Introduction
S100 proteins are low molecular weight (9 to 14 kDa) intracellular calcium-binding proteins that control key cellular pathways including regulation of the cytoskeleton [
1], cell migration and adhesion [
2], and host oxidative defense [
3,
4]. Some S100 proteins have also been demonstrated to have important extracellular pro-inflammatory effects and cytokine-like activities in addition to their intracellular functions. When released from cells, S100A8, S100A9, S100A11, and S100A12 act as unconventional inflammatory cytokines [
5,
6]. Therefore, not only the expression of these proteins by cells, but also their release into the extracellular environment may have important implications on their activity in a given tissue.
S100A8 and S100A9 are found intracellularly in granulocytes, monocytes, and early differentiation stages of macrophages [
7,
8]. A clear increase and role for S100A8 and S100A9 in the synovium and macrophages in inflammatory arthritis has been established [
9,
10]. Extracellular S100A8 is considered a pro-inflammatory molecule because of its effect on cytokine synthesis [
11] and upregulation of destructive matrix metalloproteinases (MMP) and disintegrin and metalloproteases with thrombospondin motifs (ADAMTS) enzymes by macrophages [
10,
12]. In contrast, S100A9 alone was previously shown not to activate phagocytes and, when it forms a complex with S100A8, to decrease the activity of this S100 protein [
11]. Chondrocytes have also been shown to express S100A8 and S100A9 [
13] and their upregulation following stimulation with IL-1 and oncostatin-M, suggested a possible role in cartilage repair or inflammation-induced degradation [
14]. Recently, increased S100A8 and S100A9 staining of chondrocytes in inflammatory arthropathies in mice and humans was reported [
9]. This same study also demonstrated that extracellular S100A8 stimulated expression and activity of various matrix-degrading metalloproteinases by a chondrocyte cell line, and aggrecanolysis in mouse patella explant cultures [
9]. These results suggested that in inflammatory arthritis, extracellular S100A8 secreted from inflammatory cells or the chondrocytes themselves may be an important mediator of cartilage matrix degradation.
In contrast to the significant role of infiltrating inflammatory cells and synovial pannus in rheumatoid arthritis (RA), cartilage breakdown in osteoarthritis (OA) is driven primarily by the chondrocytes. Although considered to be a non-inflammatory arthropathy, a role for chondrocyte-derived cytokines in maintaining elevated proteolysis of aggrecan and collagen in end-stage human OA cartilage has been demonstrated [
15]. To date, however, the changes in S100A8 and S100A9 expression and protein localization and the potential role of these two proteins in cartilage destruction during the onset and progression of OA as opposed to inflammatory arthropathies has not been investigated. Furthermore, although it has been shown that S100A8 can induce catabolic enzymes expression in chondrocyte cell lines [
9], no previous studies have established whether S100A8 has a similar effect in primary adult articular chondrocytes or if S100A9 or the S100A8/A9 complex has a similar effect. We investigated the immunolocalization of S100A8 and S100A9 in sections of antigen-induced arthritis (AIA); the effect of IL-1α on
S100a8 and
S100a9 expression and immunolocalization in mouse cartilage explants
in vitro; the
in vivo expression and immunolocalization of S100A8 and S100A9 in cartilage during progressive cartilage destruction in an OA compared with an inflammatory arthritis model in mice; and the effect of S100A8 and S100A9 on the expression by primary adult ovine articular chondrocytes of key extracellular matrix molecules, matrix degrading enzymes, and their inhibitors.
Materials and methods
Mouse osteoarthritis model
All animal experimentation was conducted with approval from the Royal North Shore Hospital Animal Care and Ethics Committee (protocols 0051-005A and 0506-019A). OA was induced in 10-week-old male C57BL6 mice by medial meniscal destabilization (MMD) of the right knee [
16]. Joints with no surgery or subjected to sham-operation (exposure of the medial menisco-tibial ligament but no transection) were used as controls. Animals were sacrificed at 2, 4, 8 and 16 weeks after surgery (n = 3 per time point) for histology and immunohistology.
