Skip to main content
Erschienen in: Malaria Journal 1/2018

Open Access 01.12.2018 | Methodology

Streamlined, PCR-based testing for pfhrp2- and pfhrp3-negative Plasmodium falciparum

verfasst von: Jonathan B. Parr, Olivia Anderson, Jonathan J. Juliano, Steven R. Meshnick

Erschienen in: Malaria Journal | Ausgabe 1/2018

Abstract

Background

Rapid diagnostic tests (RDTs) that detect histidine-rich protein 2 (PfHRP2) are used throughout Africa for the diagnosis of Plasmodium falciparum malaria. However, recent reports indicate that parasites lacking the pfhrp2 and/or histidine-rich protein 3 (pfhrp3) genes, which produce antigens detected by these RDTs, are common in select regions of South America, Asia, and Africa. Proving the absence of a gene is challenging, and multiple PCR assays targeting these genes have been described. A detailed characterization and comparison of published assays is needed to facilitate robust and streamlined testing approaches.

Results

Among six pfhrp2 and pfhrp3 PCR assays tested, the lower limit of detection ranged from 0.01 pg/µL to 0.1 ng/µL of P. falciparum 3D7 strain DNA, or approximately 0.4–4000 parasite genomes/µL. By lowering the elongation temperature to 60 °C, a tenfold improvement in the limit of detection and/or darker bands for all exon 1 targets and for the first-round reaction of a single exon 2 target was achieved. Additionally, assays targeting exon 1 of either gene yielded spurious amplification of the paralogous gene. Using these data, an optimized testing algorithm for the detection of pfhrp2- and pfhrp3-negative P. falciparum is proposed.

Conclusions

Surveillance of pfhrp2- and pfhrp3-negative P. falciparum requires careful laboratory workflows. PCR-based testing methods coupled with microscopy and/or antigen testing serve as useful tools to support policy development. Standardized approaches to the detection of pfhrp2- and pfhrp3-negative P. falciparum should inform efforts to define the impact of these parasites.
Begleitmaterial
Additional file 1: Figure S1. Pfhrp2 assay performance using serially diluted P. falciparum 3D7 strain DNA. Elongation temperatures were varied as listed below. All other reaction conditions are specified in Table 1. Figure S2. Pfhrp3 assay performance using serially diluted P. falciparum 3D7 strain DNA. Elongation temperatures were varied as listed below. All other reaction conditions are specified in Table 1. Figure S3. Representative agarose gel electrophoresis depicting unexpected spurious bands from Dd2 strain (pfhrp2-deleted) control DNA. PCR targeting pfhrp2 exon 1/2 (assay 1 outer) yielded a spurious ~ 300 bp band from serial dilutions of pfhrp2-deleted Dd2 strain control DNA at all three elongation temperatures. Figure S4. Representative agarose gel electrophoresis depicting unexpected spurious bands from HB3 strain (pfhrp3-deleted) control DNA. PCR targeting pfhrp3 exon 1/2 (assay 5) yielded spurious bands at ~ 300, 400, and 800 bp from serial dilutions of Dd2 strain control DNA using optimized elongation temperatures (Table 1). Figure S5. Pfhrp3 assay performance using serially diluted P. falciparum 3D7 strain DNA. Elongation temperatures were varied as listed below. All other reaction conditions are specified in Table 1. The sequence of pfhrp2 exon 1/2 (assay 1) PCR product aligns to pfhrp3, due to spurious PCR amplification of the Dd2 pfhrp3 gene. PCR was performed using 0.01 ng/μL of 3D7 (pfhrp2-positive) and Dd2 (pfhrp2-negative) control DNA, respectively (see Additional file 1: Figure S3), followed by Sanger sequencing of amplicons. Reference sequences from the consensus 3D7 (v3.0) genome for pfhrp2 and pfhrp3 are displayed on the top two rows (REF), from 5′→ 3′, with capital letters for coding regions and genetic coordinates in reference to the pfhrp2 gene. Identical bases are indicated by a period (.), missing bases by a dash (-), substitutions by the discordant base. PCR product sequence contigs are highlighted as follows: 3D7 control DNA (light gray); Dd2 control DNA (dark gray). Figure S6. The sequences of pfhrp3 exon 1/2 (assay 5) PCR product align to pfhrp2, due to spurious PCR amplification of the HB3 pfhrp2 gene. PCR was performed using 0.01 ng/μL of 3D7 (pfhrp3-positive) and HB3 (pfhrp3-negative) control DNA, respectively (see Additional file 1: Figure S4), followed by Sanger sequencing of amplicons. Reference sequences from the consensus 3D7 (v3.0) genome for pfhrp2 and pfhrp3 are displayed on the top two rows (REF), from 5′→ 3′, with capital letters for coding regions and genetic coordinates in reference to the pfhrp3 gene. Identical bases are indicated by a period (.), missing bases by a dash (-), substitutions by the discordant base. PCR product sequence contigs are highlighted as follows: 3D7 control DNA (medium gray) and HB3 control DNA 300 bp fragment (light gray), 400 bp fragment (medium gray), and 800 bp fragment (dark gray)
Hinweise

Electronic supplementary material

The online version of this article (https://​doi.​org/​10.​1186/​s12936-018-2287-4) contains supplementary material, which is available to authorized users.
Jonathan B. Parr and Olivia Anderson are co-first authors

