Background
Osteosarcoma is the most common histological form of primary bone tumors in children and adolescents which originates from the malignant transformation of mesenchymal cells with high mortality [
1]. It often occurs during the differentiation of osteoid tissue and immature osteoblast. Doxorubicin (Dox) is one of the most commonly used chemotherapeutic drugs for osteosarcoma [
2]. However, the intrinsic weakness of DOX severely limits its clinical efficacy: low-dose usage could not only reduce its effectiveness but also lead to drug resistance, while dose increasement would cause severe cardiotoxicity [
3]. Therefore, the overall survival rate of osteosarcoma patients is only 5 to 20% which is not satisfactory [
4]. It is now generally recognized that the cancer stem cells (CSCs) could be a major cause of chemo-resistance and tumor recurrence [
5]. Therefore, developing the combination regimen with potential complementary mechanisms, especially targeting CSCs, may be a promising avenue of drug toxicity reduction and efficacy improvement.Epigallocatechin gallate (EGCG) is the highest content of catechin in green tea with many physiological and pharmacological activities. It was found that EGCG could promote the sensitivity of traditional anticancer drugs [
3,
6,
7] and reverse multidrug resistance [
8]. Similarly, EGCG was reported to exert significant inhibitory effect on osteosarcoma cells including induce apoptosis, inhibit the proliferation and invasion of osteosarcoma cells [
9‐
11].
Long non-coding RNAs have been reported to play important roles in tumor progression. Human SOX2 over lapping transcript (SOX2OT) gene can generate 8 lncRNA transcript variants (variant 1–8) which are functionally assumed to be correlated with cellular differentiation and carcinogenesis [
12]. These variants show diverse expression profiles in different cell or tissue types [
12]. It is worth mentioning that the SOX2OT harbors pluripotency regulator SOX2 and could positively regulate SOX2 expression [
13,
14]. But so far, the expression and function of lncRNA SOX2OT variants in osteosarcoma is still unclear.
Our preliminary experiment surprised to find that the combination of EGCG and Dox could produce synergistic effect on osteosarcoma cell growth inhibition. Moreover, EGCG treatment resulted in LncRNA SOX2OT variant7 downregulation in a concentration-dependent manner. Based on above descreption, this study investigated the underlying molecular mechanisms of the synergistic effect between Dox and EGCG targeting SOX2OT variant 7 and found that EGCG could decrease the Dox treatement-induced pro-survival autophagy partly through inhibiting SOX2OT variant 7 to improve the growth inhibition of Dox on osteosarcoma cells. On the other hand, EGCG could inactivate Notch3/DLL3 signaling targeting SOX2OT variant 7 to reduce the stemness of OS cells and then abated drug-resistance of osteosarcoma cells.
Methods
Tumor cell culture and tumor sphere-forming culture
The SaoS2 and U2OS osteosarcoma cell lines were purchased from the Cell Culture Center, Shanghai Institutes for Biological Sciences, the Chinese Academy of Sciences (Shanghai, People’s Republic of China). The cells were maintained in DMEM supplemented with 10% FBS, 25 mM hydroxyethyl piperazine ethanesulfonic acid buffer, 100 U/mL penicillin, and 100 μg/mL streptomycin in ahumidifed atmosphere of 5% carbon dioxide at 37 °C.
In order to form osteosarcoma spheres, 5 × 103 cells /well suspended OS cells were cultured in low-adhesive six-well plates in serum-free DMEM-F12 (1:1) medium supplemented with 20 ng/ml fibroblast growth factor (FGF; R&D systems), 20 ng/ml epidermal growth factor (EGF; R&D systems), B27 (1:50) (Invitrogen), N2 (1:100) (R&D systems), and 10 ng/ml LIF (Millipore) for 10 days (that is sphere-forming culture medium). In addition, fresh DMEM-F12 (1:1) medium, EGF, and bFGF were added every other day. A single-cell suspension derived from primary spheres was obtained for the secondary sphere formation with the same method.
Patients and tissue samples
10 pairs of OS tissue samples and their relative adjacent tissues were collected from the second Xiangya hospital from Dec, 2015 to March, 2016. Unfortunately, RNA degradation was found in 4 pairs of tissues which could not be used in subsequent experiments. Use of these samples for all experiments was approved by the Ethics Committee of the 2nd Xiangya Hospital of Central South University.
