Serum amyloid A triggers the mosodium urate -mediated mature interleukin-1β production from human synovial fibroblasts

Recombinant human SAA was purchased from Peprotech (Rocky Hills, NJ, USA). According to the manufacturer, the endotoxin level of the product is 0.1 ng/mg protein. MSU crystals were purchased from Alexis (Lausen, Switzerland). Polyclonal anti-IL-1β, pro-IL-1β and anti-cleaved caspase-1 (D57A2) antibodies were purchased from Cell Signaling Technology (Beverly, MA, USA). Anti-caspase-1 polyclonal antibodies (sc-622) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-NLRP3 antibodies were obtained from Abcam (Cambridge, UK). Anti-cathepsin B antibodies and caspase-1 inhibitor (z-YVAD-FMK) were obtained from Calbiochem (San Diego, CA, USA)

Synovial tissues were obtained from patients with rheumatoid arthritis at the time of total joint replacement. Synovial fibroblasts were isolated from the synovial tissues by enzymatic digestion. The study was approved by the Ethics Committees Nagasaki Medical Center and informed consent was obtained from each of the individuals. Synovial fibroblasts were used from passages 4 through 6 during which time they are a homogeneous population of cells (<1% CD 45 positive).

Synovial fibrablasts (5 × 10⁴) were seeded in 24-well plates containing RPMI1640 supplemented with 10% heat-inactivated FBS and stimulated with MSU for 24 hours. In some experiments, synovial fibrablasts were pre-treated with SAA for 12 hours before stimulation. Cell-free supernatants were collected by centrifugation at 400 g for five minutes and assayed for IL-1β or IL-1α with enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN, USA) without the steps for concentrations or precipitations. The same supernatants were also subjected to 12% SDS-PAGE, followed by immunoblotting with Abs for human IL-1β (dilution 1:400), caspase-1 (dilution 1:500), and cathepsin B (dilution 1:500) with an ECL Western blotting kit (Amersham, Little Chalfont, UK). Endotoxin was measured by chromogenic limulus test (Toxicolor LS-50M Kit, SEIKAGAKU CORPORATION, Tokyo, Japan).

Synovial fibroblasts were transfected with 100 nM non-targeting control small interfering RNA (siRNA; AllStars Negative Control siRNA; Qiagen, Hilden, Germany) or with 50 nM two NLRP3 siRNAs (CIAS1_6 and CIAS1_9; Qiagen), combined with the HiPerFect Transfection Reagent (Qiagen) under serum-free condition, as instructed by the manufacturer. The medium was subsequently replaced, pretreated with SAA for 12 h and stimulated with another 24 h with MSU with medium containing 10% FBS. The cell-culture medium was collected for IL-1β ELISA analysis. In some experiments cells were harvested for total RNA purification after SAA pretreatment and analyzed by semi-quantitative RT-PCR (NLRP3), as described below.

Total RNA was extracted from synovial fibroblasts using the RNeasy total RNA isolation protocol (Qiagen, Crauley, UK) according to the manufacturer's protocol. First-strand cDNA was synthesized from 1 μg of total cellular RNA using an RNA PCR kit (Takara Bio Inc., Otsu, Japan) with random primers. Thereafter, cDNA was amplified using specific primers respectively. The specific primers used were as follows:

NLRP3: forward primer 5'- AAAGAGATGAGCCGAAGTGGG -3' reverse primer 5'- TCAATGCTGTCTTCCTGGCA -3' β-actin; forward primer 5'-GTGGGGCGCCCCAGGCACCA-3' reverse primer 5'-CTCCTTAATGTCACGCACGATTTC-3'.

The product sizes were 79 bp for NLRP3 and 234 bp for β-actin. The thermocycling conditions (35 cycles) 94°C for 60 s and 62°C for 60 s, and 72°C for 60 s.

The amplification of the IL-1-β transcripts was also accomplished on a Light Cycler (Roche Diagnostics, Mannheim, Germany) using specific primers. The housekeeping gene fragment of glyceraldehydes-3-phosphates dehydrogenase (GAPDH) was used for verification of equal loading.

Synovial fibroblasts were stimulated with SAA with the indicated concentrations of SAA for 24 h. Cells were washed by ice-cold PBS and lysed with a lysis buffer (1% Nonidet P 40, 50 mM Tris, pH 7.5, 100 mM NaCl, 50 mM NaF, 5 mM EDTA , 20 mM β-glycerophosphate, 1.0 mM sodium orthovanadate, 10 μg/mL aprotinin and 10 μg/mL leupeptin) for 20 minutes at 4°C. Insoluble material was removed by centrifugation at 15,000 × g for 15 minutes at 4°C. The supernatant was saved and the protein concentration was determined using the Bio-Rad protein assay kit (Bio Rad, Hercules, CA, USA). An identical amount of protein (50 μg) for each lysate was subjected to 10% SDS-polyacrylamide gel electrophoresis, and then transferred to a nitrocellulose membrane. Immunoblot analysis using anti-NLRP3, pro-IL-β and β-acitin antibodies was performed with an ECL Western blotting kit (GE Healthcare, BUCKS, UK). In brief, the membrane was probed with primary antibodies and washed and incubated with donkey anti-rabbit secondary antibody conjugated with horseradish peroxidase (1:10,000 diluation; GE Healthcare). After being washed, the membrane was reacted with an ECL advance Western blot detection kit (GE Healthcare). Protein bands were visualized using a lumino-image analyzer (LAS3000; Fujifilm, Toyo, Japan).