Background

Diagnostic testing is a core component of recent malaria control efforts. In Africa, where the majority of deaths due to malaria occur, rapid diagnostic tests (RDTs) are the most commonly employed malaria diagnostic strategy, accounting for 74% of diagnostic testing among suspected malaria cases [1]. The most commonly used RDTs in Africa rely upon detection of PfHRP2, a Plasmodium falciparum-specific antigen expressed by the histidine-rich protein 2 (pfhrp2) gene. However, recent reports from select locations in South America, Asia, and Africa of P. falciparum parasites lacking pfhrp2 and/or the histidine-rich protein 3 (pfhrp3) gene, which produces an antigen that cross reacts with some PfHRP2-based RDTs, raise concerns about the effectiveness of PfHRP2-based RDTs in affected regions [218]. In response, the World Health Organization (WHO) has prioritized efforts to address parasites with deletions of the pfhrp2 and/or pfhrp3 (pfhrp2/3) genes [19, 20].
The methods required to identify and confirm pfhrp2/3 gene deletions are challenging, due to the difficulty of proving the absence of a gene. While PCR assays that target pfhrp2/3 are expected to yield negative results when applied to parasites lacking the gene(s), PCR failure can occur for other reasons. Testing of parasites with intact pfhrp2/3 genes may yield false-negative results due to DNA concentrations below the assay’s limit of detection, poor quality DNA, variable reagent performance, or other factors.
Cheng et al. published useful guidelines to standardize the reporting of pfhrp2/3 gene deletions [21]. However, the specific methods employed for the detection and confirmation of deletions continue to vary between laboratories, and recent evidence suggests that atypical elongation temperatures may improve amplification of AT-rich regions of both genes [14, 22]. This manuscript seeks to address these issues by comparing the performance of published PCR assays for pfhrp2 and pfhrp3, exploring the impact of reduced elongation temperatures on assay sensitivity, assessing assay specificity, and describing a streamlined testing algorithm.

Methods

The performance characteristics of six published PCR assays, including four designed to amplify pfhrp2 and two designed for pfhrp3, were compared [3, 5, 9, 23]. After determining the optimal annealing temperatures for each assay, we assessed their lower limits of detection (LOD) using DNA extracted from cultured P. falciparum 3D7 strain parasites. DNA was quantified using the Qubit 2.0 instrument with dsDNA high sensitivity reagents (ThermoFisher Scientific, Waltham, MA) and serially diluted in nuclease-free water to achieve concentrations ranging from 10−1 to 10−7 ng/µL (seven tenfold dilutions). For each dilution, the assay was performed in triplicate, using different elongation temperatures of 60, 65, and 72 °C. PCR assays were performed on Mastercycler thermocyclers (model AG 22331; Eppendorf, Hamburg, Germany) using 25 µL reaction volumes containing 12.5 µL HotStarTaq Master Mix (Qiagen, Venlo Netherlands), 200–400 nM primers synthesized by Eurofins Genomics (Louisville, KY) with salt-free purification, nuclease-free water, and 3 µL of DNA template (Table 1). For nested reactions, first-round product was diluted 100-fold in nuclease-free water prior to second-round amplification. PCR products were visualized using electrophoresis with 1% agarose gels in TBE buffer (Tris/Borate/EDTA). Finally, LOD testing was repeated using optimized reaction conditions and serial dilutions of 3D7 DNA from a separate stock.
Table 1
Published pfhrp2/3 primer sequences, limits of detection, and optimized conditions
Assay #
Target
Primer sequences (5′→3′)
Reaction conditions
Cycling parameters
LOD,* ng/µL (genomes/µL)
Ref
1
pfhrp2 (exon 1/2)
Outer:
 For: GGTTTCCTTCTCAAAAAATAAAG
 Rev: TCTACATGTGCTTGAGTTTCG
Optional—inner:
 For: GTATTATCCGCTGCCGTTTTTGCC
 Rev: CTACACAAGTTATTATTAAATGCGGAA
200 nM each primer
HotStarTaq MM (Qiagen, Venlo, Netherlands)
3 μL template DNA or 100 × diluted first-round product
25 μL reaction vol
95 °C × 15 min; 40 cycles of 94 °C × 1 min, 50 °C × 1 min for outer primers or 55 °C × 1 min for inner primers, 60 °C × 1 min; 60 °C × 10 min
10−5 (~ 0.4)
[3]
2
pfhrp2 (exons 1/2)
For: TATCCGCTGCCGTTTTTGCC
Rev: AGCATGATGGGCATCATCCTA
