The clinical significance of IL-6 s and IL-27 s in Bronchoalveolar lavage fluids from children with mycoplasma pneumoniae pneumonia

In this study, the diagnosis of MPP met the following criteria: 1) fever, coughing, and other respiratory tract infection symptoms; 2) chest radiographic examinations with bronchial pneumonia, interstitial pneumonia, segmental or lobar pneumonia, and even pleural effusion; and 3) a single serum anti- MP IgM antibody titer of ≥1:160 at the acute phase following admission (in those with no history of respiratory infections in the past 3 months) and a positive PCR test for MP. Patients with any of the following criteria [12, 13] would be diagnosed as severe cases: 1) tachypnea or tachycardia (Tachypnea was defined as a respiratory rate of > 40/m for children aged 1–5 years, and 30/m for children aged> 5 years. Tachycardia was defined as > 140 bpm for children aged 1–3 years, > 120 bpm for children aged 3–5, > 118 bpm for children aged 5–10 years, and > 100 bpm for children aged > 10 years of age.) with or without nasal flare, moaning, three concave sign, and cyanosis; 2) hypoxemia (SaO2 ≤ 92%); 3) refractory MPP; 4) multilobar involvement or involvement area ≥ 2/3 on chest radiographs; 5) pleural effusion (> 300 ml), severe atelectasis, pulmonary necrosis and pulmonary abscess. 6) Other severe complications (central nervous system infections, heart failure, myocarditis, gastrointestinal hemorrhage, and obvious electrolyte/ acid-base balance disorders). Patients having infections within 3 months, or suffering from known coexisting chronic, progressive or oncological illnesses, or receiving corticosteroids or immunosuppressive agents within 3 months, or with immune hypofunctions or immune related diseases, or allergic diseases or suspected allergic diseases (including allergic rhinitis and atopic dermatitis) or asthmas were excluded from the research.

All the patients were divided into severe cases and mild cases by the severity of the diseases. The whole patients could also be divided into MP single infection group and MP mixed infection group according to the infection types as well as low MP DNA loads (<10⁵copies/ml) and high MP DNA loads (≥10⁵copies/ml) according to the MP DNA loads.

Data including ages, genders, clinical signs and symptoms, laboratory and radiological findings were collected from patients during Jan 1st and Dec 31st of the year 2017. All chest radiographs and computed tomography were reviewed by two experienced radiologists and they agreed on the conclusions.

MP DNAs from BALFs were extracted using QIAamp DNA MINI kit (Qiagen, Hilden Germany). The target gene for detecting MP by PCR was a segment of gene p1 adhesion with 150 bp (P1–178: CAATGCCATCAACCCGCGCTTAACC,P1–331: CGTGGTTTGTTGACTGCCACTGCCG). The PCR conditions were: 30 cycles of 94 °C for 30 s, 62 °C for 30 s and 72 °C for 30 s. MP DNA was quantified using Mycoplasma pneumoniae DNA Fluorescence Diagnostic Kit (Shengxiang Biotechnology Co. Ltd., Hunan Province, China) with ABI PRISM 7500 instrument (Applied Biosystems TM, Foster City, California, United States). The experiments were strictly conducted in accordance with the manufacturers’ instructions.

Bronchoscopy was performed within 3 days after hospital admission for patients with MPP and immediately after hospital admission to remove the foreign bodies in bronchus from children in control. Flexible fiber optic bronchoscopy and bronchoalveolar lavage were performed following the guidelines described previously [14]. BALFs were collected from these children and stored in − 80 °C freezer.

IL-6 s and IL-27 s in BALFs from the children were measured by sandwich enzyme-linked immunosorbent assay (ELISA) with commercial reagent kits (Abcan Company, USA). The experiments were strictly conducted in accordance with the manufacturer’s instructions.

Statistical analyses were performed using SPSS21.0 Statistical package. Continuous variables were reported as means ± standard deviations. ANOVA was used to compare means of multiple groups. LSD test was used for the inter-comparison of 2 means in the multiple groups. The ages and genders between MPP patients and control were compared with t test and x² test, respectively. MP DNA loads, IL-6 s and IL-27 s were shown and compared by box plots. P < 0.05 was considered to indicate a statistically significant difference.

