Background
Prostate cancer is the second most common malignant cancer in male patients and has high morbidity and mortality [
1]. In the past, hormone therapy, surgery and radiation therapy were requirements for advanced prostate cancer; however, since 2004, chemotherapy (docetaxel) has begun to play a significant role [
2]. Consequently, finding and studying more specific chemotherapy drugs has important significance for advanced prostate cancer patients. Salinomycin is a monocarboxylic polyether antibiotic isolated from
Streptomyces albus [
3]. In 2009,
Gupta and colleagues found that salinomycin had nearly 100-fold higher potency against breast cancer stem cells (CSCs) than paclitaxel in a screen of 16,000 compounds [
4]. Salinomycin is considered a promising anti-tumor chemotherapy drug, which may reduce the resistance and relapse of cancer by killing cancer cells and CSCs [
5].
It has been reported that salinomycin is an ionophore that transports cations (K
+, Na
+, Ca
2+, and Mg
2+) through cell membranes [
6]. Salinomycin can increase intracellular cation concentrations and disrupt the osmotic balance, resulting in apoptosis [
7]. In addition, salinomycin is found to inhibit the Wnt/β-catenin signaling pathway and selectively induces apoptosis [
8,
9]; reduce the activity of ABC transporters [
10]; induce oxidative stress [
11], autophagy [
12,
13], and anti-angiogenic and anti-tumorigenic activities [
14]; inhibit EMT (Epithelial-mesenchymal transition) [
15]; and inhibit cancer cell growth [
16,
17]. Despite all of this evidence, the molecular mechanism for salinomycin remains elusive, and the precise target of salinomycin action is unclear.
In our previous studies, we found that salinomycin could kill CSCs in lung cancer and inhibit cell growth and target CSCs in prostate cancer [
5,
18]. The cytotoxicity of salinomycin to human prostate cancer PC-3 cells was stronger than to nonmalignant prostate cells RWPE-1. Salinomycin induced apoptosis of PC-3 cells by Wnt/β-catenin signaling pathway. Salinomycin, but not paclitaxel, triggered more apoptosis in aldehyde dehydrogenase- (ALDH-) positive PC-3 cells, which were considered as the prostate cancer stem cells, suggesting that salinomycin may be a promising chemotherapeutic to target CSCs [
5]. Furthermore, we found that salinomycin-induced autophagy blocks apoptosis via the ATG3/AKT/mTOR signaling axis in prostate cancer PC-3 cells [
19]. Salinomycin induced apoptosis and autophagy in PC-3 cells. Interestingly, autophagy inhibition enhanced salinomycin-induced apoptosis. ATG3 was involved in the blockage of apoptosis by autophagy in salinomycin-treated PC-3 cells. ATG3 regulation might occur through the AKT/mTOR signaling axis [
19]. However, our previous studies did not address the precise target of salinomycin action.
To investigate the mechanism of salinomycin, a microarray analysis was used to identify DEGs in vitro (PC-3 cells) and in vivo (NOD/SCID mice xenograft model generated from implanted PC-3 cells). ATPase sarcoplasmatic/ endoplasmatic reticulum Ca
2+ transporting 3 (
ATP2A3), a significantly upregulated gene, was successfully identified, which encoded one of the Ca
2+-ATPases. It is known that ATP2A3 is localized in the ER membrane and involves in Ca
2+ transport [
20,
21].
Griffin et al. found that the expression of ATP2A3 was downregulated in Jurkat cells, reducing the transport of Ca
2+ from the cytoplasm into the ER [
22]. Other studies found that upregulation of ATP2A3 caused increases in reticular calcium content in the pheochromocytoma cell line PC12 and ultimately resulted in apoptosis [
23].
In this study, we found that ATP2A3 might be a potential targets for salinomycin, which inhibits Ca2+ release and triggers ER stress. This finding could provide new clues for the mechanism of the salinomycin anti-cancer effects.
Methods
Cell culture, drugs and cell survival assay
Human prostate cancer PC-3 and DU145 cells (ATCC, Manassas, VA, USA) were cultured as previously described [
5]. Salinomycin (Sigma-Aldrich, St Louis, MO, USA), BAPTA-AM (Selleckchem, Houston, TX, USA) were dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich, St Louis, MO, USA). Sodium phenylbutyrate (4-PBA) was dissolved in water.
