Significance of Aurora B overexpression in hepatocellular carcinoma. Aurora B Overexpression in HCC

During the period January 1987 through December 1997, 160 surgically resected, primary unifocal HCCs were selected for this study. After resection, tumor tissues were immediately cut into small pieces, snap frozen in liquid nitrogen, and stored in deep freezer. Patients had received comprehensive pathologic assessment and regular follow-up at National Taiwan University Hospital, as described previously [17, 18]. This study was compliant with the regulations of the Ethics Committee of the host institution. The 160 patients included 122 men and 38 women with a mean age of 57 years (range, 14-88 years). Serum hepatitis B surface antigen (HBsAg) was detected in 107 cases (67%) and antihepatitis C virus antibody in 53 (35%), including 13 positive for both. Elevated α-fetoprotein (AFP; ≥200 ng/mL) was detected in 80 cases (50%). Liver cirrhosis was found in 61 patients (38%). All patients had adequate liver function reserve at the time of surgery. None of the patients had received local or systemic therapy before surgery.

Tumor grade was divided into 3 groups: well-differentiated (grade I, 31 cases), moderately differentiated (grade II, 74 cases), and poorly differentiated (grade III-IV, 55 cases). The unifocal HCC was staged as stages I, II, IIIA, IIIB, and IV, as described previously [11, 19, 20]. Staging was based on the International Union Against Cancer criteria, with slight modification because HCC tends to spread in the liver via vascular invasion, which is an important unfavorable prognostic factor for this disease [21]. Stage I HCC included tumors that were ≤ 2 cm and showed no evidence of liver and vascular invasion (4 cases). Stage II HCCs included tumors that were ≤ 2 cm for which vascular invasion was limited to small vessels in the tumor capsule, as well as encapsulated tumors > 2 cm with no evidence of liver or vascular invasion (62 cases). Stage IIIA HCCs included invasive tumors > 2 cm with invasion of small vessels in the tumor capsule and/or satellites near the tumor, but no portal vein invasion (25 cases). Stage IIIB HCCs included tumors with invasion of the portal vein branch near the tumor, but not of the distant portal vein in the liver parenchyma (23 cases). Stage IV included tumors with involvement of major portal vein branches, satellites extending deeply into the surrounding liver, tumor rupture, or invasion of the surrounding organs (46 cases). No evidence of regional lymph node or distant metastasis was noted at the time of surgery in any of the cases. Among the 160 patients studied, 149 were eligible for the evaluation of early tumor recurrence (ETR; ≤12 months). Eleven patients who died within 1 year after surgery without objective evidence of tumor recurrence were excluded from the evaluation of ETR.

Reverse transcription-polymerase chain reaction (RT-PCR) was used to determine the mRNA levels of Aurora A and Aurora B in paired HCCs and nontumorous liver samples, as described elsewhere [11, 22]. The ribosomal protein S26 mRNA, a housekeeping gene, was used as an internal control [23]. Briefly, total RNA was isolated from the frozen tissues using a guanidium isothiocyanate/CsCl method. RNA was quantified by spectrophotometry at 260 nm. Stock RNA samples were kept in alcohol in deep freezer until used. Complementary DNA (cDNA) was prepared from the total RNA of paired HCCs and nontumorous liver samples. Two microliter reverse transcription product, 1.25 units Pro Taq polymerase (Protech Technology Enterprise, Taipei, Taiwan), Pro Taq buffer, and 200 μM dATP, dCTP, dGTP, and dTTP (each) were mixed with primer pairs for Aurora A, Aurora B, and S26 in a total volume of 30 μl. One-tube PCR reaction was stopped at the exponential phase of gene amplification: 29 cycles for Aurora A, 32 for Aurora B, and 23 for S26. The reaction was performed in an automatic DNA thermal cycler (model 480; Perkin-Elmer Co., Wellesley, MA), with limited reaction reagents (Tag enzyme and dNTPs), and processed with initial heating at 94°C for 2 minutes, followed by 29 (Aurora A) or 32 (Aurora B) PCR reaction cycles of 94°C for 30 seconds, annealing at 60°C for 1 minute, extension at 72°C for 1 minute, and a final 72°C extension for 10 minutes. The PCR reaction was stopped at cycle 7 (Aurora A) or 10 (Aurora B), and the reaction tubes were quenched on ice to allow adding S26 primers, then complete the final 23 PCR reaction cycles. Primers for amplified genes were as follows: Aurora A-F (AATTGCAGATTTTGGGTGGT), Aurora A-R (AAACTTCAGTAGCATGTTCCTGTC), Aurora B-F (ATCGTGGCGCTCAAGGTCCT), Aurora B-R (GATGCACTCTCAAAGGGTGGG), S26-F (CCGTGCCTCCAAGATGACAAAG), S26-R (GTTCGGTCCTTGCGGGCTTCAC). The PCR products were electrophoresed on a 2% agarose gel. Concentrations of the PCR fragments were determined with the IS-1000 digital imaging system (Alpha Innotech, San Leandro, CA). The Aurora A and Aurora B mRNA levels were determined according to the ratio of signal intensity for Aurora A or B to that of S26 as measured by 1 D Image Analysis software (Kodak Digital Science, Rochester, NY) and scored as high (ratio >1.0), moderate (ratio > 0.5 and ≤1.0), or low (ratio ≤0.5). The Aurora A and Aurora B mRNA levels of nontumorous liver rarely exceeded a ratio of 0.5, and a ratio > 0.5 was regarded as overexpression.

