Background
Gliomas are the most common primary tumors in the central nervous system in adults, with an estimated annual incidence of 6.6 per 100,000 individuals in the USA [
1]. Glioblastoma is the most malignant type of glioma and leads to poor survival despite of aggressive therapy including surgery, radiotherapy and chemotherapy [
2‐
5]. The 2016 WHO classification of tumors of the central nervous system proposed the priority of integrated histological and molecular classification system in brain tumor diagnosis, which enables more precise patient stratification [
1]. It is indicated that glioblastoma patients with different recurrence-free survival (RFS) time exhibited different expression pattern of mRNAs and miRNAs [
6]. Considering the heterogeneity within and among glioma patients, more insights into the oncogenes of glioma are still an urgent need.
Spindle and kinetochore associated complex (SKA complex) is required for timely anaphase onset. This family is composed of three proteins: SKA1, SKA2 and SKA3, which facilitates the processive movement of microspheres along with depolymerizing microtubules. Individually, SKA1 complex mostly performed two crucial biochemical functions: direct microtubule binding through its C-terminal domain, and microtubule-stimulated oligomerization [
7,
8]. Inhibition of the SKA complex results in a chromosome congression failure followed by cell death [
9‐
12]. The role of SKA1 in the malignant progression of several cancers has already been discussed recently [
13‐
16]. In vitro experiments revealed that SKA1 may be a potential therapeutic target of human glioblastoma [
17], but the underlying mechanisms remains to be elucidated.
Here, we confirmed that expressions of SKA1 increased along with advances in glioma grades. Knockdown of SKA1 could potently inhibit proliferation, migration and invasion both in vitro and in vivo. We further clarified that SKA1 was involved in Wnt/β-catenin signaling pathway and could be a potential biomarker of malignant phenotype in glioma.
Methods
Cell culture
The human glioma cell lines U251, U87, LN229 and T98 were purchased from the Chinese Academy of Sciences (Shanghai, China). In the laboratory, all cell lines were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Hyclone, Logan, UT) supplemented with 10% fetal bovine serum (FBS, Hyclone, Logan, UT) and incubated in a humidified atmosphere of 5% CO2 at 37 °C.
Clinical tissue sample collection
Tumor tissues were collected from patients with pathologically and clinically confirmed glioma. All samples were confirmed by pathological diagnosis and classified according to the World Health Organization (WHO) criteria. Moreover, prior written informed consents were obtained from patients or their guardians, and approval from the Ethics Committees of Nanfang Hospital of Guangdong Province were also obtained.
Establishment of stably transfected cells
The preparation of lentivirus expressing human SKA short hairpin RNA (sh#1, CCGGTGAAGAACCTGAACCCGTAAACTCGAGTTTACGGGTTCAGGTTCTTCATTTTTTG; sh#2, CCGGATAGAGTATAGAGGCTATTTCCTCGAGGAAATAGCCTCTATACTCTATTTTTTTG; sh#3, CCGGCCTGACACAAAGCTCCTAAATCTCGAGATTTAGGAGCTTTGTGTCAGGTTTTTG) were performed using the pLVTHM-GFP lentiviral RNAi expression system (Genechem, China). U87, U251, LN229 and T98 cells were then transfected with lentiviral particles containing specific or negative-control (shNC) vectors according to the manufacturer’s instructions, respectively.
Western blot analysis
The cells or tumor tissues were washed three times with PBS and lysed in RIPA Buffer (50 mM Tris–HCl pH 8.0, 1 mM EDTA pH 8.0, 5 mM DTT, 2% SDS) with protease inhibitor and phosphoric-acid protease inhibitor at 4 °C for 30 min. Then they were crushed with ultrasonic machine and centrifuged at 12000 rpm for 15 min at 4 °C. The protein concentration was measured using BCA assay (Beyotime Inc, China). 12.5 μl mixed solution including 30 mg protein and 2.5 μl SDS was resolved using a 10% SDS-PAGE gel and electro-transferred to polyvinylidene fluoride membranes (Invitrogen, Carlsbad, CA). Afterwards, the membranes were blocked with 5% BSA or nonfat milk in pH 7.0 TBST, and then were incubated with primary antibodies overnight at 4 °C. On the next day, membranes were washed three times with TBST and incubated with horseradish peroxidase conjugated secondary antibody for 1 h at room temperature. At last, membranes were washed three times with TBST again. Signals were detected using enhanced chemiluminescence reagents (Pierce, Rockford, IL, USA). All experiments were independently performed in triplicate.
