Introduction
Increased production of reactive oxygen species (ROS) is involved in the pathophysiology of cardiovascular diseases such as hypertension, especially in the setting of increased activation of the renin-angiotensin system [
7,
14,
21]. Increased levels of vascular ROS may induce vascular endothelial dysfunction through the superoxide-mediated inactivation of endothelium-derived vasodilator nitric oxide (NO) as well as modulate intracellular signaling pathways that promote vascular remodeling [
21]. Both these mechanisms can contribute to the development of angiotensin-dependent hypertension although redox-regulated pathways in the kidneys and the central nervous system are also important.
NADPH oxidase proteins are major sources of ROS [
2,
4,
18]. All NADPH oxidases contain a core subunit, termed Nox, which catalyzes the transfer of electrons from NADPH to molecular O
2 and leads to ROS generation. Five Nox isoforms (Nox1–5) have been identified, which form the basis of distinct NADPH oxidases and have varying requirements for other protein subunits. Among these isoforms, Nox5 is absent in rodents [
2]. In the vasculature, Nox2 and Nox4 are expressed in the endothelium, whereas vascular smooth muscle cells (VSMC) contain predominately Nox4 and Nox1 [
2,
4]. Nox2 is also expressed in adventitial fibroblasts and in human conduit artery VSMC [
2,
4]. There are significant biochemical differences between Nox1, 2 and 4. Whilst each of the three Noxs (i.e. Nox1, Nox2 and Nox4) forms a heterodimer with a p22phox subunit, Nox1 and 2 require the binding of additional regulatory subunits for their activation whereas Nox4 is constitutively active and does not require other cytosolic subunits for its activity. Nox2 activation is induced by agonists such as angiotensin II, which cause post-translational modifications of oxidase regulatory subunits (p47phox, p67phox, p40phox and Rac1) and their subsequent association with the Nox2-p22phox heterodimer. The isoform-specific expression of Noxs in the different cell types of the vessel wall and the co-expression of more than one isoform in individual cell types both suggest that the different isoforms may have distinct roles. However, cell-specific roles of Nox isoforms in vivo remain poorly understood.
It is well established that NADPH oxidases are involved in the pathophysiology of angiotensin II-dependent hypertension and endothelial dysfunction but the roles of the different Nox isoforms is less clear [
4,
7,
17,
27]. Nox1 knockout mice were reported to have a reduced basal blood pressure and an attenuation of angiotensin II-induced hypertension and endothelial dysfunction [
11,
20], whereas mice with VSMC-targeted overexpression of Nox1 had vascular hypertrophy and an enhanced pressor response to angiotensin II [
8]. Transgenic mice with VSMC-specific overexpression of Rac1 (which is required for both Nox1 and Nox2 activity) also showed enhanced angiotensin II-induced hypertension [
13]. Studies in tissues from human patients with hypertension, diabetes, heart failure or aging have correlated endothelial vasodilator dysfunction with increased Nox2 expression and activity [
9,
10]. Nox2 knockout mice show improved endothelial dysfunction in a model of renovascular hypertension [
17] but no change in basal blood pressure [
5] or the hypertensive response to chronic angiotensin II infusion [
16], nor to chronic activation of the renin-angiotensin system [
28]. The above studies suggest that VSMC Nox1 is important in angiotensin II-induced hypertension but the cell-specific roles of Nox2 and, in particular, the contribution of endothelial Nox2 remains unclear.
In this study, we generated transgenic mice with endothelium-targeted overexpression of Nox2 and investigated the effect on vascular function and angiotensin II-induced hypertension. We report that increases in endothelial levels of Nox2 in vivo contribute significantly to the enhancement of angiotensin II-dependent hypertension, vascular remodeling and endothelial dysfunction.
Methods
Transgenic mice and tissues
All animal procedures were conducted in accordance with the Guidance on the Operation of the Animals (Scientific Procedures) Act, 1986 (UK Home Office). Transgenic mice with endothelial-targeted overexpression of Nox2 were generated utilizing a tie 2 promoter/enhancer construct [
26] containing the full length human Nox2 cDNA sequence. Fertilized oocytes from CBA/C57Bl6 mice were microinjected with the construct and founder progeny was identified by PCR analysis of genomic DNA. Two independent transgenic lines were generated and backcrossed for >10 generations into a C57Bl6 background. Experiments were conducted using heterozygous male mice and wild-type littermate controls aged between 8 and 16 weeks. Aortic tissues for immunoblotting or mRNA expression analyses were snap frozen in liquid nitrogen and stored at −80°C. Endothelial denudation on aortic rings was performed using a fine wire threaded into the lumen.
