Background
Cancer of the corpus uteri (commonly called endometrial cancer) is one of the most common malignancies of the reproductive system. In the United States, approximately 52,630 new cases will be diagnosed in 2014 and 8590 deaths are expected [
1]. Therefore, it is critical to better understand the molecular mechanisms of endometrial cancer.
Cancer stem cells (CSCs) are defined by their ability to seed new tumors and are proposed to be the cancer-initiating cells responsible for carcinogenesis [
2,
3]. To date, CSCs have been isolated from various human cancer tissues [
4,
5]. Emerging evidence indicates that a population of CSCs may be involved in endometrial carcinoma carcinogenesis [
6,
7]. The epithelial-mesenchymal transition (EMT) is a well-described process whereby epithelial cells lose their polarity and cell-cell contacts, undergoing a dramatic remodeling of the cytoskeleton and acquiring a migratory phenotype. Recent studies have highlighted a link between EMT and the induction of the stem cell-like properties of cancer cells in solid tumors [
8‐
10].
The Piwil1 gene is a member of the Piwi gene family, which represent the first class of evolutionarily conserved genes known to be required for stem cell self-renewal and division [
11,
12]. Piwil1 has been found to be frequently overexpressed in various tumor types, including gastric cancer, breast cancer and endometrial cancer [
13,
14]. Previous studies have demonstrated that Piwil1 played a key role in enhancing tumor malignant behavior including proliferation [
13,
15] and invasion [
16], as well as the potential importance of Piwil1 expression as a marker of poor prognosis in soft-tissue sarcoma and ductal adenocarcinoma of the pancreas [
17,
18].
On the basis of these findings, we believe that both or partly of Piwil1 and EMT are involved in the acquisition of stem-like properties, with the hope that such associations might provide insights into the causal function of Piwil1 in endometrial carcinogenesis.
Methods
Ethics statement
The study was approved by the Human Investigation Ethics Committee of Shanghai First People’s Hospital Affiliated to Shanghai Jiao Tong University. The samples of endometrial carcinoma and normal endometrial tissues were collected after written informed consent from the patients. Animal research was carried out in strict accordance with the Guide for the Care and Use of Laboratory Animals. The procedures were approved by the Department of Laboratory Animal Science at Shanghai Jiao Tong University School of Medicine. All efforts were made to minimize suffering.
Tissue specimens
Tissue samples for immunohistochemistry and real-time quantity PCR (RT-qPCR) were obtained at Shanghai First People’s Hospital Affiliated to Shanghai Jiao Tong University from 2011 to 2013. The stages and histological grades of these tumors were established according to the criteria of the Federation International of Gynecology and Obstetrics (FIGO) surgical staging system (2009) [
19]. None of the patients underwent hormone therapy, radiotherapy, or chemotherapy prior to surgery.
Cell culture
Human endometrial cancer cell lines including Ishikawa and HEC-1B were obtained from the Chinese Academy of Sciences Committee Type Culture Collection (Shanghai, China, Additional file
3). According to the provider’s instructions, cells were cultured at 37 °C in a humidified atmosphere containing 5 % CO
2 in Dulbecco’s modified Eagle’s medium (DMEM)/F12 (Gibco, Life Technologies, Auckland, New Zealand) supplemented with 10 % fetal bovine serum (Gibco, Carlsbad, CA, USA).
Ishikawa cell line is a human endometrial adenocarcinoma cell line which contains estrogen and progesterone receptors [
20]. HEC-1B cell line is a human endometrial adenocarcinoma cell line which has a low baseline level of estrogen and progesterone receptors [
21].
Immunohistochemistry
Tissue immunohistochemistry was performed by the 3,3'-diaminobenzidine (DAB) method with a heat-induced antigen retrieval step. Briefly, slides were incubated with rabbit polyclonal anti-Piwil1 (1:100, ab105393, Abcam), rabbit monoclonal anti-E-cadherin (1:400, #3195, CST), rabbit monoclonal anti- Vimentin (1:100, #5741, CST), rabbit monoclonal anti-CD44 (1:100, ab51037, Abcam), rabbit monoclonal anti-ALDH1 (1:100, ab52492, Abcam), rabbit monoclonal anti-ki67 (1:100, ab16667, Abcam) and rabbit monoclonal anti-PCNA (1:100, ab92552, Abcam) overnight at 4 °C and then incubated with horseradish peroxidase (HRP)-linked anti-rabbit or anti-mouse secondary antibody (Boster) at room temperature for 30 min followed by chromagen detection with DAB (Boster) and hematoxylin (Boster) counterstaining. Isotype control antibodies was used as negative control.