CCK8 assay
The CCK8 assay was performed to examine cell viability. Glioma cells (1000/well) were seeded in 96-well plates with a volume of 200 μl medium. Subsequently, 10 μl of CCK8 reagent mixed with 100 μl DMEM medium without FBS were added to each well and incubated for 1 h. Then the absorbance value (OD) was measured at 450 nm. The observation duration lasted for one week at the same time every day.
The indicated cells were plated in 12-well plates (200 cells per well) and cultured for 2 weeks. The colonies were then fixed with methanol for 30 min and stained with 1% crystal violet for 1 min. All assays were independently performed in triplicate.
EdU incorporation assay
The proliferation of U87 and U251 cells were examined using the Cell-Light EdU Apollo488 In Vitro Imaging Kit (RiboBio, China) according to the manufacturer’s protocol. In brief, cells were incubated with 10 μM EdU for 2 h before fixation with 4% paraformaldehyde and permeabilization with 0.5% Triton X-100, and then stained with EdU kit. Cell nucleus were stained with 5 μg/ml DAPI (4′,6-diamidino-2 phenylindole) for 10 min. The number of EdU-positive cells was counted under a microscope in five random fields (200×). All assays were independently performed in triplicate.
Cell migration and invasion assay
The cell migration assays were carried out with Transwell assays. About 5 × 104 cells in 100 μl DMEM medium without FBS were seeded on a fibronectin-coated polycarbonate membrane inserted in a Transwell apparatus (Costar, MA). In the lower chamber, 500 μl DMEM with 10% FBS was added as a chemoattractant. After the cells were incubated for an appropriate time according to specific cell lines in a 5% CO2 atmosphere at 37 °C, the insert was washed with PBS, and cells on the top surface of the insert were removed with a cotton swab. Cells adhering to the lower surface were fixed with methanol for 30 min, stained with 1% crystal violet solution for 1 min and counted under a microscope in three random fields. The cell invasion assays were carried out with Boyden assays, and the procedure was similar to the cell migration assay, except for that polycarbonate membranes were precoated with 24 mg/ml Matrigel (R&D Systems, USA). All assays were independently performed in triplicate.
Wound healing assay
U87 and U251 cells were stably transfected with shSKA1 or empty vectors respectively, and then cultured in 6-well plates. After the cells grew to 90% confluence, three paralleled scratch wounds across each well were made with a P-10 pipette tip. Fresh medium supplemented with reduced FBS (5%) was added, and the wound-closing procedure was observed for 48 h. Photographs were taken at 0, 12 h, 24 h and 48 h, respectively. All assays were independently performed in triplicate.
Xenograft tumor model
About 1 × 106 active U87 cells that transfected with shRNA or empty vectors and suspended in 0.1 ml DMEM medium were subcutaneously injected into a group of ten nude mice, respectively. These mice were grown in a barrier facility on HEPA-filtered racks. The animals were fed with an autoclaved laboratory rodent diet and water. All animal studies were conducted in accordance with the principles and procedures outlined in the National Institutes of Health Guide for the Care and Use of Animals under assurance number A3873-1. On day 30, the mice were sacrificed, and tumor tissues were excised and weighed, respectively.
Immunohistochemistry
Paraffin sections at 4 μm were deparaffinized in 100% xylene and rehydrated in descending ethanol series according to standard protocol. Heat-induced antigen retrieval was performed in citrate buffer for 15 min in microwave oven. Endogenous peroxidase activity and non-specific antigens were blocked with peroxidase blocking reagent containing 3% hydrogen peroxide and serum. The sections were then incubated with primary antibodies, including N-cadherin (1:100; CST, USA), E-cadherin (1:100; Proteintech, USA), MMP9 (1:100; Proteintech, USA), and PCNA (1:100; Abcam, USA), at 4 °C overnight. The next day, the sections were washed three times with PBS. The sections were followed by incubation with biotin-labeled secondary antibody for 1 h at room temperature and washed three times with PBS. Subsequently, Sections were visualized with DAB and counterstained with hematoxylin, mounted in neutral gum, and analyzed with a bright field microscope equipped with a digital camera (Nikon, Japan). The results were scored as previously mentioned: 0, no staining; 1, weak staining in < 50% cells; 2, weak staining in ≥ 50% cells; 3, strong staining in < 50% cells; and 4, strong staining in ≥ 50% cells [
18]. All experiments were independently performed in triplicate.
