Introduction
Bladder cancer is one of the most common tumors all over the world [
1]. Surgery, radiation therapy and chemotherapy are major therapies for the treatment of bladder cancer while they have inevitable side effects because of lack of specificity [
2,
3]. Thus, we should focus on an effective and tumor-specific therapeutic method for bladder cancer.
MicroRNA (miRNA) is a type of endogenous non-coding RNAs and also a key mediator of RNA interference (RNAi) in eukaryotes [
4‐
6]. Many protein-coding genes are influenced by miRNAs through target-sequence interaction [
4]. Complete or partial pairing of the miRNA complex to the target mRNA transcript causes RNA degradation or translational inhibition [
7]. Studies show that based on the pri-miR-155 backbone, artificial miRNAs (amiRNAs) were created through inserting a series of miRNA precursors with different stem sequences, which generated efficient mature miRNA [
8,
9]. In addition, a subset of non-coding RNAs, regulatory RNAs, repress or activate translation through sensing environmental signals or other RNA molecules [
10].
GAL4, a yeast transcriptional activator, and upstream activating sequence (UAS) that is the specific recognition sequence of GAL4 or GAL4-VP64 fusion protein, are two components in GAL4/UAS system [
11]. This system operates not only in yeast but also in various mammal cells [
12,
13]. The UAS, a minimal promoter, cannot drive the expression of downstream targeting genes until the binding of GAL4 protein or GAL4-VP64 fusion protein [
13]. Moreover, to develop a kind of cancer-specific treatment, we try to use tumor-specific elements to achieve this purpose. The human telomerase reverse transcriptase (hTERT), one of the subunits of telomerase, exists in most tumors but not normal tissues [
14,
15]. Previous studies show that compared with the wild-type
hTERT promoter, the mutant
hTERT promoter could enhance the expression of
hTERT or downstream genes and still maintain its tumor-specific feature [
16‐
18]. We pick the tumor-specific element, mutant
hTERT promoter, from a previous study [
19]. In their study, they utilized the mutant
hTERT to drive expression of BCL2 shRNA. However, their driven efficiency was still not very high and stable expression of BCL2 shRNA may do harm to cells. Compared with their work, we may overcome these limitations.
Using the above elements, we could construct artificial devices with novel functions according to the principles of synthetic biology [
17,
20,
21]. Synthetic devices have been used to regulate gene expression or control the biological phenotypes of cancer cells [
22,
23]. Synthetic amiRNA, one of the synthetic devices, could knockdown expression of genes with several advantages, including co-expression with a gene of interest, stable expression and low toxicity [
24‐
28]. Wang, et al. synthesized amiRNA clusters and used them as powerful tools for multiplex gene knockdown at the posttranscriptional level [
9]. In this study, we construct and synthesize regulatory RNAs to control the gene expression. The inhibitive RNA (iRNA) binds UAS so GAL4-VP64 cannot recognize UAS. The active RNA (aRNA) which is constructed according to the previous study [
10] interacts with iRNA tightly and UAS is exposed again, and finally GAL4-VP64 binds UAS to activate amiRNAs targeting MYC.
MYC was one of the most well-known deregulated oncogenes and the third most amplified gene in human cancer [
29,
30]. In bladder cancer, increase of
MYC copy number occurred before muscle invasion and correlated with grade [
31]. Furthermore, MYC was regarded as an independent predictor of progression-free and cancer-specific survival [
32]. Thus, we choose MYC as the therapeutic target in this study.
In our study, we constructed synthetic artificial miRNA devices driven by UAS to suppress the expression of the MYC oncogene in bladder cancer. As mentioned above, synthetic iRNA block UAS from binding the GAL4-VP64 fusion protein. And results of in vitro and in vivo experiments showed that the GAL4-VP64 fusion protein interacts with UAS again when aRNA expressed. In short, synthetic regulatory RNAs selectively inhibit the progression of bladder cancer through controlling the expression of amiRNAs targeting MYC.
Materials and methods
Cell lines and cell culture
Human bladder cancer cell lines (T24 and 5637) and human foreskin fibroblast (HFF) cells were purchased from the Institute of Cell Research, Chinese Academic of Sciences, Shanghai, China. The normal bladder epithelium SV-HUC-1 cell line was established by transformation of human normal ureter tissue with SV40 virus, and purchased from American Type Culture Collection (ATCC). T24 and HFF cells were cultured in DMEM (Invitrogen, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS). The 5637 cells were maintained in 10% FBS RPMI-1640 media (Invitrogen, Carlsbad, CA, USA). The SV-HUC-1 cells were grown according to the manufacturer’s protocol. The cells were cultured at 37 °C in a humidified atmosphere of 5% CO2 in an incubator.