Surgical procedures
Telemeter transducers (PA-C10, Data Sciences International, St. Paul, MN) were implanted under 2.5% isoflurane anesthesia. The transducer was positioned in the aortic arch via the left carotid artery whilst the transmitter body was placed in a subcutaneous pocket in the right flank. Data were collected after a 7-day recovery period. Angiotensin II or saline was administered via osmotic minipumps (Model 1002, Alzet, Cupertino, CA) implanted subcutaneously under 2% isofurane.
Western blotting
Aortic samples were lysed using a polytron homogeniser in Tris HCl (25 mM) buffer solution (pH 7.2) containing EGTA (2 mM), EDTA (5 mM), NaF (30 mM), β-glycerophosphate (40 mM), sodium pyrophosphate (20 mM), sodium orthovandate (1 mM), phenylmethylsulfonyl-fluroide (1 mM), benzamidine (3 mM), pepstatin A (5 μM), and leupeptin (10 μM). Protein content was determined using a Biorad Bradford Protein assay (Biorad, UK). Proteins were separated by SDS-PAGE and transferred onto nitrocellulose membrane. The antibodies used were: Nox2, eNOS (BD Transduction Laboratories, UK); p22phox (gift from F.Wientjes, University College London, UK); phospho- and pan-ERK (Cell Signalling, MA); nitrotyrosine (Abcam); and actin (Sigma, UK). Immunoblots were quantified by densitometry, using the actin level for normalization.
Real-time RT-PCR
RNA was isolated using an SV total RNA isolation kit (Promega, UK). cDNA was synthesized using avian myeloblastosis virus reverse transcriptase (AMV; Promega, UK) at 42°C for 90 min. Relative gene expression was quantified on an Applied Biosystems 7000 sequence detection system (Applied Biosystems, UK) using SYBR Green and the comparative Ct method, with GADPH levels used for normalization. Forward and reverse primer sequences were as follow (all 5′–3′):
GAPDH: CGTGCCGCCTGGAGAA, CCCTCAGATGCCTGCTTCAC; β-actin: GTGAAAAGATGACCCAGATCA, TGGTACGACCAGAGGCATACAG; p22phox: TGGACGTTTCACACAGTGGT, AAAGAGGAAAAAGGGGTCCA; Nox1: CATCCAGTCTCCAAACATGACAG, GCTACAGTGGCAATCACTCCAGTA; Nox2: ACTCCTTGGGTCAGCACTGG, GTTCCTGTCCAGTTGTCTTCG; Nox4: TGAACTACAGTGAAGATTTCCTTGAAC, GACACCCGTCAGACCAGGAAT; p47phox: AGAGTCGCCAGGGCACTCT, TCTTCGCCTGGCTGTCAGT; p67phox: AAGCTGTTTGCCTGTGAGGT, CTTCATGTTGGTTGCCAATG; Catalase: GCTGAGAAGCCTAAGAACGCAAT, CCCTTCGCAGCCATGTG; SOD1: GGACCTCATTTTAATCCTCACTCTAAG, GGTCTCCAACATGCCTCTCTTC; SOD2: CACACATTAACGCGCAGATCA, GGTGGCGTTGAGATTGTTCA; SOD3: GGGATGGATCTAGAGCATTAAGGA, ACACCTTAGTTAACCCAGAAATCTTTTC.
Immunohistochemistry and aortic morphology
Aortic sections for immunohistochemistry were frozen in OCT solution and stored at −80°C. Immunostaining was performed on 10 μm cryosections. Sections were incubated with polyclonal anti-Nox2 (BD Transduction Laboratories) and anti-CD31 (Chemicon) antibodies. Secondary antibodies were conjugated to Alexafluor 488 or Cy3 and analyses were performed on a Leica SP5 confocal microscope (Leica, Germany). For aortic morphology, tissues were pressure fixed in vivo with 0.9% saline perfusion followed by 4% PFA and embedded in paraffin. 6-μm sections were stained with hematoxylin and eosin. Digital images were analyzed for aortic wall thickness using Volocity software (Volocity v5.0, Perkin Elmer, USA), measuring approximately 20 radial lines from the internal elastic lamina to the external lamina per section [
8].