SAA has been shown to induce the expression of various proinflammatory cytokines in inflammatory cells. First, we examined whether SAA induces IL-1β secretion from synovial fibroblasts. As shown in Figure 1, SAA is a potent inducer of pro-IL-1β mRNA expression in synovial fibroblasts. However, SAA alone did not induce the secretion of IL-1β, suggesting that SAA alone is not able to provide the signal for the proteolytic cleavage of pro-IL-1β and secretion of mature IL-1β (Figure 2A). In contrast, priming of synovial fibroblasts with SAA resulted in the induction of IL-1β secretion when these cells were subsequently stimulated with MSU (Figure 2A). Immunoblot analysis also indicated that in addition to pro-IL-1β (31 kDa), cleaved mature IL-1β (17 kDa) was also induced by MSU in SAA-primed synovial fibroblasts (Figure 2B).

We next determined whether the induction of IL-1β is a direct effect of SAA or results from contaminating LPS in the SAA preparation. LPS priming induce the IL-1β secretion following MSU stimulation from synovial fibroblasts; however, its IL-1β-inducing ability was lower compared to those of SAA-priming (Figure 3A). Given that most proteins are heat-labile, whereas LPS is heat-resistant, we examined the ability of heat-treated SAA (1 μg/ml) and LPS (500 pg/ml) to stimulate IL-1β secretion from synovial fibroblasts. As shown in Figure 3B, after heating 100°C for 30 minutes, LPS retained its ability to induced MSU-stimulated IL-1β production. In contrast, SAA exposed to 100°C for 30 minutes could not stimulate IL-1β secretion completely as described previously [19]. The endotoxin detected by limulus test was extremely high in LPS-primed synovial fibroblasts-conditioned media, whereas, endotoxin was not detected SAA-primed synovial fibroblast-conditioned media (Figure 3B). These results indicate that the trace amount of LPS in the SAA preparation cannot account for the IL-1β secretion from SAA/MSU-stimulated synovial fibroblasts.

Previous investigations demonstrated that the inflammatory caspases are cleaved and released along with active IL-1β after activation of the inflammasome [20]. Consistent with these findings, SAA/MSU stimulation activated caspase-1 in synovial fibroblasts (Figure 4A). The caspase-1 dependency for the pro-IL-1β processing was confirmed by addition of the caspase-1 inhibitor z-YVAD-fmk, which completely blocked SAA/MSU-induced IL-1β processing (Figure 4B).

The induction of NLRP3 expression is important for inflammasome activation [21]. Therefore, we examined the effects of SAA on NLRP3 expression in synovial fibroblasts. As shown in Figure 5A, a rapid increase in NLRP3 mRNA expression was observed in SAA-stimulated synovial fibroblasts. Also, we analyzed the protein expressions of pro-IL-1β and NLRP3 using the lysates of SAA-stimulated synovial fibroblasts. Immunoblot analysis revealed the protein expressions of pro-IL-1β and NLRP3 were increased by SAA stimulation (Figure 5B). To elucidate the role of NLRP3 in SAA/MSU-induced IL-1β induction, NLRP3 was silenced in synovial fibroblasts using a combination of two small interfering RNAs (siRNA). The siRNA treatments prevented SAA-induced NLRP3 mRNA expression (Figure 5C). Silencing the NLRP3 gene reduced SAA/MSU-induced IL-1β secretion, while no inhibition of IL-1β secretion was observed in synovial fibroblasts transfected with negative control siRNA (Figure 5D). Inflammasome activation has been associated with the release of cathepsin B from the cells [22, 23]. Therefore, we examined the cell-free culture media for the presence of cathepsin B. As shown in Figure 6, significant secretion of cathepsin B was observed in SAA/MSU-stimulated synovial fibroblasts, as well as SAA-primed synovial fibroblasts.

More recently, IL-1α secretion was demonstrated to be required the presence of IL-1β, in which IL-1β directly binds IL-1α as a shuttle [24]. Therefore, we examined whether SAA/MSU stimulation induces IL-1α secretion from rheumatoid synovial fibroblasts. Although neither SAA nor MSU induces IL-1α secretion, SAA priming induces the IL-1α secretion from MSU-stimulated synovial fibroblasts parallel to IL-1β secretion (Figure 7).