Expression of SOX2OT variants in OS tissues and SOX2OT-V7 overexpressed lentivirus generation
SOX2OT transcript variants were amplified separately using RT-PCR according to previous literature reports. U-87 MG cell line was used as positive control [
13,
15,
16]. The SOX2OT V7 sequence was synthesized by BGI (Beijing, China). The synthetic V7 DNA fragment and lentiviral vector PGMLV-6395 were enzyme digested with BamH I/EcoRI,Ligation was performed to construct V7 overexpressed lentivirus recombinant plasmid. The following lentivirus package was performed by Auragene biotech (Changsha, China).
MTT assay
Cells were plated at a density of 5000 per well of a 96-well plate, 24 hafter plating, cells were treated as the indicated concentrations. 20 ml MTT with a concentration of 5 mg/mlwas added to each well for an additional 4 hours. The blue MTT formazan precipitate was then dissolved in 150 μL of dimethyl sulfoxide per well with incubation for 10 min in a rotary platform at 37 °C. Cell proliferation inhibition ratio was calculated according to the absorbance at a wavelength of 570 nm (A value) in each well by ELISA analyzer (MK3, Themo, USA). Cell proliferation inhibition ratio (%) = (A value of control group–A value of treated group)/A value of control group× 100%.
Analysis of in vitro drug interaction
According to previous study [
3], MTT assay was used to detect the absorbance at the wavelength of 570 nm as the OD value. The coefficient of drug interaction (CDI) was calculated as follows: CDI = AB/(A × B). According to the absorbance of each group, AB is the ratio of the combination groups to control group; A or B is the ratio of the single agent group to control group. Thus, CDI value< 1, = 1 or > 1 indicates that the drugs are synergistic, additive or antagonistic, respectively.
Quantitative RT-PCR
Total RNA was extracted from cells using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions, and then the RNA was reverse transcribed using the PrimeScript RT Master Mix Perfect Real Time kit (TaKaRa, Dalian, China) to obtain the cDNA. Using the cDNA as the template, real-time PCR assay was performed using the pairs of primers listed in Table
1. The 20 μL real-time PCR reaction included 0.5 μL of cDNA template, 0.25 μL of Forward/Reverse primers respectively, 10 μL of RNase-free dH
2O, and 8 μL of 2.5× Real Master Mix (SYBR Green I). The reaction conditions included a pre-denaturation step at 94 °C for 10 s, and 40 cycles of 94 °C for 15 s and 58 °C for 60 s. After the reaction, the data were subjected to statistical analysis.
Table 1
Primer sequence list
Atg5 | Sense | TAAGTTTGGCTTTGGTTG |
Antisense | TTCCCTTTCAGTTATCTCAT |
Atg7 | Sense | ATGCCTGGGCATCCAGTGAACTTC |
Antisense | CATCATTGCAGAAGTAGCAGCCA |
Beclin 1 | Sense | TGTGGAATGGAATGAAATCAA |
Antisense | CCCCCAGAACAGTACAACGGC |
SOX2OT-V7 | Sense | TCTGTTCAGTATTTGGAAGAAAG |
Antisense | GCTTGGACCCGCGTG |
SOX-2 | Sense | CCCTGTGGTTACCTTTTCCT |
Antisense | AGTGCTGGGACATGTGAAG |
Oct-4 | Sense | TTCAGCCAAACGACCATCT |
Antisense | GCTTTGCATATCTCCTGAAGA |
CD44 | Sense | GGAGCAGCACTTCAGGAGGTTAC |
Antisense | GGAATGTGTCTTGGTCTCTGGTAGC |
Nanog | Sense | CTCTCCTCTTCCTTCCTCCAT |
Antisense | TTGCGACACTCTTCTCTGC |
Notch1 | Sense | CCCGCCAGAGTGGACAGGTCAGTA |
Antisense | TGTCGCAGTTGGAGCCCTCGTTA |
Notch2 | Sense | CCCACAATGGACAGGACA |
Antisense | GAGGCGAAGGCACAATCA |
Notch3 | Sense | TCTCAGACTGGTCCGAATCCAC |
Antisense | CCAAGATCTAAGAACTGACGAGCG |