Superoxide dismutase (SOD) activity
Aortic homogenates were prepared in extraction buffer (NaPO
4 10 mM, EDTA 5 mM, EGTA 5 mM, NaCl 50 mM, Triton 1%, protease inhibitor cocktail 1% (Sigma), pH 7.8) and separated by zymography on 12% non-denaturing PAGE (Invitrogen, UK) in running buffer (Tris base 20 mM, glycine 150 mM, pH 8.5). The gel was subsequently soaked in the dark in potassium phosphate (50 mM, pH 7.8) solution containing nitroblue tetrazolium (NBT, 275 μg/ml), riboflavin (65 μg/ml) and
N,
N,
N9,
N9-tetramethyl-ethylenediamine (Temedm 3.2 μl/ml). Bands were developed by exposing the gel to light whilst washing in dH
2O. The SOD isoforms [SOD1, Cu/Zn-SOD; SOD2, Mn-SOD; and SOD3, extracellular (ec)-SOD] were identified by their positions on the gel corresponding to their relative molecular weights and subsequently quantified by densitometry [
6].
ROS measurements
NADPH oxidase activity was assessed by lucigenin-enhanced chemiluminescence, as described previously [
12]. Briefly, fresh aortae were incubated with or without angiotensin II (1 μM) for 30 min in DMEM at 37°C, prior to homogenization in a modified Krebs Henseleit solution (NaCl 118 mM, KCl 4.7 mM, CaCl
2 2.5 mM, NaHCO
3 25 mM, KH
2PO
4 1.2 mM, MgSO
4 1.2 mM, glucose 11 mM, HEPES 10 mM, pH 7.4) containing protease inhibitor cocktail (0.05 μl/mg; Sigma). Tissue homogenates (15 μg) were added to Krebs buffer solution, incubated at 37°C for 10 min, followed by addition of NADPH (300 μM) and dark-adapted lucigenin (5 μM). Chemiluminescence was then measured on a plate luminometer (Lucy 1, Rosys Anthos, Wals, Austria) over a 20- to 30-min period. All samples were performed in triplicate and the level of superoxide production was calculated from average area under the curve. In some experiments, one of the following inhibitors was pre-incubated with the cell homogenate for 20 min prior to the addition of NADPH: the flavoprotein inhibitor, diphenyleneiodonium (DPI, 10 μM); a NOS inhibitor,
N-nitro-
l-arginine methyl ester hydrochloride (
l-NAME, 100 μM); a mitochondrial electron transport chain inhibitor, rotenone (50 μM); a superoxide scavenger, tiron (10 mM); a putative NADPH oxidase inhibitor, apocynin (10 μM); or a xanthine oxidase inhibitor, allopurinol (100 μM).
Vascular tone
Segments of the descending thoracic aorta were suspended in an organ bath containing Krebs buffer solution comprising (in mM) NaCl 118.2, KCl 4.69, MgSO4·7H2O 1.18, KH2PO4 1.19, glucose 11.1, NaHCO3 25.0, CaCl2·6H2O 2.5 and indomethacin 0.003 mM, pH 7.4 at 37°C, for isometric tension measurements. Rings were exposed to vasoconstrictors or vasodilators. For vasodilation studies, rings were pre-constricted to 75% of the maximal contraction to phenylephrine prior to addition of acetycholine or sodium nitroprusside. In some experiments, aortic rings were incubated with angiotensin II (1 μM) for 30 min with or without tiron (10 mM) prior to any other agents. In a different set of experiments, a single dose of N-methyl-l-arginine acetate salt, (l-NMMA, 100 μM) was added to aortic rings pre-constricted to 30% of the maximal response to phenylephrine.
Statistics
Data are expressed as mean ± SEM. Comparisons between Tg and wild-type were made by unpaired Student’s t test for two groups, one-way ANOVA with Bonferroni post-hoc testing for more than two groups, or repeated measures ANOVA as appropriate. Two-way ANOVA was used to compare responses to treatments between Tg and wild-type. The entire concentration–response curves were compared by non-linear regression analysis followed by the extra sum-of-squares F test. Statistical analyses were done on GraphPad Prism (v4.03 for Windows, San Diego, CA). P < 0.05 was considered significant.