400 nM each primer HotStarTaq MM
3 μL template DNA
25 μL reaction vol
95 °C × 15 min; 40 cycles of 94 ° × 1 min, 57 °C x 1 min, 60 °C × 1 min; 60 °C × 10 min
10−1 (~ 4000)
[9]
3
pfhrp2 (exon 2)
For: ATTCCGCATTTAATAATAACTTGTGTAGC
Rev: ATGGCGTAGGCAATGTGTGG
400 nM each primer
HotStarTaq MM
3 μL template DNA
25 μL reaction vol
95 °C × 15 min;
40 cycles of 94 °C × 1 min, 59 °C × 1 min, 72 °C × 1 min;
72 °C × 10 min
10−4 (~ 4)
[5]
4
pfhrp2 (exon 2)
Outer:
 For: CAAAAGGACTTAATTTAAATAAGAG
 Rev: AATAAATTTAATGGCGTAGGCA
Optional—inner (hemi-nested):
 For: ATTATTACACGAAACTCAAGCAC
 Rev: AATAAATTTAATGGCGTAGGCA
400 nM each primer
HotStarTaq MM
3 μL template DNA or 100× diluted first-round product
25 μL reaction vol
95 °C × 15 min;
40 cycles of 94 °C × 1 min, 57 °C × 1 min for outer primers or 62 °C for inner primers, 60 °C × 1 min;
60 °C × 10 min
10−4 (~ 4)
[23]
5
pfhrp3 (exons 1/2)
For: TATCCGCTGCCGTTTTTGCTTCC
Rev: TGCATGATGGGCATCACCTG
400 nM primers
HotStarTaq MM
3 μL template DNA
25 μL reaction vol
95 °C × 15 min;
40 cycles of 94 °C × 1 min, 60 °C × 1 min, 60 °C × 1 min;
60 °C × 10 min
10−4 (~ 4)
[9]
6
pfhrp3 (exon 2)
Outer:
For: AATGCAAAAGGACTTAATTC
Rev: TGGTGTAAGTGATGCGTAGT
Optional—inner (hemi-nested):
 For: AAATAAGAGATTATTACACGAAAG
 Rev: TGGTGTAAGTGATGCGTAGT
400 nM primers
HotStarTaq MM
3 μL template DNA or 100 × diluted first-round product
25 μL reaction vol
95 °C × 15 min;
40 cycles of 94 °C × 1 min, 55 °C × 1 min, 60 °C × 1 min;
60 °C × 10 min
10−4 (~ 4)
[23]
7
pfldh (initial qPCR)
For: ACGATTTGGCTGGAGCAGAT
Rev: TCTCTATTCCATTCTTTGTCACTCTTTC
Probe: FAM-GTAATAGTAACAGCTGGATTTACCAAGGCCCCA-TAMRA
200 nM primers
100 nM probe
Probe Master qPCR Mix (Roche Diagnostics, Indianapolis, IN)
2 μL template DNA
12 μL reaction vol
50 °C × 2 min;
95 °C × 10 min;
40 cycles of 95 °C × 15 s, 60 °C × 1 min
10−4 (~ 4)
[31]
8
Pf -tubulin (confirmatory)
For: AATAAATCATAATGATGTGCGCAAGTGATCC
Rev: AATAAATCATAATCCTTTGTGGACATTCTTCCTC
300 nM primers
FastStart Universal SYBR Green MM (Roche Diagnostics)
3 µL template DNA
25 µL reaction volume
50 °C × 2 min;
95 °C × 10 min;
40 cycles of 95 °C × 15 s, 60 °C × 1 min;
Dissociation analysis
10−3 (~ 40)
[32, 33]
LOD lower limit of detection; MM master mix; Vol volume; Bp base pair
* Typical LOD under the conditions of this laboratory. Assay performance varied between runs, but consistently achieved LODs within one log10 of the listed LOD
The specificity of the best performing assays, including those with targets spanning exon 1 and 2 (exon 1/2) and exon 2 alone, was then evaluated. Assays were performed using control DNA from P. falciparum Dd2 (MRA-150G) and HB3 (MRA-155G) strain parasites, which lack pfhrp2 and pfhrp3, respectively. Control DNA was obtained from the Malaria Research and Reference Reagent Resource Center ([MR4], BEI Resources, Manassas, Virginia) and diluted to a concentration of 0.1 ng/µL after initial quantification using Qubit as above. For assays that yielded an unexpected result using optimized reaction conditions (i.e. bands from a pfhrp2 assay performed using pfhrp2-deleted Dd2 DNA or bands from a pfhrp3 assays performed using pfhrp3-deleted HB3 DNA), amplicons were sequenced using Sanger sequencing at Eton Bioscience (Research Triangle Park, NC), and assays were repeated at the other elongation temperatures (60, 65, and/or 72 °C). For PCR products with multiple bands appreciated by gel electrophoresis, individual bands were excised, and DNA was extracted using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) before sequencing. Gel extraction was performed according to the manufacturer’s instructions, with the exception of the final DNA elution step, in which we performed two separate elutions using 30 µL aliquots of Buffer EB through the column, followed by a final elution step using the combined 60 µL initial eluate to maximize DNA yield. Raw sequence reads were processed using Sequencher 5.4 (Gene Codes Corporation, Ann Arbor, MI), trimming bidirectional sequences based on confidence values and visual inspection of the chromatograms. We used EMBOSS Water for pairwise nucleotide alignments to the 3D7 (v3.0) pfhrp2 and pfhrp3 reference sequences. Sequence identification was based on sequence homology and alignment score, using default settings (DNAfull matrix, gap open penalty 10, gap extend penalty 0.5) [24].