Additional 10 week-old C57BL6 male mice underwent bilateral surgery with the right knee undergoing MMD while the left knee underwent a sham-operation. Animals were sacrificed at one, two, and six weeks after surgery (n = 7 per time point). The joints were dissected to expose the articular cartilage, tibial epiphyses were isolated and placed in RNA later containing 20% EDTA, decalcified at 4°C for 72 hours and then embedded in optimal cutting temperature (OCT) compound and stored at -80°C. Serial 7 μm coronal cryo-sections were fixed in ethanol, air-dried, and non-calcified medial tibial plateau articular cartilage from previously assigned areas of cartilage fibrillation and loss of toluidine blue staining were microdissected and isolated using a Veritas microdissection system (Molecular Devices, Sunnyvale, CA, USA).
Mouse cartilage isolation and culture
Femoral head cartilage was isolated from 24-day-old C57B6 wild type mice and cultured for two or four days in serum-free medium with or without 10 ng/ml recombinant human IL-Iα (PeproTech, London, UK [
17]. In four-day cultures the media was changed after two days. At termination, femoral heads were either stored at -20°C in RNA later (Ambion, Austin TX, USA) prior to RNA extraction or embedded in OCT and stored at -80°C prior to immunostaining.
Chondrocyte isolation and culture
Chondrocytes from four-year-old ovine knee articular cartilage were isolated by sequential pronase and collagenase digestion and grown to confluence in serum-containing media [
18]. Cells were incubated overnight in serum-free medium prior to stimulation for 24 hours with serum-free medium containing 10
-7 or 10
-8 M recombinant human S100A8, S100A9, or the complex of both (n = 6 replicates/treatment). Recombinant human S100A8, S100A9, or heterocomplex with no contaminating lipopolysaccharise (LPS) were expressed and purified as described [
13,
19,
20].
At the termination of culture, ovine chondrocytes were washed with PBS, and then lysed with TRIzol (Invitrogen Life Technologies, Mulgrave, Victoria, Australia). Mouse femoral heads were pulverized using a liquid nitrogen-cooled tissue mill. Pulverised femoral heads and micro-dissected cartilage from frozen sections of sham or MMD-induced OA joints were extracted with TRIzol. Total cellular RNA in TRIzol extracts was isolated from all samples by RNeasy kit (Qiagen, Doncaster, Victoria, Australia) including an on-column DNase I (Qiagen, Doncaster, Victoria, Australia) digestion. RNA was quantified using Sybrgreen (Molecular Probes, USA) with 18S/28S rRNA as a standard (Sigma-Aldrich, Castle Hill, NSW, Australia). Three femoral heads were pooled to generate a representative RNA sample for each in vitro treatment and were analysed by microarray expression profiling. Micro-dissected cartilage from three separate joints was pooled to account for biological variability, and provide a representative sample of sham or MMD cartilage RNA at each time point for microarray analysis. The RNA from the remaining four sham and MMD joints were analysed separately using quantitative RT-PCR (qRT-PCR) for S100a8 and S100a9 to verify the results from the microarray analysis.
Ovine chondrocyte quantitative reverse transcription polymerase chain reaction
Changes in mRNA expression in cultured primary ovine chondrocytes were quantified using real-time qRT-PCR as previously described [
21]. Reverse transcription (RT) reactions were undertaken with 1 μg total RNA (Omniscript RT kit, Qiagen, Doncaster, Victoria, Australia). All samples underwent RT at the same time to avoid potential variations in experimental conditions. Aliquots of cDNA were amplified by PCR using specific ovine primer sets (Table
1). All PCR reactions generated single products with confirmed sequences (SUPAMAC, Sydney University, NSW, Australia). The differentiated phenotype of control cultures of primary ovine chondrocytes in monolayer was confirmed by examining gene expression relative to
Gapdh. However, all 'housekeeping' genes evaluated (
Gapdh,
Actb,
Hprt, ubiquitin) showed differential regulation by S100 proteins (data not shown). Therefore, to evaluate the changes induced by S100A8, S100A9, or the heterocomplex, gene expression in all cultures including controls was subsequently corrected for total RNA [
22] and the effect of added S100 proteins expressed as fold change from control cultures.