Statistical analysis
All quantified data is presented as an average of triplicate technical replicates. SPSS 13.0 and Graph Pad Prism 4.0 software were used for statistical analysis. Data are represented as mean ± SD. One-way ANOVA or two-tailed Student’s t-test was used for comparisons between groups. Chi square test or Fischer’s were used to identify differences between categorical variables. Survival analysis was performed using Kaplan–Meier method. Multivariate Cox proportional hazards method was used for analyzing the relationship between the variables and patient’s survival status. Differences were considered statistically significant when P < 0.05.
Discussion
In the present study, we identified SKA1 as a potential biomarker of malignant phenotype for glioma and confirmed that SKA1 expression increased along with advances of glioma grades. Based on these findings, we further investigated the biological functions of SKA1 in glioma and figured out that it could significantly promote glioma cells proliferation, migration and invasion abilities. With Western blot, we suggested that SKA1 may facilitate cell growth by regulation of cell cycle phase transition, contrary to that reported previously [
17]. Finally, we demonstrated that SKA1 may also be involved in the regulation of EMT and Wnt/β-catenin signaling pathways.
Though SKA1 is firstly identified as a regulator of timely anaphase onset [
9], recent oncology researches revealed that SKA1 may be a crucial regulator for tumorigenesis and multidrug-resistance in several tumors. Inhibition of SKA1 led to cell cycle arrest and apoptosis in a number of tumors including hepatocellular carcinoma, non-small cell lung carcinoma and gastric cancer [
10,
15,
16]. SKA1 is also reported to be involved in chemo-resistance and contributes to cisplatin resistance in non-small cell lung carcinoma cells by protecting tumor cells from cisplatin-induced cell apoptosis [
19]. Nevertheless, knockdown of SKA1 could sensitize tumor cells to tyrosine kinase inhibitor and epirubicin [
13,
20].
Though precise regulatory network of SKA1 remains to be elucidated, several researches proposed that SKA1 could inhibit the activity of Akt and Erk pathway [
21,
22]. Our manuscript reported the first evidence that SKA1 may also be involved in Wnt/β-catenin signaling pathway. Wnt/β-catenin signaling pathways is considered to be a fundamental growth control pathway, and its dysregulation is frequently observed in a variety of cancers, leading to a defined cellular response through the activation of β-catenin/TCF target genes [
23]. It has been suggested that relative change rather than absolute change of β-catenin levels is crucial, indicating that even low levels of nuclear β-catenin are sufficed for target gene activation [
24]. Since Wnt/β-catenin signaling pathway is involved in stemness and proliferative potential in several cancers [
25‐
28], further work is needed to unravel potential involvement of SKA1 in glioma stemness.
Conclusions
In conclusion, SKA1 expression increased along with advances of glioma grades, and SKA1 is a potential biomarker of poor prognosis for glioma. Particularly, SKA1 promotes proliferation, migration and invasion abilities in glioma cells. Furthermore, it is demonstrated that knockdown of SKA1 led to cell-cycle arrest and MET in glioma. Finally, we suggested that SKA1 could be a potential regulator of Wnt/β-catenin signaling pathway. Considering these results, SKA1 could a promising therapeutic target for the treatment of human glioma.
Acknowledgements
This study was supported by National Nature Science Fund of China (No. 81872064), Outstanding Youths Development Scheme of Nanfang Hospital, Southern Medical University (No. 2016J008), Natural Science Fund of Tibet Autonomous Region, China (No. XZ2017ZR-ZYZ27) and Startup Fund for Scientific Research of Fujian Medical University (No. 2018QH1186)The funders had no role in study design, data collection, data analysis, decision to publish, or preparation of the manuscript.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.