Results

Assay performance

Reduced elongation temperatures improved the sensitivity of five of the six assays (Additional file 1: Figures S1, S2). An elongation temperature of 60 °C reduced the LOD by tenfold and/or produced darker bands for all exon 1/2 targets and for the first-round reaction of a single exon 2 target (assay 4). Using optimized elongation temperatures and under our lab conditions, the LOD of published PCR assays for pfhrp2 and pfhrp3 varied, with lower limits ranging from approximately 0.01 pg/µL to 0.1 ng/µL of 3D7 DNA, or approximately 0.4–4000 parasite genomes/µL (Table 1). Additionally, while adding a second round of amplification in the best performing nested PCR for pfhrp2 exon 1/2 (assay 1) resulted in darker bands, the assay’s LOD was unchanged.

Amplification of paralogous genes by exon 1/2 assays

Unexpectedly, paralogous amplification by assays targeting exon 1/2 but not exon 2 of both genes was observed. Bands were visualized from assays targeting exon 1/2 of pfhrp2 (assay 1) using Dd2 (pfhrp2-deleted) control DNA (Additional file 1: Figure S3) and those targeting exon 1/2 of pfhrp3 (assay 5) using HB3 (pfhrp3-deleted) control DNA (Additional file 1: Figure S4), respectively. Assay 1 produced unexpected bands at all three extension temperatures tested, while assay 5 produced bands when tested using 60 and 65 °C extension temperatures but not at 72 °C. All tested exon 2 assays for both genes (assay 3, 4, and 6) produced negative results using Dd2 or HB3 DNA, as expected. Pfhrp2 exon 1/2 assay 2 was not tested due to its poor performance during initial LOD testing, presumably a result of a single base insertion near the 3′ end of the reverse primer compared to the 3D7 reference sequence. The sequence homology of pfhrp2 and pfhrp3 exon 1/2 primer binding sites (Fig. 1) suggested that amplification of paralogous genes had occurred—i.e., the amplicons generated by the pfhrp2 exon 1/2 assay using Dd2 strain control DNA represented pfhrp3 amplification and that those generated by the pfhrp3 exon 1/2 assay using HB3 strain control DNA represented pfhrp2 amplification.
Sequencing results confirmed amplification of pfhrp3 by the pfhrp2 exon 1/2 assay, and vice versa. With Dd2 strain (pfhrp2-deleted) template, the pfhrp2 exon 1/2 assay (assay 1) unexpectedly produced a single band with a fragment length of approximately 300 bp. The amplicon’s sequence aligned to the pfhrp3 gene with 92% sequence homology (Additional file 1: Figure S5). With HB3 strain (pfhrp3-deleted) template, the pfhrp3 exon 1/2 assay (assay 5) unexpectedly produced two clear bands with fragment lengths of approximately 300 and 800 bp and a faint band at approximately 400 bp. Sequences generated using DNA extracted from each band aligned to the pfhrp2 gene, with 98, 99, and 97% sequence homology for the 300, 400, and 800 bp fragments, respectively (Additional file 1: Figure S6). However, when applied to 3D7 strain (pfhrp2/3-positive) control template, both exon 1/2 assays produced the expected result: a single band with a sequence that aligned to pfhrp2 with 96% homology or pfhrp3 with 99% sequence homology (for assays 1 and 5, respectively).

Streamlined testing algorithm

These findings were used to develop a streamlined, PCR-based testing pipeline for pfhrp2/3-negative P. falciparum (Fig. 2) that incorporates optimized elongation temperatures, LOD testing results, and assay specificity.

Discussion

By lowering the LOD and employing assays that distinguish pfhrp2 from pfhrp3, this testing algorithm provides an improved approach to PCR-based detection of pfhrp2/3-negative P. falciparum. Importantly, PCR-based approaches for identification of pfhrp2- and pfhrp3-negative parasites must be coupled with verification of P. falciparum parasitaemia and confirmation that parasite DNA is present at concentrations above the LODs of the pfhrp2 and pfhrp3 assays. These goals were achieved by employing assays targeting two P. falciparum-specific, single-copy genes, lactate dehydrogenase (pfldh) and P. falciparum beta tubulin (PfBtubulin), as the initial and final steps of the testing pipeline.
Lowering the elongation temperature improved the LOD of all published assays with exon 1/2 targets on either gene. This finding likely represents improved amplicon extension across the AT-rich intron between the exons as suggested by previous reports [22]. Unexpected amplification of paralogous gene targets by the pfhrp2 and pfhrp3 exon 1/2 assays was observed, presumably due to sequence homology at the primer binding sites. In regions where co-existing pfhrp2 and pfhrp3 deletions are common, the impact of non-specific amplification is expected to be reduced [2527]. Additionally, the absence of paralogous amplification of 3D7 control DNA suggests that the availability of abundant, completely homologous primer binding sites early in PCR cycling reduces the likelihood of exponential amplification after mispriming. To reduce the risk of unintentional amplification of paralogous genes, this testing algorithm uses assays targeting exon 2 of both genes. This approach also permits analysis of the repetitive sequences that encode epitopes recognized by anti-PfHRP2 antibodies [28].
A broad range of LOD results was observed for published pfhrp2 and pfhrp3 assays, spanning over 4 orders of magnitude under the laboratory conditions employed during this study. These differences were addressed in the resulting testing pipeline (Fig. 2) by defining an initial threshold DNA concentration tenfold higher than the LOD of the downstream pfhrp2 and pfhrp3 assays. In addition, a stringent, final single-copy-gene PCR that meets the same LOD requirement was included, providing confirmation that sample degradation has not occurred during the testing process. The typical workflow employed in this laboratory includes assays 3 and 6 for pfhrp2 and pfhrp3 testing, respectively, performed in duplicate. For discordant results (i.e. one of two replicates positive), samples are called positive if there is a clear band of appropriate fragment length. If not, the assay is repeated, and the final call is based on the third result. Because the first-round of the nested assays achieved LODs below the initial and final confirmatory, falciparum-specific assays, their use as single-step assays is favoured in this laboratory to reduce the risk of contamination and improve work flow.
In settings where real-time PCR is not feasible, the proposed initial lactate dehydrogenase (pfldh) quantitative PCR assay and the final confirmatory P. falciparum beta tubulin (PfBtubulin) assays could be replaced with traditional PCR assays with LODs above the LOD of the pfhrp2 and pfhrp3 assays. Because assay performance can vary from laboratory to laboratory and with different reagents or equipment, it is essential to confirm the LOD of each assay using the reagents and laboratory infrastructure at hand.
In addition to PCR-based testing, current guidelines recommend independent confirmation of P. falciparum parasitaemia using microscopy or a non-PfHRP2-based RDT, such as an RDT that detects P. falciparum lactate dehydrogenase (pf-pLDH), before making deletion calls [19, 21]. Quantification of circulating PfHRP2 antigen is also a valuable tool that can be particularly useful for assessing PfHRP2-RDT-negative but pfhrp2/3-PCR-positive isolates with impaired protein expression [29]. Additionally, novel assays under development such as those targeting regionally specific deletion breakpoints or employing droplet digital PCR, have potential to improve throughput [30].

Conclusions

Surveillance of pfhrp2- and pfhrp3-negative P. falciparum requires careful laboratory workflows. PCR-based testing methods, coupled with microscopy and/or antigen testing, serve as useful tools to support policy development. Standardized approaches to the detection of pfhrp2- and pfhrp3-negative P. falciparum should inform efforts to define the impact of these parasites [20, 21].

Authors’ contributions

JBP designed the study. OA and JBP performed the laboratory analyses, analysed and interpreted the data and drafted the manuscript. SRM and JJJ made substantial contributions to its conception and design. All authors read and approved the final manuscript.