Discussion
In this study, we have investigated the effects of endothelial-targeted in vivo overexpression of the Nox2 isoform of NADPH oxidase on vascular function and angiotensin II-induced hypertension. Our main findings were that: (1) a modest twofold increase in levels of endothelial Nox2 had no effect on basal NADPH oxidase activity, vascular function or blood pressure in the absence of agonist stimulation, consistent with the knowledge that this isoform is quiescent unless stimulated [
1,
2,
4,
18]; (2) there were no significant compensatory changes in mRNA levels of Nox4, eNOS, or catalase or in SOD1-3 activity after Nox2 overexpression; (3) exposure to angiotensin II resulted in a significantly greater worsening of endothelial vasodilator function in Tg mice compared to wild-type but the magnitude of effect was very modest; (4) angiotensin II-induced hypertension was potentiated in Tg mice after chronic infusion of either a low (normally subpressor) dose or a high dose of angiotensin II; and (5) chronic high dose angiotensin II infusion caused greater vascular remodeling in Tg mice compared to wild-type. Taken together, these results suggest that an increase in endothelial levels of Nox2 contributes significantly to hypertension in settings where there is increased activation of the renin-angiotensin system, an effect that may involve endothelial dysfunction and/or vascular structural remodeling.
Angiotensin II is well known to play a major role in the initiation and progression of hypertension as well as other vascular diseases [
21]. Whilst the signal transduction of angiotensin II responses is complex, a large body of evidence points to an important role of ROS generated by NADPH oxidases [
15,
18,
21,
24]. Chronically elevated levels of angiotensin II increase NADPH oxidase activity and superoxide production in all layers of the vessel wall but the relative contribution of different Nox isoforms and different cell types to the development of hypertension remains incompletely defined. As mentioned earlier, studies in gene-modified mouse models support an important role for VSMC Nox1 in angiotensin II-dependent hypertension [
8,
11,
13,
20]. Expression levels of Nox2 increase upon angiotensin II stimulation in endothelial cells in vitro [
25] as well as in the endothelium in situ in blood vessels [
17] but the role of Nox2 in the endothelium—a major site of expression of this isoform—in the development of hypertension is unclear.
In the current study, we undertook a specific endothelium-targeted overexpression of Nox2 using the well-established tie 2 promoter construct [
26]. Endothelial-specificity of overexpression was confirmed by several approaches including immunostaining and the quantification of Nox2 levels in isolated endothelial cells and in aorta with or without endothelium. The degree of Nox2 expression that was achieved in Tg mice was comparable with the levels that have been reported in experimental models of endothelial dysfunction or hypertension [
8,
11], suggesting that the data may be pathophysiologically relevant. Importantly, the basal endothelial-specific increase in Nox2 levels was not accompanied by potentially confounding changes in levels of Nox4, antioxidant genes or eNOS. Previous studies in which p22phox was overexpressed in VMSC in vivo were accompanied by numerous changes in antioxidant genes and eNOS which significantly complicated interpretation of the effects observed [
19]. A previous study that generated an endothelium-specific overexpression of Nox2 reported a basal increase in NADPH oxidase activity which was accompanied by increased levels of eNOS and SOD2 [
3], which could potentially confound the effects of the increased endothelial Nox2 levels. In the current study, the lack of significant change in antioxidant genes and eNOS may be related to the fact that the increase in Nox2 overexpression was relatively modest and that there was no basal change in NADPH oxidase activity in the absence of agonist stimulation (unlike the previous study [
3]). Our results are in agreement with data that Nox2 oxidase is normally quiescent and that ectopic increases in the expression of Nox2 in defined cellular systems do not result in an increase in ROS production in the absence of agonist stimulation [
1,
2,
4,
18]. However, we also found that antioxidant gene expression level remained similar between groups after in vivo angiotensin II treatment. This suggests that factors other than endothelial Nox2 (e.g. ROS generated from other sources) may be more important for the regulation of these genes. We found a significant increase in the protein levels of the p22phox subunit, which binds to Nox2, in Tg mice. This is most likely to be explained by the fact that the stability of the two proteins increases when they are complexed together [
2,
4,
18], a postulate supported by the finding that there was no change in mRNA levels of p22phox. We also found no change in mRNA levels of the cytosolic subunits p47phox and p67phox that are required for Nox2 function.