Tumorigenic studies in NOD/SCID mice
For tumorigenic studies, PC-3 cells were subcutaneously inoculated into the flanks of NOD/SCID male mice (5 weeks of age; Beijing HFK BioScience Co., Ltd. Beijing China). Mice were housed in a standard laboratory environment (temperature: 24 ± 2 °C; humidity: 50 ± 5%; 12 h day-night cycle) and treated intraperitoneally (i.p.) daily with either DMSO or salinomycin at a dose of 10 mg/kg/day/200 μL (each group was 5). After 3 weeks, the mice were euthanized by carbon dioxide inhalation followed by cervical dislocation. The xenografts were excised and pulverized in liquid nitrogen. Animal studies have approved by the animal ethics committee from South China university.
Gene expression microarray analysis
Cultured PC-3 cells were treated with 1.0 μM salinomycin or DMSO control for 24 h. Then, total RNA from the abovementioned cells or tumors was extracted with TRIzol reagent (Life Technologies, Inc., Carlsbad, CA, USA) according to the manufacturer’s protocol. Double-stranded cDNA (ds-cDNA) was synthesized from 5 μg of total RNA using a SuperScript ds-cDNA synthesis kit (Life Technologies, Inc., Carlsbad, CA, USA). Human 12 × 135 K Gene Expression Arrays (Roche NimbleGen) were hybridized at 42 °C for 16 to 20 h with 4 μg of Cy3 labeled ds-cDNA in NimbleGen hybridization buffer/hybridization component in a hybridization chamber (Hybridization System-NimbleGen Systems, Inc., Madison, WI, USA).
Microarray data acquisition and analysis
Slides were scanned at 5 μm/pixel resolution using an Axon GenePix 4000B scanner (Molecular Devices Corporation) piloted by GenePix Pro 6.0 software (Axon). Scanned images (TIFF format) were then imported into NimbleScan software (version 2.5) for grid alignment and expression data analysis. The expression data were normalized through quantile normalization and the Robust Multichip Average (RMA) algorithm included in the NimbleScan software. All gene level files were imported into Agilent GeneSpring GX software (version 11.5.1) for further analysis. Differentially expressed genes were identified through fold Change filtering.
Quantitative RT-PCR analysis
Quantitative RT-PCR (reverse transcription-polymerase chain reaction) was performed with FastStart Essential DNA Green Master (Roche, Mannheim, Germany). All reactions were performed on the Roche LightCycler 96 Real-Time PCR system (Roche Diagnostics GmbH, Mannheim, Germany). Individual values were normalized to the
GAPDH loading control. Sequences of gene primers are listed in Table
1. The mRNA expression levels were analyzed using delta cycle threshold (ΔCt) values.
Table 1
Primers used for quantitative RT-PCR experiments
MAGEA3
| TCGGTGAGGAGGCAAGGTTC | CGGGAGTGTGGGCAGGAG | 123 |
ATP2A3
| CTCTGACTTGCCTGGTGGAGA | GGTGAACTCCTTCCGCATCA | 122 |
NPY1R
| CCTTTGTGAGGTGTTTGTGGG | TGAAGCTAGGAAGAGACGCC | 116 |
BTBD15
| ACGAGTGCAAAACATGTGGCG | GCCTTTGGAGTGGTACTGTGAA | 242 |
HSD17B12
| GGAGCAGCGCCTATTAGTGT | CGAAATACGCAGGGCTAGGT | 189 |
IPF1
| GAATGGCTTTATGGCAGATTA | TGATACTGGATTGGCGTTGT | 191 |
BGN
| CGGACACACCGGACAGATAG | AAAGGACACATGGCGCTGTA | 293 |
GAPDH
| GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA | 131 |
Immunohistochemistry staining
Human prostate cancer tissues and para-carcinoma tissues were obtained from the Second Affiliated Hospital, University of South China with institutional review board approval. Some sections were stained with HE. Immunohistochemistry staining was performed as described previously [
24,
25] using ATP2A3 (1:500, GeneTex, San Antonio, TX, USA), BIP and ATF4 antibodies (all from CST, Danvers, MA, USA). Images were captured by a CCD camera (Olympus, Center Valley, PA).