Table 1
Ovine-specific real time PCR primer pair sequences, annealing temperatures and product size
Acan
| F - TCA CCA TCC CCT GCT ACT TCA TC R - TCT CCT TGG AAA TGC GGC TC | 58 | 105 | |
Adamts1
| F - CCA ACT GGA GCC ACA AAC ATT G R - GGA CAG AGT GAA GTC GCC ATT C | 55 | 126 | [GenBank: XM_589626] |
Adamts4
| F - AAC TCG AAG CAA TGC ACT GGT R - TGC CCG AAG CCA TTG TCT A | 60 | 149 | |
Adamts5
| F - GCA TTG ACG CAT CCA AAC CC R - CGT GGT AGG TCC AGC AAA CAG TTA C | 55 | 97 | |
Col2a1
| F - TGA CCT GAC GCC CAT TCA TC R - TTT CCT GTC TCT GCC TTG ACC C | 55 | 154 | [GenBank: X02420] |
Mmp1
| F - CAT TCT ACT GAC ATT GGG GCT CTG R - TGA GTG GGA TTT TGG GAA GGT C | 55 | 122 | [GenBank: AF267156] |
Mmp3
| F - TCC CCC AGT TTC CCC TAA TG R - GAT TTC TCC CCT CAG TGT GCT G | 58 | 124 | [GenBank: AF135232] |
Mmp13
| F - GGT GAC AGG CAG ACT TGA TGA TAA C R - ATT TGG TCC AGG AGG GAA AGC G | 58 | 349 | |
Mmp14
| R - CCC AGT GCT TGT CTC CTT TGA AG | 56 | 126 | [GenBank: AF267160] |
Timp1
| F - GGT TCA GTG CCT TGA GAG ATG C R - GGG ATA GAT GAG CAG GGA AAC AC | 57 | 265 | [GenBank: S67450] |
Timp2
| F - ACT CTG GCA ACG ACA TCT ACG G R - TCT TCT TCT GGG TGG CAC TCA G | 57 | 261 | [GenBank: M32303] |
Timp3
| F - CTT CCT TTG CCC TTC TCT ACC C R - TCT GGT CAA CCC AAG CAT CG | 57 | 286 | [GenBank: NM_174473] |
Gapdh
| F - CCT GGA GAA ACC TGC CAA GTA TG R - GGT AGA AGA GTG AGT GTC GCT GTT G | 58 | 139 | [GenBank: U94889] |
Mouse cartilage RNA amplification, microarray hybridization and qRT-PCR
To quantify changes in all
S100 mRNA in cultured mouse femoral heads and micro-dissected tibial cartilage from the OA model, linear amplification in one or two rounds, respectively, was performed using the MessageAmp kit (Ambion, Austin TX, USA) following the manufacturers guidelines. Aminoallyl-modified UTP was incorporated and then labelled with reactive fluorophors Cy3 or Cy5 (GE Healthcare, Rydalmere, NSW, Australia). Duplicate microarrays (Cy3/Cy5 dye-swap with replicate RNA samples) were performed for
in vitro treatment (i.e. control versus IL-1 at each time point), and sham versus MMD (at one, two and six weeks). Labelled RNA was hybridized to 44 k whole genome oligo microarrays (G4122A, Agilent Technologies, Forest Hill, Victoria, Australia). The arrays were scanned on an Axon 4000B scanner and features extracted with GenePix Pro 4.1 software (Molecular Devices, Sunnyvale, CA, USA). Raw data was processed using a print-tip Loess normalization [
23] using limmaGUI software [
24]. Mean log2-transformed expression ratios and B-statistic values (log posterior odds ratio [
23] were calculated for all direct comparisons [
25]. Data is plotted as the average fold-change compared with control for femoral head culture experiments, or average fold-change with MMD compared with sham surgery at each time point. The changes in
S100a8 and
S100a9 mRNA expression in micro-dissected mouse tibial cartilage following MMD were validated by qRT-PCR in four separate animals at each time point, and the median fold change in MMD compared with sham-operated joints was calculated. These analyses were performed as previously described [
26] using mouse-specific primer pairs (
S100a8 forward - TGCGATGGTGATAAAAGTGG, reverse - GGCCAGAAGCTCTGCTACTC;
S100a9 forward - CACAGTTGGCAACCTTTATG, reverse - CAGCTGATTGTCCTGGTTTG), and the expression of
S100a8 and
S100a9 were normalized using the geometric mean expression of two housekeeping genes [
27],
Atp5b (forward - GGCTGATAAGCTGGCAGAAG, reverse - GGAGAGATCAGTTGCAGTGCT), and
Rpl10 (forward - TTGAAGACATGGTTGCTGAGA, reverse - AGGACCACGATTGGGGATA). These two housekeeper genes were shown by microarray expression profiling to be unchanged during the onset and progression of OA in the MMD mouse model (data not shown).