Acknowledgements

The authors wish to thank Andreea Waltmann for helpful advice and Kyaw Thwai for assistance with the assays. The following reagents were obtained through BEI Resources, NIAID, NIH: Genomic DNA from Plasmodium falciparum, Strain HB3, MRA-155G, contributed by Thomas E. Wellems; Genomic DNA from Plasmodium falciparum, Strain Dd2, MRA-150G, contributed by David Walliker.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

Representative gel images can be found in the Additional file. Upload of Sanger sequencing contigs to GenBank was not permitted due to their short < 200 bp fragment length. Sequence alignments are displayed in Additional file 1: Figures S5 and S6, and raw sequencing reads are provided in a combined FASTA file (Additional file 2). Otherwise, data sharing is not applicable to this article, as no datasets were generated or analysed during the current study.
Not applicable.
Not applicable.

Funding

This work was supported by the National Institute of Allergy and Infectious Diseases [5R01AI107949 to SRM], the American Society of Tropical Medicine and Hygiene-Burroughs Wellcome Fund to JBP, and the Thrasher Research Fund to JBP. The funders had no role in the study design, data collection and interpretation, writing, or the decision to submit the work for publication.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Anhänge

Additional files

Additional file 1: Figure S1. Pfhrp2 assay performance using serially diluted P. falciparum 3D7 strain DNA. Elongation temperatures were varied as listed below. All other reaction conditions are specified in Table 1. Figure S2. Pfhrp3 assay performance using serially diluted P. falciparum 3D7 strain DNA. Elongation temperatures were varied as listed below. All other reaction conditions are specified in Table 1. Figure S3. Representative agarose gel electrophoresis depicting unexpected spurious bands from Dd2 strain (pfhrp2-deleted) control DNA. PCR targeting pfhrp2 exon 1/2 (assay 1 outer) yielded a spurious ~ 300 bp band from serial dilutions of pfhrp2-deleted Dd2 strain control DNA at all three elongation temperatures. Figure S4. Representative agarose gel electrophoresis depicting unexpected spurious bands from HB3 strain (pfhrp3-deleted) control DNA. PCR targeting pfhrp3 exon 1/2 (assay 5) yielded spurious bands at ~ 300, 400, and 800 bp from serial dilutions of Dd2 strain control DNA using optimized elongation temperatures (Table 1). Figure S5. Pfhrp3 assay performance using serially diluted P. falciparum 3D7 strain DNA. Elongation temperatures were varied as listed below. All other reaction conditions are specified in Table 1. The sequence of pfhrp2 exon 1/2 (assay 1) PCR product aligns to pfhrp3, due to spurious PCR amplification of the Dd2 pfhrp3 gene. PCR was performed using 0.01 ng/μL of 3D7 (pfhrp2-positive) and Dd2 (pfhrp2-negative) control DNA, respectively (see Additional file 1: Figure S3), followed by Sanger sequencing of amplicons. Reference sequences from the consensus 3D7 (v3.0) genome for pfhrp2 and pfhrp3 are displayed on the top two rows (REF), from 5′→ 3′, with capital letters for coding regions and genetic coordinates in reference to the pfhrp2 gene. Identical bases are indicated by a period (.), missing bases by a dash (-), substitutions by the discordant base. PCR product sequence contigs are highlighted as follows: 3D7 control DNA (light gray); Dd2 control DNA (dark gray). Figure S6. The sequences of pfhrp3 exon 1/2 (assay 5) PCR product align to pfhrp2, due to spurious PCR amplification of the HB3 pfhrp2 gene. PCR was performed using 0.01 ng/μL of 3D7 (pfhrp3-positive) and HB3 (pfhrp3-negative) control DNA, respectively (see Additional file 1: Figure S4), followed by Sanger sequencing of amplicons. Reference sequences from the consensus 3D7 (v3.0) genome for pfhrp2 and pfhrp3 are displayed on the top two rows (REF), from 5′→ 3′, with capital letters for coding regions and genetic coordinates in reference to the pfhrp3 gene. Identical bases are indicated by a period (.), missing bases by a dash (-), substitutions by the discordant base. PCR product sequence contigs are highlighted as follows: 3D7 control DNA (medium gray) and HB3 control DNA 300 bp fragment (light gray), 400 bp fragment (medium gray), and 800 bp fragment (dark gray)
Literatur
1.
Zurück zum Zitat WHO. World malaria report 2016. Geneva: World Health Organization; 2016. WHO. World malaria report 2016. Geneva: World Health Organization; 2016.
2.
Zurück zum Zitat Abdallah JF, Okoth SA, Fontecha GA, Torres RE, Banegas EI, Matute ML, et al. Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras. Malar J. 2015;14:19.CrossRefPubMedPubMedCentral Abdallah JF, Okoth SA, Fontecha GA, Torres RE, Banegas EI, Matute ML, et al. Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras. Malar J. 2015;14:19.CrossRefPubMedPubMedCentral
3.