Western blot analysis
Protein extraction and Western blotting were performed as previously described [
26]. The primary antibodies BIP, PERK, ATF4, eIF2a, CHOP, Caspase 12, p-PERK, p-eIF2a, p-CaMK-II (all from CST, Danvers, MA, USA), CaMK-II (Bioworld Technology, Inc., Minneapolis, MN, USA) and ATP2A3 (GeneTex, San Antonio, TX, USA) were used to detect the ER stress. PARP, cleaved PARP antibodies (all from CST, Danvers, MA, USA) were used to detect apoptosis. The β-actin antibody (CST, Danvers, MA, USA) was used as an internal control.
Transmission electron microscopy
For electron microscopy, PC-3 cells were plated at a density of 106 cells in 100 mm cell culture dishes. The cells were treated with salinomycin for 24 h. Subsequently, the cells were harvested, washed in PBS, and fixed in 2.5% glutaraldehyde/0.2 M phosphate buffer solution (pH 7.4) at 4 °C. Finally, cells were detected by transmission electron microscopy (Servicebio Co., Ltd. Wuhan, China).
Immunofluorescence staining
Immunofluorescence staining was performed after salinomycin treatment, as previously described [
27]. BIP (1:200, Abcam, Cambridge, MA, USA) and CHOP (1:200, CST, Danvers, MA, USA) antibodies were used in this experiment. Secondary antibodies conjugated with Alexa Fluor-647 (Abcam, Cambridge, MA, USA) and Alexa Fluor-488 (Abcam, Cambridge, MA, USA) were used. The fluorophore-labeled cells were examined and analyzed by laser scanning confocal microscopy (Olympus, Tokyo, Japan).
Detection of [Ca2+]i by Fluo-3/AM
Intracellular Ca2+ release was detected using the fluorescent probe Fluo-3/AM (Beyotime Biotechnology Co., Haimen, China). For salinomycin treatment, PC-3 and DU145 cells were incubated with Fluo-3/AM stock solution (0.5–5 μM) at 37 °C in the dark for 10 min following three washes with PBS. Samples were analyzed by a FACS-Calibur (BD Biosciences, San Jose, CA, USA), and fluo-3 was detected using a 530/30 nm filter. The arithmetic mean of fluo-3 fluorescence intensity was expressed as [Ca2+]i. Images of these cells were also captured using an inverted fluorescence microscope (Carl Zeiss, Jena, Germany) to observe the green fluorescence. The results were averaged from three independent experiments.
Plasmid construction and cell transfection
To construct recombinant ATP2A3 plasmids, the ORF of ATP2A3 was amplified by PCR and subcloned into the pCDH cDNA cloning lentivector (Cat#CD513B-1; SBI, Mountain View, CA) using the following primers:5′-CCCAAGCTTATGGAGGCGGCGCATCTG-3′ (forward, Hind III included) and 5′-CCGCTCGAGCTTCTGGCTCATTTCGTGC-3′ (reverse, Xho I included). All constructs were verified by sequencing (Sanggon Biotech Co., Ltd., Shanghai, China). The pDsRed2-ER plasmid was purchased from Clontech (Palo Alto, CA, USA). Cell transfection was performed with TurboFect™ in vitro Transfection Reagent (Fermentas, Glen Burnie, MD, USA) according to the manufacturer’s instructions.
Small interfering RNA knockdown
Small interfering RNA (siRNA) was used to knockdown ATP2A3 expression in PC-3 cells. ATP2A3-siRNAs and negative control sequences were synthesized by RiboBio Co., Ltd. (Guangzhou, China). The siRNAs were transfected by Lipofectamin 2000 (Invitrogen, Life Technologies, Inc., Carlsbad, CA, USA) according to the manufacturer’s instructions.
Cell cycle and apoptosis analysis
PC-3 cells were seeded in six-well plates and then transfected with pCDH cDNA-ATP2A3 or empty vector for 24–48 h. For cell cycle analysis, cells were fixed and stained as previously described [
26]. For apoptosis analysis, apoptosis and necrosis were evaluated by annexin V-FITC/PI staining as previously described [
26]. The samples were analyzed by a FACS-Calibur (BD Biosciences, San Jose, CA, USA).