Two independent pathologists, who were blinded to the clinical and pathological data, evaluated the specimens. Sections were evaluated according to semi quantitative immunoreactivity scores. We separately scored for the percentage of positive staining (0 = negative, 1 = 25 %, 2 = 25–50 %, 3 = 50–75 % and 4 = 75 %) and the staining intensity (0 = none, 1 = weak, 2 = moderate, and 3 = strong). For each specimen, the summation of the two above gave the final score.
Total RNA extraction and real-time RT-PCR
Total RNA was extracted from tissues and cell lines using Trizol (Invitrogen) and cDNA was prepared using the reverse transcriptase kit (TaKaRa) according to the manufacturer’s instructions. The cDNA was analyzed by real-time PCR using SYBR Premix Ex Taq (TaKaRa) in an Eppendorf Mastercycler realplex. A housekeeping gene, GAPDH, was used as an internal control. Data was calculated using the 2
-△△Ct formula. Primers sequences are shown in Additional file
1: Table S1.
Western blotting
Cells were lysed in lysis buffer (Beyotime) for 30 min at 4 °C. Total proteins were fractionated by SDS–PAGE and transferred onto PVDF membranes (Millipore). The membranes were then incubated with primary antibodies against Piwil1 (1:1000, ab105393, Abcam), E-cadherin (1:1000, #3195, CST), N-cadherin (1:1000, #13116, CST), Vimentin (1:1000, #5741, CST), CD44 (1:5000, ab51037, Abcam), CD133 (1:1000, 18470-1-AP, ProteinTech) and ALDH1 (1:1000, ab52492, Abcam) at 4 °C overnight, followed by incubation with peroxidase-linked secondary antibody (1:10000, 112-005-003, Jackson ImmunoResearch). The probed proteins were detected by enhanced chemiluminescent reagents (Thermo). GAPDH (1:2000, #5174, CST) was used as an internal control.
Immunofluorescence
Cells were cultured on glass coverslips for 24 h and then fixed in 4 % paraformaldehyde. They were permeabilized with 0.1 % Triton X-100. After blocking in 5 % bovine serum albumin for 1 h at room temperature, cells were incubated with primary antibodies as follows: Piwil1 (1:50, ab105393, Abcam), E-cadherin (1:200, #3195, CST), Vimentin (1:100, #5741, CST), CD44 (1:100, ab51037, Abcam), CD133 (1:100, 18470-1-AP, ProteinTech) and ALDH1 (1:1000, ab52492, Abcam) overnight at 4 °C. Next, cells were incubated with Alexa Fluor 647 or rhodamine (TRITC)-conjugated secondary antibodies (1:200, Jackson ImmunoResearch) for 1 h. Nuclei were visualized by counterstaining with 496-diamidino-2-phenylindole (DAPI). Samples were analyzed using a Leica TCS SP8 confocal microscope (Leica Microsystems). Isotype control antibodies was used as negative control.
Stable transfection
HEC-1B cells were transfected with Piwil1 expression plasmids (exPiwil1, Genepharma, Shanghai, China) or control plasmids (pEGFP-N1, empty vector, EV, Genepharma) by LipofectamineTM 2000 (Invitrogen) according to the manufacturer’s protocol. Stable overexpression clones (HEC-1BexPiwil1 and HEC-1BEV cells) were selected in the presence of 1 mg/ml G418 (Gibco) and then propagated in the presence of 0.5 mg/ml G418.