Zurück zum Zitat Akinyi S, Hayden T, Gamboa D, Torres K, Bendezu J, Abdallah JF, et al. Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru. Sci Rep. 2013;3:2797.CrossRefPubMedPubMedCentral Akinyi S, Hayden T, Gamboa D, Torres K, Bendezu J, Abdallah JF, et al. Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru. Sci Rep. 2013;3:2797.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Baldeviano GC, Okoth SA, Arrospide N, Gonzalez RV, Sanchez JF, Macedo S, et al. Molecular epidemiology of Plasmodium falciparum malaria outbreak, Tumbes, Peru, 2010–2012. Emerg Infect Dis. 2015;21:797–803.CrossRefPubMedPubMedCentral Baldeviano GC, Okoth SA, Arrospide N, Gonzalez RV, Sanchez JF, Macedo S, et al. Molecular epidemiology of Plasmodium falciparum malaria outbreak, Tumbes, Peru, 2010–2012. Emerg Infect Dis. 2015;21:797–803.CrossRefPubMedPubMedCentral
5.
Zurück zum Zitat Koita OA, Doumbo OK, Ouattara A, Tall LK, Konare A, Diakite M, et al. False-negative rapid diagnostic tests for malaria and deletion of the histidine-rich repeat region of the hrp2 gene. Am J Trop Med Hyg. 2012;86:194–8.CrossRefPubMedPubMedCentral Koita OA, Doumbo OK, Ouattara A, Tall LK, Konare A, Diakite M, et al. False-negative rapid diagnostic tests for malaria and deletion of the histidine-rich repeat region of the hrp2 gene. Am J Trop Med Hyg. 2012;86:194–8.CrossRefPubMedPubMedCentral
6.
Zurück zum Zitat Murillo Solano C, Akinyi Okoth S, Abdallah JF, Pava Z, Dorado E, Incardona S, et al. Deletion of Plasmodium falciparum histidine-rich protein 2 (pfhrp2) and histidine-rich protein 3 (pfhrp3) genes in Colombian parasites. PLoS ONE. 2015;10:e0131576.CrossRefPubMedPubMedCentral Murillo Solano C, Akinyi Okoth S, Abdallah JF, Pava Z, Dorado E, Incardona S, et al. Deletion of Plasmodium falciparum histidine-rich protein 2 (pfhrp2) and histidine-rich protein 3 (pfhrp3) genes in Colombian parasites. PLoS ONE. 2015;10:e0131576.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Wurtz N, Fall B, Bui K, Pascual A, Fall M, Camara C, et al. Pfhrp2 and pfhrp3 polymorphisms in Plasmodium falciparum isolates from Dakar, Senegal: impact on rapid malaria diagnostic tests. Malar J. 2013;12:34.CrossRefPubMedPubMedCentral Wurtz N, Fall B, Bui K, Pascual A, Fall M, Camara C, et al. Pfhrp2 and pfhrp3 polymorphisms in Plasmodium falciparum isolates from Dakar, Senegal: impact on rapid malaria diagnostic tests. Malar J. 2013;12:34.CrossRefPubMedPubMedCentral
8.
Zurück zum Zitat Kumar N, Pande V, Bhatt RM, Shah NK, Mishra N, Srivastava B, et al. Genetic deletion of HRP2 and HRP3 in Indian Plasmodium falciparum population and false negative malaria rapid diagnostic test. Acta Trop. 2013;125:119–21.CrossRefPubMed Kumar N, Pande V, Bhatt RM, Shah NK, Mishra N, Srivastava B, et al. Genetic deletion of HRP2 and HRP3 in Indian Plasmodium falciparum population and false negative malaria rapid diagnostic test. Acta Trop. 2013;125:119–21.CrossRefPubMed
9.
Zurück zum Zitat Gamboa D, Ho MF, Bendezu J, Torres K, Chiodini PL, Barnwell JW, et al. A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS ONE. 2010;5:e8091.CrossRefPubMedPubMedCentral Gamboa D, Ho MF, Bendezu J, Torres K, Chiodini PL, Barnwell JW, et al. A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS ONE. 2010;5:e8091.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Li P, Xing H, Zhao Z, Yang Z, Cao Y, Li W, et al. Genetic diversity of Plasmodium falciparum histidine-rich protein 2 in the China-Myanmar border area. Acta Trop. 2015;152:26–31.CrossRefPubMedPubMedCentral Li P, Xing H, Zhao Z, Yang Z, Cao Y, Li W, et al. Genetic diversity of Plasmodium falciparum histidine-rich protein 2 in the China-Myanmar border area. Acta Trop. 2015;152:26–31.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Amoah LE, Abankwa J, Oppong A. Plasmodium falciparum histidine rich protein-2 diversity and the implications for PfHRP 2: based malaria rapid diagnostic tests in Ghana. Malar J. 2016;15:101.CrossRefPubMedPubMedCentral Amoah LE, Abankwa J, Oppong A. Plasmodium falciparum histidine rich protein-2 diversity and the implications for PfHRP 2: based malaria rapid diagnostic tests in Ghana. Malar J. 2016;15:101.CrossRefPubMedPubMedCentral
12.
Zurück zum Zitat Bharti PK, Chandel HS, Ahmad A, Krishna S, Udhayakumar V, Singh N. Prevalence of pfhrp2 and/or pfhrp3 gene deletion in Plasmodium falciparum population in eight highly endemic states in India. PLoS ONE. 2016;11:e0157949.CrossRefPubMedPubMedCentral Bharti PK, Chandel HS, Ahmad A, Krishna S, Udhayakumar V, Singh N. Prevalence of pfhrp2 and/or pfhrp3 gene deletion in Plasmodium falciparum population in eight highly endemic states in India. PLoS ONE. 2016;11:e0157949.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Berhane A, Russom M, Bahta I, Hagos F, Ghirmai M, Uqubay S. Rapid diagnostic tests failing to detect Plasmodium falciparum infections in Eritrea: an investigation of reported false negative RDT results. Malar J. 2017;16:105.CrossRefPubMedPubMedCentral Berhane A, Russom M, Bahta I, Hagos F, Ghirmai M, Uqubay S. Rapid diagnostic tests failing to detect Plasmodium falciparum infections in Eritrea: an investigation of reported false negative RDT results. Malar J. 2017;16:105.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Parr JB, Verity R, Doctor SM, Janko M, Carey-Ewend K, Turman BJ, et al. Pfhrp2-Deleted Plasmodium falciparum parasites in the Democratic Republic of the Congo: a national cross-sectional survey. J Infect Dis. 2017;216:36–44.CrossRefPubMed Parr JB, Verity R, Doctor SM, Janko M, Carey-Ewend K, Turman BJ, et al. Pfhrp2-Deleted Plasmodium falciparum parasites in the Democratic Republic of the Congo: a national cross-sectional survey. J Infect Dis. 2017;216:36–44.CrossRefPubMed