Mutations of the p53 and β-catenin genes were analyzed in 134 and 150 tumors, respectively, by direct sequencing of exon 2 to exon 11 of p53 and exon 3 of β-catenin, as described previously [17, 24, 25]. Samples with incomplete study results were excluded from statistical analysis.

Early tumor recurrence (ETR) was designated as intrahepatic tumor recurrence or distant metastasis detected by imaging tools, pathology and/or high AFP levels within 12 months. All 160 patients had been followed for more than 5 years or until death. At the end of the follow-up in November 2008, 37 patients remained alive. One hundred forty-nine cases (93%) were eligible for evaluation of ETR.

Seventy-three (46%) cases had ETR. Among the 73 patients, 11 (15%), 26 (36%), 7 (10%), 1 (1%) received tumor resection, transhepatic arterial embolization, chemotherapy, or radiotherapy, respectively. Fifty-one (32%) of the 160 cases had late tumor recurrence more than 12 months after the initial hepatectomy. Among the 51 patients, 18 (35%), 24 (47%), 4 (8%), 2 (4%) received tumor resection, transhepatic arterial embolization, chemotherapy, or radiotherapy, respectively.

The liver cancer cell lines Huh-7, HepG2, Hep3B, PLC5, HCC36, HA59T, SK-hep-1, and Tong were cultured in Dulbecco's modified Eagle's medium (DMEM) plus 10% fetal bovine serum (FBS), supplemented with penicillin and streptomycin. Cells were maintained in a humidified incubator with 5% CO₂ in air at 37°C.

AZD1152-HQPA is a selective inhibitor of Aurora B (inhibition constant Ki, 0.36 nM) compared with Aurora A (inhibition constant Ki, 1369 nM) [26]. AZD1152-HQPA, provided by AstraZeneca Pharmaceuticals (Macclesfield, UK), was used for in vitro cell line studies.

Western blotting was performed as described previously [11]. The following primary antibodies were used: anti-Aurora B (Novus Biologicals, Littleton, CO, USA), anti-Aurora A (Novus Biologicals), anti-α-tubulin antibody (Sigma-Aldrich, St. Louis, MO, USA), anti-phosphorylated histone H3 (Ser10) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), and anti-phosphorylated Aurora A (T288) (Cell Signaling Technology, Inc., Danvers, MA, USA). The final images were developed with a chemiluminescence reagent.

A total of 5 × 10⁴ Huh-7 or Hep3B cells were plated in six-well plates. After overnight culture, cells were treated with DMSO or 1, 5, 25, and 125 nM of AZD1152-HQPA. At 72 hours of drug treatment, cells were trypsinized and the total number of cells were counted using hemocytometer. Trypan blue dye exclusion assay was used to determine the number of viable cells. The experiments were carried out in 3-4 replicates and repeated trice.