Ishikawa cells were transfected with shRNA against Piwil1 (shPiwil1, Genepharma) (sense: 5’-AGTCAGCAACCTGGTTATA-3’; antisense: 5’- TATAACCAGGTTGCTGACTGG -3’) or shRNA against nontarget (NT, Genepharma) by Lipofectamine™ 2000. Stable knockdown clones (IshikawaEV and IshikawashPiwil1 cells) were selected in the presence of 0.5 μg/ml puromycin (Sigma; St. Louis, MO, USA) and maintained with 0.3 μg/ml. Transfection efficiency was confirmed by RT-qPCR and western blot.
Cells and transfected cells (3 × 103 cells/well) were plated in 96-well plates. Then, 20 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT, 5 mg/ml; Sigma) was added to each well and then incubated at 37 °C for 4 h. Absorbance values were then measured at 490 nm using a microplate reader (Bio-Red). For colony formation assay, 200 cells/well were seeded into 6-well plates. When clearly identifiable cell clones had formed, the colonies were fixed with methanol and stained with 0.5 % crystal violet. All experiments were repeated at least three times.
Cell migration and invasion assays
Cell lines were suspended in serum-free medium and plated at a density of 1 × 105 cells/well (for the migration assay) or 2 × 105 cells/well (for the invasion assay) in 6.5 mm transwell chambers equipped with 8.0 μm pore-size polycarbonate membranes without or with matrigel coating (BD Biosciences). Complete medium (600 μl) was added to the lower chamber. After incubation for 24 h (migration assay) or 48 h (invasion assay), cells were fixed in 4 % paraformaldehyde and stained with crystal violet. Then cells that migrated to the basal side of the membrane were counted at 200× magnification. The migration and invasion assays were repeated at least three times.
Cells (5 × 103) were plated on non-adherent 6-well culture plates (coated with a 10 % polyHEMA (Sigma) for 4 h and dried for 3 days at 37 °C). After plating, cells were incubated in a serum-free medium consisting of DMEM/F12 supplemented with 20 ng/ml of EGF, 10 ng/ml of bFGF, and 2 % B27 (all from Sigma and Gibco). The number of spheroids per well was counted after 5 days under light microscopy at a 200-fold magnification. The experiments were repeated at least three times.
Nude mouse tumor xenograft assay
Athymic female nude mice (BALB/c, 4 to 6 week old, n = 5 per group) were obtained from Shanghai Life Science Institute (Slac Laboratory Animal Co., Ltd, Shanghai, China). IshikawashPiwil1 or IshikawaNT cells were injected subcutaneously into the flank of each mouse at a density of 1 × 107 cells to establish a mouse model bearing endometrial cancer. The growth of tumors was monitored throughout the experiment and tumor size was measured with calipers every 4 days and the tumor volume was calculated as (Rmax) × (R2 min)/2. Four weeks after injection, mice were euthanized, tumors were removed carefully, and the weight and volume of tumors were measured.
Statistical analysis
All data analyses were performed using the software package SPSS v. 18 (SPSS Inc., Chicago, IL, USA). Values were expressed as mean ± the standard deviation and analyzed with the Student’s t-test or Mann–Whitney U test. Significant differences were indicated for P values < 0.05.
Discussion
One hypothesis related to carcinogenesis assumes that a specific population of tumor cells, CSCs, have the ability to initiate and maintain tumor growth [
25]. A increasing body of evidence suggest that CSCs may originate not only from somatic stem cells (SSCs) where tumor suppressor genes could be silenced, but also from differentiated cells in which a self-renewal signaling pathway is activated [
2].
Piwi, the other subclade of the Argonaute family, affected asymmetric division of stem cells in the Drosophila germline [
26]. The early studies demonstrated that Piwi is essential for gametogenesis and is a key regulator of female germline stem cells [
11,
12]. Four Piwi proteins are expressed in humans: Piwil1/Hiwi, Piwil2/Hili, Piwil3, and Piwil4/Hiwi2. Most studies showed that Piwi proteins are overexpressed in human cancers [
26]. The expression of Piwil1, Piwil2, Piwil13, and Piwil4 were positively correlated with T stage, lymph node metastasis and clinical TNM and patients with higher expression had shorter survival time [
27,
28]. In this study, we confirmed that the expression of Piwi proteins (Piwil1, Piwil2, Piwil13, and Piwil4) are different in endometrial cancer cell lines (Additional file
4) and we mainly focused on the role of Piwil1 in endometrial cancer.
