in WT mice following intranasal challenge with IAV. This occurred despite the fact that inhibition of other PRRs by CS, for example TLR7, was not reversed by RIG-I overexpression (Fig.
5a). Thus, the host response initiated by RIG-I overexpression following IAV infection of mice could compensate for inhibition of multiple PRRs by long term smoking. The data suggest that RIG-I could play an important role in the recognition and control of IAV infection in mice, both in CS-exposed, and NS animals.
PRR induction by IAV in Fig.
5a was determined by mRNA level only. Additional PRR proteins or pathways likely play a role in IAV infection. Others have shown that the absence of either the RIG-I signaling adaptor mitochondrial antiviral-signaling protein (MAVS) [
35] or TLR3 [
36] diminishes viral clearance and adaptive immunity to IAV infection. These studies suggest that host recognition of IAV by PRRs in vivo and initiation of innate immunity is more complex than currently appreciated, and could differ from well-established mechanisms in vitro. There might be extensive cooperative and/or competitive interactions among different PRRs that support and regulate antiviral sensing and induction of innate immune responses.
During influenza infection, the severity of disease is the result of the interplay between viral virulence and the host response. Local inflammation and enhanced cytokine production are the hallmarks of host innate immune responses that act to protect against infection by viruses, and are essential in local control of invading microbes. The pneumonia that follows seasonal influenza infection is generally a rare complication and can be primary viral pneumonia, secondary bacterial infection, or a mixed viral/bacterial infection. By contrast, primary viral pneumonia is a major manifestation of human H5N1 disease [
37]. Primary viral pneumonia was also prominent during the severe H1N1 pandemic of 1918. In these situations, aggressive and uncontrolled immune cytokine responses may lead to deleterious consequences [
38]. For example, inflammatory responses in animal infection models immunologically naïve to IAV show that enhancement of inflammation in young adults may have been a major contributor to mortality during the 1918 influenza pandemic [
39]. In mild infection, the host has a limited or moderate response with little tissue damage and, thus, the disrupted homeostasis is restored rapidly [
40]. Either uncontrolled (usually in pandemic IAV infection) or suppressed (in immunosuppressed patients) inflammation could be dangerous to the host. Here, we demonstrate that CS suppressed and delayed the host response to IAV while RIG-I overexpression restored the impaired inflammatory and antiviral response in the lung. Thus, normal and appropriate inflammation may be necessary and beneficial for survival of the mouse during seasonal IAV infection. From Fig.
1.II, there was more staining for NP in TG mice than in WT mice, and we did not find a direct correlation of viral titer in the lung with mortality in these different groups (Fig.
3d), although it is possible this would be evident at other times during infection. Another possibility could be that the viral titers were measured during low dose IAV infections performed to study mechanisms, which may not completely mimic viral replication during fatal infection. Furthermore, enhanced viral burden may not be solely responsible for morality in mice [
41].
Because innate immunity is a key determinant of the subsequent host immune response and clinical outcome, we evaluated the timeline of inflammation and cytokine expression in the lung during infection. Our results support the hypothesis that increased mortality in IAV infection is due to dysregulation of the antiviral response in CS mice. The study also suggested that critical events influencing outcomes may occur early after infection. Early gene activation elicited by IAV infection of RIG-I TG mice likely controls the lethality. We assume that the BALF protein levels seen in NS WT mice and in both sets of TG mice reflect a near optimal host inflammatory response, as they are associated with lower mortality. Therefore, the lower levels of BALF protein levels in CS-exposed WT mice reflects a deleterious modulation of the innate response.
Cytokines also have important effects on the adhesive properties of the endothelium, causing circulating leukocytes to stick to the endothelial cells of the blood vessel wall and migrate between them to the site of infection, to which they are attracted by chemokines. CS exposure impaired the host cytokine responses of IFN-γ, IL-6, MCP-1, TNFα, IL-18 and RANTES to IAV in the lung as compared with NS infected mice. In contrast, these cytokine responses were normalized in RIG-I TG mice exposed to CS. It is notable that RIG-I overexpression restored the immune response in a controlled fashion, as it did not increase deleterious inflammation. This may occur due to regulation of the RIG-I signal through sophisticated post-translational modifications resulting in a robust yet ‘tunable’ cytokine response to maintain immune homeostasis [
42].
Acknowledgments
We want to thank Dr. Ute Hochgeschwender for helpful discussions in designing the RIG-I transgenic mice. We acknowledge the assistance from the Oklahoma Medical Research Foundation Imaging Analysis core facility and the Duke Neurotransgenic Laboratory for transgene microinjection. The OUHSC Rodent Barrier Facility was supported in part by Grant Number C06RR017598 from the National Center for Research Resources (NCRR), a component of the National Institutes of Health (NIH), and the contents of this publication are solely the responsibility of the authors and do not necessarily represent the official view of NCRR or NIH.