Patient samples
Thirty-nine pairs of bladder cancer tissues and matched para-carcinoma tissues were resected from patients diagnosed with bladder cancer. Samples were treated with other necessary procedures according to a previous study [
33]. This study was admitted by the Institutional Review Board of Peking University Shenzhen Hospital.
Creation of iRNA, aRNA and artificial miRNAs
To construct a vector that expresses iRNA, the sequence of iRNA was inserted into the pcDNA3-EGFP vector (Addgene #13031) between the restriction sites XhoI and XbaI. To create vectors expressing aRNA, we used the mutant
hTERT promoter and aRNA to replace CMV promoter and EGFP respectively in the pcDNA3-EGFP vector. GAL4-VP64 displaced EGFP in pcDNA3-EGFP vector to create pcDNA3-GAL4-VP64 vector. Besides, UAS and related artificial microRNAs were designed, synthesized and inserted between the restriction sites BbsI and BstBI into the pcDNA3-GAL4-VP64 vector. In dual luciferase reporter assays, UAS replaced the SV40 promoter in the siCHECK™-2 vector (Promega, Madison, USA) between the restriction sites BgIII and Nhel. The iRNA can bind UAS while aRNA driven by mutant
hTERT promoter can interact with iRNA. The siRNA duplexes for
MYC and the negative control (indicated as si-
MYC and si-NC) were designed and synthesized by GenePharma, Suzhou, China. All of the related sequences were shown in Table
1.
Table 1
Relative sequences in this study
NC amiRNA | CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCATTCTCCGAACGTGTCACGTATAGTG AAGCCACAGATGTATACGTGACACGTTCGGAGAATTTGCCTACTGCCTCGCTTCAAGGTA TATTGCTGTTGACAGTGAGCGCATTCTCCGAACGTGTCACGTATAGTGAAGCCACAGATG TATACGTGACACGTTCGGAGAATTTGCCTACTGCCTCGGCGGCCGC |
MYC amiRNA | CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCACAGAAATGTCCTGAGCAATATAGTG AAGCCACAGATGTATATTGCTCAGGACATTTCTGTTTGCCTACTGCCTCGCTTCCTTCCTTC AAGGTATATTGCTGTTGACAGTGAGCGCATGGACAGTGTCAGAGTCTATAGTGAAGCCAC AGATGTATAGACTCTGACACTGTCCATTTGCCTACTGCCTCGGCGGCCGC |
iRNA | GAAUUCCGGAGGUCAGAACUCUUGG |
aRNA | CGCCAAGAGUUCUGUCCUCCGGUGGUGGUUAAUGAAAAUUAACUUACUAUACCAUAUA UCUCUAGA |
mutant hTERT promoter | GGCCCCTCCCTCGGGTTACCCCACAGCCTAGGCCGATTCGACCTCTCTCCGCTGGGGCC CTCGCTGGCGTCCCTGCACCCTGGGAGCGCGAGCGGCGCGCGGGCGGGGAAGCGCGG CCCAGACCCCCGGGTCCGCCCGGAGCAGCTGCGCTGTCGGGGCCAGGCCGGGCTCCCA GTGGATTCGCGGGCACAGACGCCCAGGACCGCGCTCCCCACGTGGCGGAGGGACTGGG GACCCGGGCACCCGTCCTGCCCCTTCACCTTCCGGCTCCGCCTCCTCCGCGCGGACCCCG CCCCGTCCCGACCCCTTCCGGGTTTCCGGCCCAGCCCCTTCCGGGCCCTCCCAGCCCCTC CCCTTCCTTTCCGGGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCCGGCAGCGCTGCGTC CTGCTGCGCACGTGGGAAGCCCTGGCCC CGGCCACCCCCGCG |
UAS | CGGAGTACTGTCCTCCG |
GAL4-VP64 | ATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAAAAGCTCAAG TGCT CCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAGTGTCGCT ACTCTCCCAAAACCAAAAGGTCTCCGCTGACTAGGGCACATCTGACAGAAGTGGAATCA AGGCTAGAAAGACTGGAACAGCTATTTCTACTGATTTTTCCTCGAGAAGACCTTGACATG ATTTTGAAAATGGATTCTTTACAGGATATAAAAGCATTGTTAACAGGATTATTTGTACAAGA TAATGTGAATAAAGATGCCGTCACAGATAGATTGGCTTCAGTGGAGACTGATATGCCTCTA ACATTGAGACAGCATAGAATAAGTGCGACATCATCATCGGAAGAGAGTAGTAACAAAGGT CAAAGACAGTTGACTGTATCGGGTTCCGGACGGGCTGACGCATTGGACGATTTTGATCTG GATATGCTGGGAAGTGACGCCCTCGATGATTTTGACCTTGACATGCTTGGTTCGGATGCCC TTGATGACTTTGACCTCGACATGCTCGGCAGTGACGCCCTTGATGATTTCGACCTGGACAT GCTGATTAAC |
si-MYC sense si-MYC antisense | GCUUCACCAACAGGAACUATT UAGUUCCUGUUGGUGAAGCTT |
Cell transfection
The propagated synthetic constructed vectors from E.coli bacteria were extracted using Plasmid Midiprep kits (Promega, Madison, USA). The cells were transfected with specific siRNA or synthetic vectors using Lipofectamine 2000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.