Jagged1 | Sense | GACACCGTTCAACCTGACAGTATTA |
Antisense | GTCACAGGCATAGTGTCCAAAGA |
Jagged2 | Sense | TCGGGCAGGAACTGTGAGAAGGC |
Antisense | AATCACAGTAATAGCCGCCAATCAGGT |
DLL1 | Sense | AGGGGTGGAGAAGCATCTGAAA |
Antisense | AACCTGCTCGGTCTGAACTCG |
DLL3 | Sense | ACGCCTGGCCTGGCACCTT |
Antisense | CCCTCTAGGCATCGGCATTCACC |
DLL4 | Sense | ACAGTGAAAAGCCAGAGTGTCGG |
Antisense | TGAGCAGGGATGTCCAGGTAGG |
Hes1 | Sense | CAGAAAGTCATCAAAGCCTATT |
Antisense | TTCAGAGCATCCAAAATCAG |
Hey1 | Sense | AGAGGAATAATTGAGAAGCG |
Antisense | CAAACTCCGATAGTCCATAG |
β-actin | Sense | AGGGGCCGGACTCGTCATACT |
Antisense | GGCGGCACCACCATGTACCCT |
Western blot
Cells were lysed in cell lysate, and then centrifuged at 12,000×g for 20 min at 4 °C. The supernatant was collected and denatured. Proteins were separated in 10% SDS-PAGE and blotted onto polyvinylidene difluoride membrane (PVDF). The PVDF membrane was treated with TBST containing 50 g/L skimmed milk at room temperature for 4 h, followed by incubation with the primary antibodies against the LC3B (1:3000, ab51520, Abcam), Atg5 (1:1000, ab108327, Abcam), Atg7 (1:100,000, ab524721,Abcam), Beclin1 (1 μg/ml, ab62557, Abcam), P62 (1:500, 18,470–1-AP, Proteintech, China), OCT-4 (1:1000, Proteintech), ABCG2 (1:50, ab24115, Abcam), c-Myc (1:10,000, ab32072, Abcam), Sox2 (1 μg/ml, ab97959, Abcam) and anti-β-actin (1:1000, Cell signaling) respectively, at 37 °C for 1 h. Membranes were rinsed and incubated for 1 h with the correspondent peroxidase-conjugated secondary antibodies. Chemiluminescent detection was performed with the ECL kit (Pierce Chemical, Rockford, IL, USA). The amount of the protein of interest, expressed as arbitrary densitometric units, was normalized to the densitometric units of ß-actin.
Purifcation of CD133+/CD44+ cancer stem cells
CD133/CD44 immunomagnetic double screening were improved and performed according to the methods reported in previous literature [
17]. A single-cell suspension of Saos-2 and U2OS cells was incubated with magnetic microbeads-conjugated with the mouse anti-human CD133 monoclonal antibody (Miltenyi Biotec, USA) for 30 min. After washing, the CD133+ cells were separated using the magnetic cell sorting system (autoMACS; Miltenyi Biotec, USA). The purified CD133+ cells were expanded for 14 days by culturing and then harvested as a single-cell suspension to be incubated with magnetic microbeads-conjugated mouse anti-human CD44 monoclonal antibody (Miltenyi Biotec, USA) for 30 min. After washing, the CD44+ cells were separated using the magnetic cell sorting system as described above. This two-step isolation enabled us to obtain sufficient number of CD133+/CD44+ CSCs for the following experiment.
To verify the purity of the isolated CD133+/CD44+ CSCs, cells were stained according to the supplied antibody protocols. Mouse anti-Human CD133/1 (Clone: AC133)-PE and mouse anti-human CD44 (Clone: DB105)-FITC (Miltenyi Biotec, USA) were used. Then flow cytometry analysis was performed using a FACSCalibur instrument (Becton Dickinson).
Self-renewal capacity assay
To evaluate the colony-forming ability of different cells, self-renewal capacity assay was performed. We seeded OS cells or CSCs into 96-well plates at a density of 1 × 103 cells / well using sphere-forming culture medium with TGF-beta (20 ng/ml) and the formation of colonies was quantifed at 14 days after inoculation. Colonies with over 50 cells were counted under an Olympus microscope.