Cells in logarithmical growth were incubated with either AZD1152-HQPA or DMSO for 24 to 48 hours. Cells were labeled with 0.5~1 mL propidium iodide (50 μg/mL) after being trypsinized and fixed in 70% methanol overnight. Cell cycle profiles and sub-G1 fractions were determined using a FACS caliber (Becton Dickinson, San Jose, CA, USA).

Data analyses were carried out with Statistical Analysis System software (version 9.1; SAS Institute, Inc., Cary, NC). Two-tailed P < 0.05 was considered statistically significant. The χ², Fisher's exact test, and log-rank test were used for univariate analyses. Multivariate analyses were conducted for ETR, tumor size, stage, and grade by fitting multiple logistic regression models [27]. Time to death was analyzed by fitting multiple Cox's proportional hazards models [28]. In our regression analyses, basic model-fitting techniques for (a) variable selection, (b) goodness-of-fit assessment, and (c) regression diagnostics (including residual analysis, influence analysis, and check of multicollinearity) were used to ensure the quality of the analysis results [27, 28].

Using RT-PCR in the linear range, Aurora B mRNA overexpression was detected in 98 (61%) of 160 surgically resceted, primary unifocal HCC specimens (Fig. 1A). Of these 160 HCCs, RNA samples of nontumorous liver were examined in 153 cases. In nontumorous liver, overexpression of Aurora B mRNA at a moderate level was detected in 2 cases (1.3%). We then examined Aurora B gene expression in cell lines, and all 7 liver cancer cell lines showed high expression levels of Aurora B mRNA, which correlated with protein levels (Fig. 1B).

To elucidate the biologic significance of Aurora B in HCC, we correlated Aurora B expression with major clinicopathologic features of HCC. As shown in Table 1, Aurora B overexpression was associated with high serum AFP level (≥200 ng/mL; P < 0.0001), but not with age, gender, chronic hepatitis B/C virus infection, or liver functional reserve (Child-Pugh class).

Histologically, Aurora B overexpression did not correlate with the presence of liver cirrhosis. Nevertheless, HCCs with Aurora B overexpression were associated with large tumor size (> 5 cm; P = 0.021), high-grade histology (P = 0.0007), and advanced tumor stage (P < 0.0001).

Genes for p53, β-catenin, and Aurora A are most frequently deregulated in HCC and are closely associated with HCC progression [7, 11]. Therefore, relations between Aurora B overexpression with mutations of p53 and β-catenin and with Aurora A overexpression were analyzed. Table 1 shows that Aurora B overexpression was correlated with Aurora A overexpression (P = 0.0003) and p53 mutation (P = 0.002). In contrast, Aurora B was more frequently overexpressed in HCCs without β-catenin mutation (P = 0.002).

HCC with Aurora B overexpression were associated with worse 5-year survival than HCC without Aurora B overexpression (P < 0.0001; Table 1 and Fig. 2A). Moreover, HCC with Aurora B overexpression showed more frequent ETR (P < 0.0001; Table 1), the most crucial clinical event associated with poor prognosis of HCC after hepatectomy [6, 19]. As listed in Table 2, multivariate analysis showed that Aurora B overexpression (odds ratio [OR], 4.679; P = 0.0011], tumor size (OR, 3.735; P = 0.0031), tumor stage (OR, 3.611; P = 0.0073), and age ≤55 years (OR, 1.043; P = 0.0245) were significant independent risk factors by Cox's proportional hazards model for the occurrence of ETR. A conditional effect plot of age and Aurora B overexpression on ETR was drawn based on the multiple logistic regression model with fixed tumor size and stage (Fig. 2B). The probability of ETR was significantly higher in patients with HCC showing Aurora B overexpression. Furthermore, ETR (OR, 29.181; P < 0.0001), tumor grade (OR, 1.516; P = 0.0041), and tumor size (OR, 1.072; P = 0.0048) were significant independent risk factors associated with poor patient survival (Table 2). Principally, we found that Aurora B overexpression was an independent risk factor associated with high-stage tumor (OR, 7.439; P = 0.0003; Table 2) and ETR (OR, 4.679; P = 0.0011), hence contributing to poor patient survival. Nevertheless, Aurora B overexpression did not exert prognostic effects for tumor size or tumor grade (Table 2).