Statistical analysis
The results were representative of at least three replicates except where specified and are shown as the mean ± SD. To compare the rates of cell apoptosis, a chi-square test was used. For WB of protein expression, ImageJ was used to quantify the density of each band, and then the significance of the fold change was determined with one-way analysis of variance (ANOVA); the significance of the difference of mean fluorescence between groups was also tested with ANOVA. The LSD t-test was used to compare the groups. All statistical analyses were performed using the SPSS 18.0 software (SPSS Inc., Chicago, IL, USA) for Windows. A P value < 0.05 was considered statistically significant.
Discussion
Salinomycin has been shown to exert anti-cancer effects in human prostate cancer as well as in other cancers [
35]. However, the molecular mechanism of salinomycin is not completely known. Therefore, a microarray-based approach was used and a significantly upregulated gene,
ATP2A3, was successfully identified in this study. ATP2A3 is involved in Ca
2+ transport [
20]. Coincidentally, a recent study showed that salinomycin’s action is comparable to that of nigericin (K
+/H
+ exchanger) [
36]. Therefore, we hypothesized that the anti-cancer effects of salinomycin might be associated with cation transport in prostate cancer cells.
Our results showed that salinomycin upregulated the expression of ATP2A3 in PC-3 and DU145 prostate cancer cells. The
ATP2A3 gene encodes Ca
2+-ATPase3 from the sarco/endoplasmic reticulum (SERCA3), which is expressed in endothelial and epithelial tissues [
37,
38]. We found that ATP2A3 was slightly expressed in human prostate cancer tissues, which suggested that the expression of ATP2A3 might be correlated with prostate tumorigenesis. Thus, we investigated the effects of ATP2A3 in PC-3 and DU145 prostate cancer cells. The results showed that ATP2A3 overexpression inhibited cell cycle progression, induced apoptosis, and markedly triggered ER stress. Consistent with previous reports [
12,
39], salinomycin triggered ER stress in prostate cancer PC-3 cells.
ER stress is a physiological response that is caused by internal or external stimuli such as oxidative stress [
40], ischemia [
41], and Ca
2+ disorders [
20]. ER stress is orchestrated by the unfolded protein response (UPR), and failure to adapt to ER stress results in apoptosis [
42]. Transient ER stress could activate UPR and promote cell survival [
43]. When ER stress is not mitigated, the UPR triggers apoptosis. The UPR is mediated by at least three major stress sensors: IRE1, ATF6 and PERK [
42]. Each stress sensor uses a unique mechanism to promote the activation of a specific transcription factor and the upregulation of a subset of UPR target genes. In this study, we found that ATP2A3 overexpression and salinomycin treatment triggered ER stress by the PERK sensor in PC-3 cells. However, ATP2A3 silencing reduced salinomycin-triggered ER stress. Based on these findings, we postulated that salinomycin-triggered ER stress might be related to ATP2A3 upregulation in PC-3 cells.
ATP2A3 is a fundamental for maintaining intracellular [Ca
2+] homeostasis by pumping Ca
2+ into the ER of eukaryotic cells [
44]. [Ca
2+]
i is a ubiquitous second messenger that operates with versatility in the regulation of several physiological events, such as apoptosis [
45]. Alterations to the Ca
2+ transport or homeostasis machinery have detrimental effects on survival and health [
46]. We found that salinomycin inhibited Ca
2+ release, thereby resulting in ER stress in PC-3 cells. As expected, ATP2A3 silencing reduced the salinomycin-mediated inhibition of Ca
2+ release. These results suggest ATP2A3 might be a potential target for salinomycin, which inhibits Ca
2+ release and triggers ER stress to exert anti-cancer effects. Furthermore, our data suggest that salinomycin-mediated inhibition of Ca
2+ release might be related to CaMKs via ubiquitin mediated protein degradation [
33], which will be one focus of our future studies.
Acknowledgments
We are grateful to Professor Dan Li from the College of Biology at Hunan University and Zhiqiang Liu from the Department of Pathophysiology at Tianjin Medical University for helpful scientific discussion. We are also grateful to Research assistant Lanhua Zhao from the Medical College at University of South China for flow cytometric analysis.