Autophagy detection
In this study, autophagy levels were detected using immunofluorescence staining and MDC staining beside autophagy marker detection. Cells were cultured on cover glasses coated with 0.1% gelatin in PBS in 6-well tissue culture plates with DMEM. The cells were incubated overnight then washed with PBS, and fixed in 4% paraformaldehyde for 15 min. They were then permeabilized in 0.2% Triton X-100 for 10 min prior to blocking in 6% bovine serum albumin (BSA) for 30 min. For immunofluorescence staining, the cells were incubated overnight with anti-LC3B (1:200, 12741S, Cell Signaling, USA) at 4 °C, followed by incubation with goat anti-rabbit IgG (H + L)-Cy3 (1:200, SA012, Auragene) for 1 h at room temperature in dark. Nuclei were counterstained with DAPI (10 μg/ml, C0065, Solarbio, China). Finally, cells were analyzed using a confocal fluorescence microscope (BX50; Olympus, Japan) and the percentage of cells with LC3 puncta was calculated by taking advantage of Image-Pro Plus 6.0. When autophagic vacuoles were labeled with monodansylcadaverine (MDC), cells were incubated with 0.05 mM MDC in RPMI1640 at 37 °C for 10 min. After incubation, cells were washed three times with PBS and immediately analyzed with a fluorescence microscopeequipped with a filter system (V-2A excitation filter:380/420 nm, barrier filter:450 nm). Images were captured and imported into Adobe Photoshop.
Animal treatments
Animal experiments were performed in strict accordance with the Guide for the Care and Use of Laboratory Animals of the second Xiangya hospital of Central South University. The protocol was approved by the Committee on the Ethics of Animal Experiments of the second Xiangya hospital of Central South University. NOD/SCID mice at age of 3–5 weeks, male, were maintained in pathogen-free conditions at animal facility. The OSCs with or without SOX2OT V7 overexpression were resuspended in serum-free medium and mixed with Matrigel at the ratio of 1:1. NOD/SCID mice were randomly divided into 4 groups (n = 3 per group). 1 × 105 indicated cells were inoculated subcutaneously into the inguinal folds of NOD/SCID mice. 7 days after inoculation, tumor formation was evaluated by palpation of injection sites., thenthe mice that developed palpable tumors were intraperitoneally injected EGCG (30 mg.kg-1) in combination with or without Notch-3 knockdown lentivirus (Lv-Notch3-) at the injection site every 3 days for 3 times. At the end of experiment (21 days), the mice were sacrificed under deep anesthesia with pentobarbital. The tumors were then dissected and captured.
Statistical analysis
Results from at least three independent experiments were expressed as mean ± SD. Statistical analysis of data from two groups was compared by two-tail t-test. Data from multiple groups wasperformed by one-way ANOVA, followed by Tukey post test. Statistical significance was determined as P < 0.05.
Disscussion
Osteosarcoma is the most common primary malignant bone tumor. One of the most active drugs for OS treatment is doxorubicin which is invariably included in OS chemotherapy protocols. Several studies have shown that high grade osteosarcoma patients may be inherently resistant to doxorubicin or become un-responsive to this drug during chemotherapy [
25]. So, it is urgent to explore the combination regimen with complementary molecular mechanisms to reduce the side effects and enhance sensitivity of Doxorubicin. EGCG is a polyphenol in green tea with antitumor bioactivity which has been reported to show potential synergism with chemotherapy drugs in a few tumor types [
6,
7]. Particularly, EGCG was found to have synergistic interaction with doxorubicin to kill the hepatoma Hep3B cells. Therefore, we hypothesized that EGCG and DOX also have synergistic inhibitory effects on osteosarcoma. Through the implementation of MTT experiment in which EGCG and DOX were used alone or in combination, the coefficient of drug interaction (CDI) was calculated and basically proved that they had synergistic effect on inhibiting the growth of osteosarcoma. The unknown molecular mechanism is another focus of this study.
DOX treatment could induce pro- survival autophagy in cells [
26‐
28]. At the same time, EGCG promoted the growth inhibition effect of antitumor drugs through autophagy regulation via activation of pro-apoptosis or pro-survival autophagy in cancer cells [
3,
29,
30]. Based on the synergistic effect of EGCG and DOX on osteosarcoma growth inhibition, in second part of this study, it was confirmed that EGCG inhibited DOX induced pro-survival autophagy which would be one of the important molecular mechanism of synergistic effect of EGCG and DOX on osteosarcoma. by detecting the expression of autophagy markers and immunofluorescence of LC3.
However, clarification of the targets of EGCG in this process was what attracts us to continue to explore. Our team was conducting exploratory functional studies of a series of LncRNAs in OS and fortunately, we found suspected targets of EGCG among them.