Dual luciferase reporter assay
Cells (1 × 105 per well) were cultured in 24-well plates and transfected with specific siRNA or vectors. After 48 h transfection, the luciferase activity was measured using the dual luciferase assay system (Promega, Madison, WI, USA) according to the manufacturer’s protocol. The experiments were performed at least three times.
RNA extraction and quantitative RT-PCR
The TRIzol reagent (Invitrogen, Grand Island, NY, USA) was used to extract total RNA from cells after transfection according to the manufacturer’s protocol. The cDNA was synthesized from total RNA using PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China). The mRNA expression levels of MYC were measured by quantitative RT-PCR (qRT-PCR) on the Roche lightcycler 480 Real-Time PCR System. GAPDH was used as the endogenous control to normalize the data. The primers used were: MYC-forward: 5′-GCAGCTGCTTAGACG CTGGA-3′, MYC-reverse: 5′-CGCAGTAGAAATACGGCTGCAC-3′; GAPDH –forward: 5′-CGCTCTCTGCTCCTCCTGTTC-3′, GAPDH-reverse: 5′-ATCCGTT GACTCCGACCTTCAC-3′. The comparative ΔCt method was used to analyze the relative expression of MYC. All of the experiments were performed at least three times.
Western-blot analysis
The transfected cells were washed in PBS and lysed in RIPA reagent (Beyotime, Jiansu, China). The bicinchoninic acid quantification assay (Pierce Biotechnolofy, Rockford, IL, USA) was used to calculate the protein concentration. Equal amounts of whole protein extract were electrophoresed on SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membranes using a semi-dry transfer cell (Bio-Rad Laboratories, Hercules, CA, USA). After blocked with 5% milk, the membranes were incubated over night with specific primary antibodies against MYC (1:1000; Cell Signaling Technology, USA) and GAPDH (1:10,000; Sigma-Aldrich). Horseradish peroxidase-conjugated secondary antibody (Amersham, Piscataway, NJ, USA) was used to incubate the blot for one hour at room temperature on a rocking platform. Finally, signal intensities were quantified using Super Signal chemiluminescence reagents (Pierce).
Cell proliferation assay
Cell Counting Kit-8 (Beyotime Institute of Biotechnology, Shanghai, China) was used to detect cell proliferation according to the manufacturer’s instructions. Cells (4000 per well) were seeded into a 96-well plate. Then, 24, 48 or 72 h after transfection, 10 μl of CCK-8 was added to each well and the cells were incubated for 40 min. Absorbance was detected at a wavelength of 450 nm using an ELISA microplate reader (Bio-Rad, Hercules, CA, USA). All of the assays were performed in triplicate.
ELISA assay
Cells were transfected with specific siRNA or vectors. The activity of caspase-3 represented the levels of apoptosis and was measured using the caspase 3 enzyme-linked immunosorbent assay (ELISA) assay kit (Hcusabio, Wuhan, China) according to the manufacturer’s protocols. All of the experiments were performed at least three times.
Cell migration assay
Cells were seeded in 6-well plates to 90% confluence before transfection. A sterile pipette tip was used to create a clear line. Twenty-four hours after transfection, the migration distance was measured using the software program HMIAS-2000. The experiments were repeated at least three times.
Xenograft model of tumor growth in vivo
The experimental procedures were approved by Institutional Ethics Review Board. Male immune-deficient BALB/c nude mice (4–5 weeks old) were purchased from Beijing Wei-tong Li-hua Laboratory Animals and Technology Ltd., Beijing, China. Vectors were packed into lentivirus according to the manufacturer’s protocols using Lentiviral Packing Kit, SyngenTech, China. In detail, 107 5637 cells were suspended in 100 μl Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) and injected subcutaneously into the right armpits of BALB/c nude mice. LV-NC represents NC amiRNA + GAL4-VP64 + iRNA + aRNA. Besides, MYC amiRNA + GAL4-VP64+ iRNA + aRNA was regarded as the LV-Treatment group. 15 days after implantation, tumor volumes were monitored every 5 days over a 2-week period. Tumor volumes were calculated using the formula: 0.5 × length × width2. At the end of the experiment, mice were euthanized, and the subcutaneous weight of each tumor was measured.