Oxidase activity was significantly increased by angiotensin II stimulation in Tg aorta and this was accompanied by a significant but rather modest worsening of endothelium-dependent vasodilatation. The most likely explanation for the modest impact of endothelial Nox2 on endothelial function is that ROS generated in all layers of the vessel wall during angiotensin II stimulation can interact with NO so that the relative impact of endothelial Nox2-derived ROS may be quite small. We also found significant differences in angiotensin II-induced hypertension in vivo. Using the gold-standard method of ambulatory telemetry, we found that there was no difference in blood pressure between Tg mice and wild-type littermates at baseline (consistent with the lack of increase in basal NADPH oxidase activity) but that a low dose chronic infusion of angiotensin II that is subpressor in wild-type mice significantly enhanced both diastolic and systolic blood pressures in Tg mice. These findings are significant as they suggest that a modest increase in endothelial Nox2 activity can lead to significant hypertension. Whereas previous studies have focused on VSMC Nox1 as being pivotal for the development of AngII-induced hypertension [
8,
11,
13,
20], the current study suggests that endothelial Nox2 could also contribute. Interestingly, at a higher dose of angiotensin II, we found that only diastolic but not systolic pressure was augmented in Tg mice. A previous study by Bendall et al. [
3] in a similar model of endothelial-specific Nox2 overexpression also reported an increased systolic blood pressure response to low dose angiotensin II infusion as measured by tail-cuff plethysmography. However, that study did not study the responses to high dose angiotensin II nor were changes in diastolic blood pressure (which cannot be accurately quantified by tail-cuff plethysmography) reported. The difference between systolic and diastolic blood pressure responses to high dose angiotensin II infusion could reflect a predominant effect of endothelial Nox2 on resistance vessels, since it is known that resistance vessel remodeling or increased tone can be an important driver of diastolic hypertension. On the other hand, systolic hypertension in this setting may be driven by mechanisms independent of endothelial Nox2—such as other Noxs or ROS-independent mechanisms [
22,
23]. Several ROS-dependent mechanisms can potentially contribute to the development of angiotensin II-dependent hypertension. Although the magnitude of difference in endothelium-dependent relaxation between Tg and wild-type assessed in aortic strips in vitro was quite modest, this could nevertheless be a contributor in vivo. The relevance of this mechanism would ideally require the assessment of resistance vessel tone and remodeling in vessels from animals subjected to angiotensin II infusion. Although vessel tone or NO production was not investigated in the mice treated with angiotensin II infusion, we were able to demonstrate evidence of enhanced NO/superoxide interaction in the vessels of Tg animals—as assessed by nitrotyrosine levels. We also assessed vascular structural remodeling in the aorta and found that aortic medial area was greater after high-dose but not low dose angiotensin II in the Tg mice. A potential mechanism contributing to the increased remodeling after high dose angiotensin II could be an increased activation of ERK signaling after AngII infusion in Tg mice compared to Wt. The lack of observed difference in aortic medial area in the low dose angiotensin II group suggests that other mechanisms (such as altered endothelial function) were important. It is also possible that altered endothelial function in renal and/or central nervous system vessels leads to perturbation of function that drives hypertension [
22,
23]. Additional studies will be required to distinguish between these possibilities.
It is well documented that ROS generation and, in particular, NADPH oxidase are important components involved in angiotensin II-induced hypertension [
2,
4,
18,
21]. The recognition of differential expression of the multiple Nox isoforms in the vessel wall, their varying regulation, and their differential expression in disease settings make it necessary to assess the contributions of individual isoforms in different locations. The current study shows that increases in endothelial Nox2 levels may contribute significantly to the development of angiotensin II-induced hypertension through mechanisms that may include alterations in endothelial vasodilator function and/or an enhancement of vascular structural remodeling.
Acknowledgments
This work was supported by the British Heart Foundation (BHF), a Fondation Leducq Transatlantic Network of Excellence award, and in part by EU FP6 Grant LSHM-CT-2005-018833, EUGeneHeart. AMS holds the BHF Chair of Cardiology at King’s College London. CM and SAR were funded by BHF PhD studentships.