SOX2 overlapping transcript (SOX2OT) is a conserved lncRNA which encompasses sex determining region Y-box2 (SOX2) in the same strand [
31]. SOX2OT have 8 transcript variants which expressions specifically in different human cancer cell lines [
12]. In order to clarify differential expression of SOX2OT-spliced variants in OS tissue samples, 10 pairs of OS tissue samples and their relative adjacent tissues were collected from the second Xiangya hospital from Dec, 2015 to March, 2016. Unfortunately, RNA degradation was found in 4 pairs of tissues which could not be used in subsequent experiments. Since the expressions of variant 1, 4, 6, 7, 8 in tumor tissues are relatively common, and glioma cell line U87 could be used as a positive control of variant expression, we used RT-PCR method to detect variants in OS tissues. According to the results, SOX2OT variants 1, 4, 7 were found expressed in OS tissues. However, whether variant 1, 4, 7 are all meaningful for osteosarcoma tumorigenesis is still unknown. Next, we confirmed the expression of variants 1, 4, 7 in the corresponding tumor tissues and their adjacent tissues again and found that only SOX2OT variant 7 showed obvious over-expression in tumor tissues compared with their adjacent tissues while neither V 4 nor V 1 showed obvious tendency of expression in tumor or adjacent tissues. Based on the above, we locked SOX2OT V7 as the main object of our study in OS although it was not enough to arrive at convincing and statistically significant conclusions because only 6 pairs of OS tissue samples were tested. Fortunately, we found that V7 seems to be one of the important targets in the study of EGCG inhibiting autophagy induced by DOX and then the follow-up experiments basically confirmed EGCG inhibited DOX-induced autophagy by targeting SOX2OT V7 partially.
Cancer stem cells are considered to be closely related to drug resistance of tumors because of enhanced expression of ABC transporter proteins and activated autophagy [
32,
33]. In view of the inhibition of the SOX2OT V7 expression in osteosarcoma cells of EGCG and the close relationship between SOX2OT and CSC pluripotent regulator SOX2, we put forward the hypothesis that EGCG could inhibit OSCs which would be another mechanism contributes to the Synergistic Interaction with Doxorubicin to osteosarcoma. EGCG could inhibit many kinds of cancer stem cells. But whether EGCG has an inhibitory effect on osteosarcoma stem cells has not been studied yet [
34‐
36]. Through subsequent experiments, we have confirmed that EGCG can partially inhibit the self-renewal ability of OSC by targeting SOX2OT V7, and significantly enhance the inhibitory effect of DOX on OSC growth.
EGCG targeting lncRNA SOX2OT V7 inhibits pro-survival autophagy induced by chemotherapeutic drugs (such as DOX), thereby enhancing the chemosensitivity of osteosarcoma cells; At the same time, EGCG targeting SOX2OT V7 decreases stemness of osteosarcoma stem cells (including drug resistance, tumorigenic ability, self-renewal ability, etc.). Notch signaling pathway is an evolutionarily conserved signaling pathway that controls the fate of cells and maintenance of stemness [
37]. EGCG could inhibit Notch signaling pathway [
22‐
24,
38], Especially, it was found that Notch signaling pathway inactivation can effectively reduce cisplatin induced osteosarcoma stem cells production and reduce the resistance of osteosarcoma cells [
39], which suggested that Notch signaling pathway play a role in OS drug resistance and stemness. In our research, by detecting downstream target genes of Notch signaling (Hes1 and Hey1), it was proved that V7 overexpression could further activated Notch signaling and EGCG treatment could inhibit the Notch signaling pathway in OSCs. To further understand the factors involved in this process, Notch receptors Notch1/2/3 and ligands such as Jagged1/2, Dll1/3/4 were invested by qRT-PCR. The results showed that in one hand there were no obvious expression alterations of Notch1 in OSCs derived from both U2OS and SaoS2 and of Notch 2 in OSCs derived from SaoS2 with or without V7 overexpression; in the other hand, Notch ligands Jagged 1, DLL1 and DLL4 showed no obvious expression alterations in OSCs derived from both U2OS and SaoS2 with V7 overexpression, besides, the expressions of Jagged2 were even not significantly changed in any groups including in OSCs compared with parental group. According to the results of this study, in all ligands and receptors of the Notch signaling, only Notch 3 and DLL 3 met the expectations of this research. So, we conclude the OSC inhibitory effect of EGCG targeting SOX2OT V7 is partly achieved by restrain of Notch3 / DLL3 signaling.