It has been long recognized that the piwil1 is essential for stem cell self-renewal, division, spermatogenesis, RNA silencing, and translational regulation in
Drosophila, mice and many other species [
11,
29‐
31]. Piwil1 is also detected in human CD34
+ cells but not in well-differentiated cells, suggesting it may determine or regulate human stem cell development [
32]. However, reports focusing on effect of Piwil1 in tumor biology are limited, and the correlation between Piwil1 and endometrial cancer progression is not well documented. Here, we showed that Piwil1 was highly expressed in human endometrial cancer. Specific knockdown or overexpression of Piwil1 in endometrial cancer cell lines led to changes in tumor growth and metastatic potential in vitro and in vivo. Our results suggest that Piwil1 may be a part of the molecular pathway necessary for activating the cell’s capacity for self-renewal in endometrial cancer.
Although several studies have investigated the expression of Piwil1 in solid cancers, including endometrial cancer, this is the first study to address the function of Piwil1 in human endometrial cancer. We found that the normal endometrium produces weak levels of Piwil1, but that Piwil1 was extensively detected in endometrial cancer, which is in accordance with reports [
14,
33]. Previous studies demonstrate that high levels of Piwil1 expression could increase the risk for tumor-related death [
17,
18] and may be a poor prognostic factor for esophageal squamous cell carcinoma, gastric cancer and hepatocellular carcinoma [
16,
27,
34]. Consistently, we found a significantly positive correlation between Piwil1 expression and lymphovascular space involvement, lymph node metastasis, varying depth of myometrial invasion and advanced disease stage, all of which are associated with high risk factors in endometrial cancer. Though these results are not sufficient to definitively designate Piwil1 as a prognostic factor for endometrial cancer, our expression data combined with our functional data suggest that Piwil1 might serve as a target for anticancer therapy.
To date, CSC markers of endometrial cancer have been identified, including CD133, CD44 and ALDH1 [
7,
22,
35,
36]. Interestingly, we found that overexpression of Piwil1 could lead to increased acquisition of CD44 and ALDH1 and cells with knockdown of Piwil1 showed decreased expression levels of these markers. Besides expressing specific markers, CSCs are defined by their self-renewal capacity, their ability to generate a new tumor and an increased capacity for migration and invasion. In our study, we showed that the ability of proliferation, migration, invasion and sphere-forming in Ishikawa cells was decreased by Piwil1 knockdown. Conversely, HEC-1B cells overexpressing Piwil1 showed increased ability of proliferation, migration, invasion and sphere-forming. From our in vivo experiments, we discovered that the Piwil1 knockdown significantly inhibited the establishment of tumors. Therefore, we for the first time reported that Piwil1 may regulate stemness of endometrial cancer cells. Ishikawa cell line could be a useful model to study endometrial CSCs because it has a higher percentage of CD133
+ cells and ability to undergo differentiation into other lineages [
7]. However, CD133 showed no substantial difference between transfected cells and control cells. These findings raise the possibility that there are additional candidate genes that regulated CD133.
During the process of tumor metastasis, preceded by the EMT [
37], metastasized cancer cells appear to require an ability to self-renew, similar to that seen in stem cells, to acquire a proliferative potential. In the present study, we presented several lines of evidence showing that Piwil1 was involved in EMT. We observed that Piwil1 could downregulate epithelial marker E-cadherin and upregulate mesenchymal markers Vimentin and N-cadherin in endometrial cancer cells. Snail plays a critical role in EMT [
23]. Knock down of Snail could reverse EMT and significantly attenuated migration, invasion and cancer stem cell-like properties of cancer cells [
38]. We further showed that Piwil1 could upregulate the transcription of Snail, indicating that Piwil1 may be required for Snail-induced EMT. However, further studies are required to identify the detailed mechanism involved in regulation of Piwil1 on Snail.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
ZC, QC, and XH carried out the design of the experiments, performed most of experiments, and drafted the manuscript. FW and HW participated in the molecular biology experiments and statistical analysis. MZ made the figures. JS and XW was involved in financial support, the design of the experiments, data analysis, and final approval of the manuscript. All authors read and approved the final manuscript.