15.
Zurück zum Zitat Rachid Viana GM, Akinyi Okoth S, Silva-Flannery L, Lima Barbosa DR, Macedo de Oliveira A, Goldman IF, et al. Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia. PLoS ONE. 2017;12:e0171150.CrossRefPubMedPubMedCentral Rachid Viana GM, Akinyi Okoth S, Silva-Flannery L, Lima Barbosa DR, Macedo de Oliveira A, Goldman IF, et al. Histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in Plasmodium falciparum isolates from select sites in Brazil and Bolivia. PLoS ONE. 2017;12:e0171150.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Beshir KB, Sepulveda N, Bharmal J, Robinson A, Mwanguzi J, Busula AO, et al. Plasmodium falciparum parasites with histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in two endemic regions of Kenya. Sci Rep. 2017;7:14718.CrossRefPubMedPubMedCentral Beshir KB, Sepulveda N, Bharmal J, Robinson A, Mwanguzi J, Busula AO, et al. Plasmodium falciparum parasites with histidine-rich protein 2 (pfhrp2) and pfhrp3 gene deletions in two endemic regions of Kenya. Sci Rep. 2017;7:14718.CrossRefPubMedPubMedCentral
17.
Zurück zum Zitat Kozycki CT, Umulisa N, Rulisa S, Mwikarago EI, Musabyimana JP, Habimana JP, et al. False-negative malaria rapid diagnostic tests in Rwanda: impact of Plasmodium falciparum isolates lacking hrp2 and declining malaria transmission. Malar J. 2017;16:123.CrossRefPubMedPubMedCentral Kozycki CT, Umulisa N, Rulisa S, Mwikarago EI, Musabyimana JP, Habimana JP, et al. False-negative malaria rapid diagnostic tests in Rwanda: impact of Plasmodium falciparum isolates lacking hrp2 and declining malaria transmission. Malar J. 2017;16:123.CrossRefPubMedPubMedCentral
18.
Zurück zum Zitat Gupta H, Matambisso G, Galatas B, Cistero P, Nhamussua L, Simone W, et al. Molecular surveillance of pfhrp2 and pfhrp3 deletions in Plasmodium falciparum isolates from Mozambique. Malar J. 2017;16:416.CrossRefPubMedPubMedCentral Gupta H, Matambisso G, Galatas B, Cistero P, Nhamussua L, Simone W, et al. Molecular surveillance of pfhrp2 and pfhrp3 deletions in Plasmodium falciparum isolates from Mozambique. Malar J. 2017;16:416.CrossRefPubMedPubMedCentral
19.
Zurück zum Zitat WHO. P. falciparum hrp2/3 gene deletions: conclusions and recommendations of a technical consultation. Geneva: World Health Organization; 2016. WHO. P. falciparum hrp2/3 gene deletions: conclusions and recommendations of a technical consultation. Geneva: World Health Organization; 2016.
20.
Zurück zum Zitat WHO. False-negative RDT results and implications of new P. falciparum histidine-rich protein 2/3 gene deletions. Geneva: World Health Organization; 2016. WHO. False-negative RDT results and implications of new P. falciparum histidine-rich protein 2/3 gene deletions. Geneva: World Health Organization; 2016.
21.
Zurück zum Zitat Cheng Q, Gatton ML, Barnwell J, Chiodini P, McCarthy J, Bell D, et al. Plasmodium falciparum parasites lacking histidine-rich protein 2 and 3: a review and recommendations for accurate reporting. Malar J. 2014;13:283.CrossRefPubMedPubMedCentral Cheng Q, Gatton ML, Barnwell J, Chiodini P, McCarthy J, Bell D, et al. Plasmodium falciparum parasites lacking histidine-rich protein 2 and 3: a review and recommendations for accurate reporting. Malar J. 2014;13:283.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Su XZ, Wu Y, Sifri CD, Wellems TE. Reduced extension temperatures required for PCR amplification of extremely A + T-rich DNA. Nucleic Acids Res. 1996;24:1574–5.CrossRefPubMedPubMedCentral Su XZ, Wu Y, Sifri CD, Wellems TE. Reduced extension temperatures required for PCR amplification of extremely A + T-rich DNA. Nucleic Acids Res. 1996;24:1574–5.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat Baker J, McCarthy J, Gatton M, Kyle DE, Belizario V, Luchavez J, et al. Genetic diversity of Plasmodium falciparum histidine-rich protein 2 (PfHRP2) and its effect on the performance of PfHRP2-based rapid diagnostic tests. J Infect Dis. 2005;192:870–7.CrossRefPubMed Baker J, McCarthy J, Gatton M, Kyle DE, Belizario V, Luchavez J, et al. Genetic diversity of Plasmodium falciparum histidine-rich protein 2 (PfHRP2) and its effect on the performance of PfHRP2-based rapid diagnostic tests. J Infect Dis. 2005;192:870–7.CrossRefPubMed
24.