Statistical analysis
All statistical analyses were performed using 21.0 version SPSS computer software (SPSS Inc., Chicago, IL, USA). The data are presented as the mean ± S.D. and were analyzed using Student’s t-test or ANOVA. A two-sided value of P < 0.05 was considered statistically significant.
Discussion
RNA molecules are often regarded as messengers of information from genes to the protein and also have regulatory roles in human diseases [
34‐
37]. Repressor RNA and activator RNA are small RNAs that have regulatory roles in controlling post-transcriptional gene expression in prokaryotic cells [
10,
38]. Whether these regulatory RNAs can control gene expression in eukaryotic cells is unknown. In our study, we construct regulatory RNAs, iRNA and aRNA according to the principles of creation in a previous study [
10], and it is the first time to measure the roles of regulatory RNAs in mammal cells.
UAS cannot drive the downstream gene expression without the binding of activating proteins, such as GAL4 or GAL4-VP64 fusion protein [
13,
39]. In the present study, the iRNA was used to compete with GAL4-VP64 protein to bind UAS. However, synthetic aRNA interacted with iRNA and exposed UAS again. Thus, GAL4-VP64 protein can bind UAS again and the downstream gene of UAS could be expressed.
The amiRNAs were inserted into the downstream of UAS in this project. MicroRNAs (miRNAs) are small non-coding RNAs and play significant roles in many biological processes [
5,
40‐
42]. Studies show that artificial miRNAs can promote gene silencing in a similar manner to natural miRNAs and they have the same efficiency and are more stable and less cytotoxic compared with shRNAs or siRNAs [
43,
44]. Artificial miRNAs can be designed and synthesized to silence multiple genes or a cluster of amiRNA sequences can be constructed to efficiently suppress one gene [
9]. Owing to the vital oncogenic role of MYC in the metabolism of cancer, we choose MYC as the therapeutic target for future study.
The mutant
hTERT promoter is a potential tumor-specific element and has been used to selectively drive expression of downstream genes in bladder cancer cells [
17]. Therefore, trying to solve limitations in the specificity and effectiveness of treatment in bladder cancer, we also take advantage of this element to selectively control gene expression in bladder cancer cells. In this study, the aRNA was driven by the mutant
hTERT promoter picked from a previous study [
19] and expressed in bladder cancer cells but not human foreskin fibroblast cells. In our work, expression of the amiRNA targeting MYC was only activated when GAL4-VP64 fusion protein binds UAS. We used synthetic regulatory RNAs to control this binding procedure (GAL4-VP64 binds UAS). Compared with their work [
19], our strategy has two advantages. The p65 or VPR (a chimeric activator that is composed of the VP64, p65 and Rta domains) showed much higher transcriptional activation efficiency than VP64 [
45]. Our strategy is modular and we could replace GAL4-VP64 with GAL4-P65 or GAL4-VPR to get much higher driven efficiency for expression of the downstream gene in the future, which is one merit. What’s more, stable expression of amiRNAs targeting MYC may be harmful for cells and we construct synthetic regulatory RNAs that are regarded as a similarly “switch” to control the expression of amiRNA, which is the other advantage.
We verified the function of MYC in bladder cancer cells. High expression of MYC was significantly correlated with bladder cancer histological grade and TNM stage. Additionally, functional experiments showed that MYC is an oncogene in bladder cancer cells. Then, we constructed tandem amiRNA sequences targeting oncogenic MYC in bladder cancer driven by UAS and tested whether synthetic regulatory RNAs can regulate the expression of amiRNA. Our results demonstrated that when cells express iRNA and GAL4-VP64 protein in bladder cancer cells and HFF cells, the expression of MYC cannot be significantly inhibited. When aRNA driven by a tumor-specific promoter was transiently transfected into cells, amiRNA targeting MYC can be expressed to markedly decrease the mRNA and protein expression levels of oncogenic MYC and significantly inhibit cell growth in vitro, induce apoptosis and suppress the migration of bladder cancer cells, but not human foreskin fibroblast cells. What’s more, the in vivo experiment showed that expression of aRNA can inhibit tumor volume compared with the relative negative control.
In conclusion, we used a synthetic platform to design and construct synthetic regulatory RNAs and artificial miRNAs. We can selectively control the expression of synthetic artificial miRNAs to inhibit progression of bladder cancer by regulatory iRNA and aRNA in vitro and in vivo. Synthetic regulatory RNAs might be a selective therapeutic method for bladder cancer.