Immunolocalization of S100A8 and S100A9
Sections from archival paraffin blocks of male C57BL6 mouse knee joints with either AIA (7 and 28 days after induction) or saline injection from a previous study [
16] were prepared at the same time as serial sections from the mouse knee joints with surgically-induced OA. Together with frozen sections from femoral head cultures, slides were immunolocalized with polyclonal antibodies to S100A8 and S100A9 (generously provided by Professor Caroline Geczy [
13] and Dr. Thomas Vogl [
9,
12]). Immunostaining with the two different S100A8 and S100A9 antibodies gave similar results, and therefore only those obtained using the antibodies supplied by Zreiqat and colleagues [
13] are shown. Negative controls included omitting the primary antibody or using an equivalent concentration of rabbit immunoglobulin (Ig)G as a control for nonspecific antibody binding. Images representative of typical immunostaining in mouse knee joints with either OA or AIA are presented. The antibodies to S100A8 did not recognize recombinant S100A9 on western blotting and vice versa (data not shown); the anti-S100A8 and anti-S100A9 polyclonal antibodies did not cross-react with human S100A12, S100B or S100A1 [
28,
29]. The specificity of immunostaining was further validated by pre-absorption with 10 nmol of the recombinant proteins for one hour at room temperature prior to immunolocalization.
Statistical analysis
Comparisons of parametric data were undertaken using the unpaired Student's t-test with Benjamini-Hochberg correction for multiple comparisons [
30]. Differential expression in microarray analysis was assumed for B-statistic of 1.0 or more [
23].
Discussion
In this study S100A8 was immunolocalized in chondrocytes in normal murine articular cartilage in vivo, and for the first time we showed that this intracellular S100A8 is lost in OA. This contrasted sharply with the retention or increase of S100A8 immunostaining in chondrocytes in cartilage from inflammatory arthropathies such as AIA. S100A9 protein was not detectable in chondrocytes in the normal non-calcified region of the articular cartilage, and although it increased in inflammatory arthritis, no chondrocyte or cartilage immunostaining was detected in OA. We found that the lack of S100A8 and S100A9 protein localization in chondrocytes early in OA, was not associated with a decrease but rather a significant increase in mRNA expression for both proteins. Although increased chondrocyte mRNA for S100a8 and S100a9 could be induced by IL-1 in vitro, this was associated with an increase in cell and cartilage matrix staining for the two proteins. Together with the distinctly different chondrocyte expression profile of other S100 proteins in IL-1-stimulated compared with OA murine cartilage, this suggests that the early upregulation of S100A8 and S100A9 in surgically-induced OA was not due to increased IL-1 activity. Importantly, increased mRNA levels for both S100a8 and S100a9 in early OA was associated with a loss of cellular staining, suggesting that these S100 proteins may be secreted from the cells and act as extracellular signaling molecules. We have now shown that homodimeric S100A9 promotes increased catabolic enzyme and decreased matrix protein gene expression in chondrocytes very similar to that induced by the S100A8 homodimer. In contrast, the heterodimeric complex failed to alter chondrocyte metabolism, suggesting that a dysregulation in expression and/or secretion of the two subunits may play a significant role in their potential bioactivity.