Because both Aurora A and Aurora B correlate closely with unfavorable prognosis of HCC and may be potential therapeutic targets [11, 12], we analyzed the possible interplay between these two important biomarkers. In this study, Aurora A overexpression, which was found in 100 (63%) of 160 HCCs examined, significantly correlated with Aurora B overexpression (P = 0.0003; Table 1). Moreover, as shown in Table 3, HCC with overexpression of both Aurora A and Aurora B showed the highest occurrence of high serum AFP level (≥200 ng/mL; 71%), large tumor size (> 5 cm; 72%), grade II to IV tumor (94%), stage IIIA to IV tumor (82%), p53 mutation (64%), wild-type β-catenin (92%), and the worst 5-year survival rate (19%) than the other groups.

Because Aurora B overexpression was correlated with Aurora A overexpression (P = 0.0003), p53 mutation (P = 0.002), and infrequent β-catenin mutation (P = 0.002) in this study (Table 1), we then analyzed the prognostic value of Aurora B overexpression for patient survival in relation to Aurora A overexpression and p53/β-catenin mutations. We showed that HCC with Aurora B overexpression was associated with worse 5-year survival regardless of Aurora A expression status (P = 0.013 for HCC without Aurora A overexpression and P = 0.001 for HCC with Aurora A overexpression; Fig. 3A), p53 mutation (P = 0.016 in wild-type p53 HCC and P = 0.123 in p53-mutated HCC; Fig. 3B), and β-catenin mutation (P = 0.329 in β-catenin-mutated HCC and P < 0.001 in wild-type β-catenin HCC; Fig. 3C).

The association of Aurora B overexpression and tumor invasiveness of HCC prompted us to explore the effects of Aurora B kinase inhibition on HCC cell viability. Huh-7 and Hep3B cells were treated with increasing concentrations of an Aurora B selective small-molecule inhibitor, AZD1152-HQPA, for 72 hours. Concentration-dependent inhibitory effects of cell viability were observed in both cell lines (Fig. 4A). The ratios of viable Huh-7 and Hep3B cells consistently decreased with higher concentrations of AZD1152-HQPA. The 50% inhibitory concentrations of cell viability (IC₅₀) at 72-hr were 16.72 ± 2.44 nM and 4.79 ± 1.03 nM for Huh-7 and Hep3B, respectively (Fig. 4A). Aurora A autophosphorylation at T288 [29] and histone H3 phosphorylation at Ser10 [12] represent the activity of Aurora A and Aurora B, respectively. As shown in Fig. 4B, AZD1152-HQPA induced dephosphorylation of histone H3 (Ser10) in a concentration-dependent manner, while the phosphorylation level of Aurora A (T288) did not change. The data suggest that AZD1152-HQPA exerts its anticancer effects in HCC cells through the inhibition of Aurora B.

Because Aurora kinase inhibitors have been shown to induce cell death after the cell cycle has been disturbed [10]. We therefore investigated the effects of AZD1152-HQPA on HCC cell cycle progression and apoptosis. As shown in Fig. 5A, AZD1152-HQPA treatment resulted in accumulation of Hep3B cells with 4N DNA contents at 24-h, followed by the appearance of cells with 8N DNA contents at 48-h. Our data demonstrated that AZD1152-HQPA induced cell cycle disturbance in a concentration-dependent manner (Fig. 5A). We also examined the ability of AZD1152-HQPA to induce apoptosis in HCC cells. As shown in Fig. 5B, AZD 1152-HQPA induced concentration-dependent apoptosis in both Huh-7 and Hep3B cells. After 48 hours of treatment with AZD1152-HQPA above 25 nM, the sub-G1 fractions of Huh-7 cells and Hep3B cells significantly increased (P < 0.01). In Fig. 5B, AZD1152-HQPA induced apoptosis more efficiently in Hep3B cells, which is in accordance with the antiproliferative effects.