From Jan 1st to Dec 31st of the year 2017, a total of 98 hospitalized children with MPP according to the including criteria and excluding criteria were enrolled. All patients including 47 male patients and 51 female ones underwent fiberoptic bronchoscopy, and BALFs were collected from them. The ages of the patients ranged from 1 to 13 years (6.63 ± 2.56 years). During the study period, 15 children with foreign bodies in bronchus consisting of 8 males and 7 females were also enrolled as control. The ages of them were among 1 to 9 years (5.40 ± 2.27 years). There were no inflammatory changes on chest radiographs and computed tomography of children in control. No symptoms of respiratory infections including coughing, fever and sore throat existed after brochoscopy in control. WBCs and CRPs in sera of the control were in normal ranges. No significant differences in ages (t = 1.76, p>0.05) and sex ratio (x² = 0.15, p>0.05) between the patients and control were observed.

Severe cases consisted of 26 male patients and 27 female ones. The ages of them were 6.91 ± 2.22 years old. Mild cases included 45 patients with 21 boys and 24 girls. The ages of them averaged 6.05 ± 2.73 years old. MP single infections (60 cases) consisted of 25 male patients and 35 female ones. The ages of them were 6.81 ± 2.67 years old. MP mixed infections included 38 patients with 22 boys and 16 girls. The ages of them averaged 6.34 ± 2.38 years old. Low MP DNA loads (1.0 × 10³copies/ml ≤ 50 cases<10⁵copies/ml) consisted of 23 male patients and 27 female ones. The ages of them were 6.92 ± 2.86 years old. High MP DNA loads (48 cases ≥10⁵copies/ml) included 48 patients with 24 boys and 24 girls. The ages of them averaged 5.86 ± 2.67 years old. No significant differences in ages (t = 1.72, p>0.05; t = 0.88, p>0.05;t = 1.89, p>0.05) and sex ratio (x² = 0.06, p>0.05; x² = 2.45, p>0.05; x² = 0.16, p>0.05) were observed between severe cases and mild cases, MP single infections and MP mixed infections as well as low MP DNA loads and high MP DNA loads.

After confirmation by PCR, all the samples from BALFs were quantified by quantitive real-time PCR with MP DNA loads ranging from 2.98 × 10³ copies/ml to 1.47 × 10⁹ copies/ml. (Figs. 1, 2).

IL-6 s in BALFs from severe cases were higher than those from control and mild cases. There were significant differences between them (p < 0.05). IL-6 s in BALFs from mild cases were significantly higher than those from control (p < 0.05) (Fig. 3 A). It suggested that IL-6 s in BALFs were firmly associated with the severity of the disease. By ROC curve analysis (Fig. 4), the cut off value of IL-6 was 63.055 pg/L. The sensitivity and specificity were 98.10 and 85.00%, respectively. IL-27 s in BALFs from severe cases and mild cases were slightly decreased than those from control, but there were no significant differences in IL-27 s among them (p > 0.05). (Table 1) (Fig. 3d).

IL-6 s in BALFs from MP mixed infection group were higher than those from control and MP single infection group. There were significant differences between them (p < 0.05). IL-6 s in BALFs from MP single infection group were significantly higher than those from control (p < 0.05) (Fig. 3b). It suggested that IL-6 s in BALFs were associated with MP mixed infections. IL-27 s in BALFs from MP mixed infection group were significantly lower than those from control and MP single infection group (p < 0.05), which suggested that IL-27 was negatively associated with other pathogens but MP. But no significant differences were found in IL-27 s from BALFs between MP single infection group and control (p > 0.05). (Table 2) (Fig. 3e).

IL-6 s in BALFs from high MP DNA loads group were higher than those from control and low MP DNA loads group. There were significant differences between them (p < 0.05) (Fig. 3c). The levels of IL-6 in BALFs from low MP DNA loads group were also significantly higher than those from control (p < 0.05). There were no significant differences in IL-27 s in BALFs from high MP DNA loads group, low MP DNA loads group and control (p > 0.05). (Table 3) (Fig. 3f).