Taken together the above novel findings suggest that the regulation of
S100a8 and
S100a9 expression and secretion from chondrocytes could play a role in the early stages of cartilage degradation in OA, and highlight the significant differences in the pathogenesis of cartilage destruction in OA versus inflammatory joint diseases. The strong positive chondrocyte staining for both S100A8 and S100A9 observed in AIA in the current study was in accord with previously reported results in this inflammatory arthritis model [
9]. However, we found that normal mouse articular chondrocytes were positive for S100A8, the specificity of which was confirmed by the lack of staining with equivalent pre-immune IgG and pre-absorption of the antibody with recombinant S100A8. This positive S100A8 staining contrasts with a previously reported lack of immunostaining in normal mouse knees [
9], but is consistent with positive S100A8 and S100A9 staining in murine and human growth plate chondrocytes [
13], and non-stimulated H4 murine chondrocyte cells [
9]. The reason for this discrepancy is unclear but may relate to differences in staining sensitivity due to fixation, decalcification, antibodies, and/or immunostaining methods used. Indeed, in frozen sections of mouse femoral head cartilage we could show positive S100A9 as well as S100A8 staining. This different staining pattern in the femoral head cartilage compared with adult joints, may be due to the age of the mice from which the cartilage was obtained, and/or that the tissue was cultured for four days prior to immunostaining. Nevertheless, the results are consistent with active synthesis of both S100A8 and S100A9 proteins by chondrocytes in normal non-calcified articular cartilage. The change in S100A8 immunostaining in surgically-induced mouse OA was restricted to the load-bearing areas of articular cartilage, whereas localization in other tissues and at the joint margins was unaltered. This differed in AIA where increased meniscal staining for S100A8 and S100A9 was observed in association with positive articular chondrocyte staining. This suggests that local factors such as mechanical overloading of the cartilage, rather than humoral agents affecting the whole joint such as cytokines or growth factors, play a significant role in regulating the metabolism of these proteins in cartilage in OA.
MMP-2 and MMP-9 have been shown to degrade S100A8 and S100A9 [
31] and both of these MMPs are upregulated in OA cartilage [
32,
33] and could potentially explain the loss of immunostaining in the mouse model. It is also possible that the increased chondrocyte
S100a8 and
S100a9 mRNA in early MMD-induced OA was not translated into protein, through micro-RNA silencing pathways predicted to act on the mRNA of both genes [
34,
35]. However, we speculate that the loss of chondrocyte immunostaining for both S100A8 and S100A9 in early OA while mRNA expression for both proteins is increased, may be due to their secretion from the cell. S100A8 and S100A9 are released from macrophages and neutrophils during inflammation [
6], and this secretion is concomitant with loss of cellular immunostaining [
36], similar to that observed in the chondrocytes in the present study. S100A9 is released from IL-1-stimulated mouse cartilage
in vitro, while S100A8 is not detected in this same conditioned media, suggesting either differential release or extracellular processing/degradation of the two proteins [
37]. In the current study there was evidence of extracellular release of S100A9, and to a lesser extent S100A8, with positive immunostaining in the surface matrix lamina of IL-1-stimulated mouse femoral head cartilage (Figure
5b). However, the chondrocytes still remained strongly immunopositive for both S100A8 and S100A9 in this IL-1-stimulated cartilage despite secretion of the S100 proteins, which contrasts with lack of chondrocyte staining in OA mouse joints. To date, we have not been able to confirm if there is increased soluble S100A8 or S100A9 in articular cartilage in OA. It remains unclear, therefore, whether release of S100A9 and/or S100A8 from chondrocytes occurs in early OA or with excessive mechanical loading of cartilage.