Zurück zum Zitat Li W, Cowley A, Uludag M, Gur T, McWilliam H, Squizzato S, et al. The EMBL-EBI bioinformatics web and programmatic tools framework. Nucleic Acids Res. 2015;43:W580–4.CrossRefPubMedPubMedCentral Li W, Cowley A, Uludag M, Gur T, McWilliam H, Squizzato S, et al. The EMBL-EBI bioinformatics web and programmatic tools framework. Nucleic Acids Res. 2015;43:W580–4.CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat Berhane A, Mihreteab S, Mohammed S, Embaye G, Hagos F, Zehaie A, et al. PfHRP2 detecting malaria RDTs: alarming false-negative results in Eritrea (Poster #879). Annual meeting of the American Society of Tropical Medicine and Hygiene. 2016; Atlanta, Georgia, USA. Berhane A, Mihreteab S, Mohammed S, Embaye G, Hagos F, Zehaie A, et al. PfHRP2 detecting malaria RDTs: alarming false-negative results in Eritrea (Poster #879). Annual meeting of the American Society of Tropical Medicine and Hygiene. 2016; Atlanta, Georgia, USA.
26.
Zurück zum Zitat Gamboa D, Ho MF, Bendezu J, Torres K, Chiodini PL, Barnwell JW, et al. A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS ONE. 2010;5:e0008091.CrossRef Gamboa D, Ho MF, Bendezu J, Torres K, Chiodini PL, Barnwell JW, et al. A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS ONE. 2010;5:e0008091.CrossRef
27.
Zurück zum Zitat Menegon M, L’Episcopia M, Nurahmed AM, Talha AA, Nour BYM, Severini C. Identification of Plasmodium falciparum isolates lacking histidine-rich protein 2 and 3 in Eritrea. Infect Genet Evol. 2017;55:131–4.CrossRefPubMed Menegon M, L’Episcopia M, Nurahmed AM, Talha AA, Nour BYM, Severini C. Identification of Plasmodium falciparum isolates lacking histidine-rich protein 2 and 3 in Eritrea. Infect Genet Evol. 2017;55:131–4.CrossRefPubMed
28.
Zurück zum Zitat Lee N, Gatton ML, Pelecanos A, Bubb M, Gonzalez I, Bell D, et al. Identification of optimal epitopes for Plasmodium falciparum rapid diagnostic tests that target histidine-rich proteins 2 and 3. J Clin Microbiol. 2012;50:1397–405.CrossRefPubMedPubMedCentral Lee N, Gatton ML, Pelecanos A, Bubb M, Gonzalez I, Bell D, et al. Identification of optimal epitopes for Plasmodium falciparum rapid diagnostic tests that target histidine-rich proteins 2 and 3. J Clin Microbiol. 2012;50:1397–405.CrossRefPubMedPubMedCentral
29.
Zurück zum Zitat Rogier E, Plucinski M, Lucchi N, Mace K, Chang M, Lemoine JF, et al. Bead-based immunoassay allows sub-picogram detection of histidine-rich protein 2 from Plasmodium falciparum and estimates reliability of malaria rapid diagnostic tests. PLoS ONE. 2017;12:e0172139.CrossRefPubMedPubMedCentral Rogier E, Plucinski M, Lucchi N, Mace K, Chang M, Lemoine JF, et al. Bead-based immunoassay allows sub-picogram detection of histidine-rich protein 2 from Plasmodium falciparum and estimates reliability of malaria rapid diagnostic tests. PLoS ONE. 2017;12:e0172139.CrossRefPubMedPubMedCentral
30.
Zurück zum Zitat Koepfli C, Badu K, Lo E, Hemming-Schroeder E, Yan G. High-throughput screening of P. falciparum hrp2 deletion for monitoring of RDT efficacy for malaria diagnosis (Poster #290). Annual meeting of the American Society of Tropical Medicine and Hygiene. 2017; Baltimore, Maryland, USA. Koepfli C, Badu K, Lo E, Hemming-Schroeder E, Yan G. High-throughput screening of P. falciparum hrp2 deletion for monitoring of RDT efficacy for malaria diagnosis (Poster #290). Annual meeting of the American Society of Tropical Medicine and Hygiene. 2017; Baltimore, Maryland, USA.
31.
Zurück zum Zitat Pickard AL, Wongsrichanalai C, Purfield A, Kamwendo D, Emery K, Zalewski C, Kawamoto F, Miller RS, Meshnick SR. Resistance to antimalarials in Southeast Asia and genetic polymorphisms in pfmdr1. Antimicrob Agents Chemother. 2003;47:2418–23.CrossRefPubMedPubMedCentral Pickard AL, Wongsrichanalai C, Purfield A, Kamwendo D, Emery K, Zalewski C, Kawamoto F, Miller RS, Meshnick SR. Resistance to antimalarials in Southeast Asia and genetic polymorphisms in pfmdr1. Antimicrob Agents Chemother. 2003;47:2418–23.CrossRefPubMedPubMedCentral
32.
Zurück zum Zitat Price RN, Uhlemann AC, Brockman A, McGready R, Ashley E, Phaipun L, et al. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number. Lancet. 2004;364:438–47.CrossRefPubMedPubMedCentral Price RN, Uhlemann AC, Brockman A, McGready R, Ashley E, Phaipun L, et al. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number. Lancet. 2004;364:438–47.CrossRefPubMedPubMedCentral
33.
Zurück zum Zitat Afonina I, Ankoudinova I, Mills A, Lokhov S, Huynh P, Mahoney W. Primers with 5′ flaps improve real-time PCR. Biotechniques. 2007;43:770–4.CrossRefPubMed Afonina I, Ankoudinova I, Mills A, Lokhov S, Huynh P, Mahoney W. Primers with 5′ flaps improve real-time PCR. Biotechniques. 2007;43:770–4.CrossRefPubMed
Metadaten
Titel
Streamlined, PCR-based testing for pfhrp2- and pfhrp3-negative Plasmodium falciparum
verfasst von
Jonathan B. Parr
Olivia Anderson
Jonathan J. Juliano
Steven R. Meshnick
Publikationsdatum
01.12.2018
Verlag
BioMed Central
Erschienen in
Malaria Journal / Ausgabe 1/2018
Elektronische ISSN: 1475-2875
DOI
https://doi.org/10.1186/s12936-018-2287-4

Weitere Artikel der Ausgabe 1/2018

Malaria Journal 1/2018 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.