Release of S100A8 and S100A9 proteins from chondrocytes into the extracellular space, would facilitate their activity as cytokine-like molecules in early OA. We showed that exogenous/extracellular S100A8, and for the first time S100A9 homodimer, could have a role in initiating cartilage degradation by decreasing chondrocyte expression of aggrecan (
Acan) and collagen II (
Col2a1), but increasing
Adamts1,
Adamts4,
Adamts5,
Mmp1, Mmp3, and
Mmp13 mRNA levels. The increase in metalloproteinase mRNA was not balanced by a similar increase in TIMPs, promoting a potential imbalance in enzyme/inhibitor ratios and matrix degradation once the pro-MMPs are activated. This is consistent with the recent report showing increased aggrecanolysis in murine patella explant cultures stimulated with S100A8 [
9]. The effects of S100A8 on primary ovine articular chondrocytes were in general agreement with that reported in the synovium and macrophages [
12], and the H4 murine chondrocyte cell line [
9], although some subtle differences were noted. We found no regulation of
Mmp14 by S100A8 in chondrocytes, whereas this enzyme was upregulated in synovium [
12]. It has been suggested that the chondroprotection in inflammatory arthritis in S100A9 knock-out mice could be due to the concomitant lack of S100A8 in these animals [
9]. Our results have now shown that S100A9 homodimer itself could play a role in cartilage breakdown by inducing similar regulation of potential cartilage-degrading enzymes in chondrocytes as S100A8.
Thus far there is no explanation as to why the heterodimer is inactive and the homodimers are active in chondrocytes. We speculate that the heterodimers may require a trigger for activation in contrast to the homodimers, which are constitutively active. For the murine heterodimer one such trigger is LPS, and activation of cells by LPS is amplified in the presence of the murine heterodimer [
11]. It has been suggested that S100A8/S100A9 complex formation results in conformational change and altered biological function of the individual proteins [
11,
38]. Oligomerization of the heterodimer with calcium/zinc binding may result in steric masking of the receptor-binding epitope [
38]. This is consistent with the fact that S100A8/S100A9 complex failed to regulate gene expression in chondrocytes. Previously, however, the heterodimercomplex but neither homodimer was found to be active in stimulating endothelial cells [
39], and the complex upregulated MMP13 in macrophages to a similar level as the S100A8 homodimer [
12]. These divergent results suggest that the S100 proteins may elicit distinct effects in different cell types within the joint. It would be interesting in the future to determine whether these differential effects are driven by variation in expression of potential receptors for these S100 proteins, such as cell-surface heparan sulfate proteoglycans [
40] or toll-like receptor-4 (TLR4) [
11], which are expressed by chondrocytes [
41,
42]. TLR4 in particular has been strongly implicated in joint inflammation and cartilage destruction in experimental inflammatory arthropathies in mice [
43].
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
HZ contributed to study design, acquisition of data, analysis and interpretation of data, and manuscript preparation. DB contributed to acquisition of data, analysis and interpretation of data, and manuscript preparation. MMS contributed to acquisition of data, analysis and interpretation of data, manuscript preparation, and statistical analysis. RW contributed to acquisition of data. LAR contributed to acquisition of data, and manuscript preparation. KJ contributed to analysis and interpretation of data. YR contributed to analysis and interpretation of data, and manuscript preparation. TV contributed to analysis and interpretation of data, and manuscript preparation. JR contributed to manuscript preparation. JFB contributed to manuscript preparation. CBL contributed to study design, acquisition of data, analysis and interpretation of data, manuscript preparation, animal management, and animal surgery. All authors read and approved the final manuscript.