nach oben

Erschienen in:

Open Access 01.12.2017 | Research

The implementation of long-lasting insecticidal bed nets has differential effects on the genetic structure of the African malaria vectors in the Anopheles gambiae complex in Dielmo, Senegal

verfasst von: Seynabou Sougoufara, Cheikh Sokhna, Nafissatou Diagne, Souleymane Doucouré, Pape MBacké Sembène, Myriam Harry

Erschienen in: Malaria Journal | Ausgabe 1/2017

Abstract

Background

Mosquitoes belonging to the Anopheles gambiae complex are the main vectors of malaria in sub-Saharan Africa. Among these, An. gambiae, Anopheles coluzzii and Anopheles arabiensis are the most efficient vectors and are largely distributed in sympatric locations. However, these species present ecological and behavioural differences that impact their vectorial capacity and complicate vector-control efforts, mainly based on long-lasting insecticidal bed nets (LLINs) and indoor residual spraying (IRS). In this study, the genetic structure of these three species in a Senegalese village (Dielmo) was investigated using microsatellite data in samples collected in 2006 before implementation of LLINs, in 2008, when they were introduced, and in 2010, 2 years after the use of LLINs.

Results

In this study 611 individuals were included, namely 136 An. coluzzii, 101 An. gambiae, 6 An. coluzzii/An. gambiae hybrids and 368 An. arabiensis. According to the species, the effect of the implementation of LLINs in Dielmo is differentiated. Populations of the sister species An. coluzzii and An. gambiae regularly experienced bottleneck events, but without significant inbreeding. The Fst values suggested in 2006 a breakdown of assortative mating resulting in hybrids, but the introduction of LLINs was followed by a decrease in the number of hybrids. This suggests a decrease in mating success of hybrids, ecological maladaptation, or a lesser probability of mating between species due to a decrease in An. coluzzii population size. By contrast, the introduction of LLINs has favoured the sibling species An. arabiensis. In this study, some spatial and temporal structuration between An. arabiensis populations were detected, especially in 2008, and the higher genetic diversity observed could result from a diversifying selection.

Conclusions

This work demonstrates the complexity of the malaria context and shows the need to study the genetic structure of Anopheles populations to evaluate the effectiveness of vector-control tools and successful management of malaria vector control.

Additional file 1: Table S1. Genetic variability for each locus within An. coluzzii and An. gambiae populations, observed heterozygosity (Ho), expected heterozygosity (He), P value in Hardy–Weinberg equilibrium and inbreeding coefficients (Fis). In bold: locus in Hardy–Weinberg disequilibrium. Table S2. Genetic variability for each locus within An. arabiensis populations, observed heterozygosity (Ho), expected heterozygosity (He), P value in Hardy–Weinberg equilibrium and inbreeding coefficients (Fis). In bold: locus in Hardy–Weinberg disequilibrium.

Electronic supplementary material

The online version of this article (doi:10.1186/s12936-017-1992-8) contains supplementary material, which is available to authorized users.

LLINs

long-lasting insecticidal treated bed nets

IRS

indoor residual spraying

HLC

human landing catches

HWE

Hardy–Weinberg equilibrium

IAM

infinite allele model

SMM

stepwise mutation model

Background

Over the last decade, impressive progress has been made in controlling malaria vectors in sub-Saharan Africa mainly using long-lasting insecticidal bed nets (LLINs) and indoor residual spraying (IRS) [1]. Both tools have remarkably contributed to the decrease of malaria prevalence since 2000 [2] in sub-Saharan Africa, where the burden of malaria is heaviest [3]. Three species of the Anopheles gambiae complex, namely Anopheles gambiae, Anopheles coluzzii and Anopheles arabiensis are the primary vectors of malaria in this region [4]. Indeed, these species coexist in sympatry throughout their range and are closely associated with human habitats [5]. The two former species, An. gambiae and An. coluzzii, were previously identified as the two An. gambiae molecular forms, S and M, respectively [6]. Evidence of hybridization or introgression between these species raised questions about their taxonomic status [7‐14]. The recognized sibling species An. arabiensis was never divided into chromosomal forms, although it is widely distributed in the Afrotropical region [15]. Behavioural differences that impact their vectorial capacity as malaria vectors have been recorded between these sibling species. Indeed, An. gambiae and An. coluzzii are highly anthropophilic and endophilic [5].

Anopheles arabiensis displays similar patterns, but presents a competitive advantage of being more zoophilic and exophilic [16]. These phenotypic differences highlight genetic heterogeneities within the An. gambiae complex that could affect the species habitat preference and their adaptive responses against malaria control tools. Several studies have largely reported selective pressure on malaria vectors after the widespread use of vector-control tools using insecticide compounds. The most obvious example is the selection and the emergence of insecticide resistance genes in the main vectors in sub-Saharan Africa [17‐22]. Furthermore, when the LLINs are used, a selective advantage has been reported in Anopheles species that exhibit a tendency to feed outdoors, earlier in the evening, during diurnal hours and on non-human hosts [23‐25]. Indeed, a previous study carried out in Nigeria and based on cytogenetic analyses has reported the presence of chromosomal inversions correlated with the indoor or outdoor biting preferences in the main vectors of the An. gambiae complex [26]. Furthermore, in Burkina Faso, in 2011, an outdoor-resting subgroup of the An. gambiae complex, named “Goundry”, genetically isolated from both the M (An. coluzzii) and S (An. gambiae) forms was found exclusively in peridomestic human habitats [27]. The authors suggest that this outdoor subgroup would be favoured by selective pressure of insecticide-treated bed nets and indoor residual spraying used in the area. Some studies showed the persistence of An. arabiensis following the implementation of insecticide-treated bed nets and its potential involvement in residual malaria transmission [23, 28]. These events could jeopardize the effectiveness of vector-control tools using insecticide compounds due to a non-uniform exposure of vectors to insecticide and worsen malaria transmission. Thus, in the context of scaling up malaria vector-control tools using insecticide-treated bed nets and indoor residual spraying, it is essential to know whether selective pressure affects the genetic structure of the main vectors of the An. gambiae complex relative to their habitat feeding place, a paramount factor in understanding the malaria epidemiology.

Concerning An. gambiae and An. coluzzii, previous investigations on the genetic differentiation of both species have reported divergent findings, even though the geographical scale, the pattern of genomic tools used and the genomic island analysed were not homologous [29‐36]. Genetic differentiation between populations of the sibling species, An. arabiensis was reported according to geographical distance [37, 38]. But, in Tanzania, high levels of differentiation were reported within An. arabiensis sympatric samples [39]. Senegalese populations of the genetic structure of the An. gambiae species complex were investigated only in two An. arabiensis populations collected in Dielmo and Barkedji villages (250 km apart) [40] between which low but significant levels of genetic differentiation were found.

As in other African malaria-endemic regions, Senegal has adopted universal coverage of insecticide-treated bed nets in its strategic national program to accelerate efforts toward malaria pre-elimination. Thus, several studies have reported on the malaria transmission dynamics and the monitoring of entomological parameters on Anopheles vectors [28, 41, 42]. However, no information was available on the impact of insecticide-treated bed nets on the genetic structure of the main vectors of the An. gambiae complex.

This study focuses on the impact of long-lasting insecticidal treated bed nets on the genetic structure of An. coluzzii and An. gambiae species and their sibling species An. arabiensis through a spatiotemporal survey covering 3 years of entomological surveys. The occurrence of putative gene flows or hybridization between An. coluzzii and An. gambiae is also considered. The implication of the control strategy is discussed.

Methods

Study area and mosquito sampling

The study was conducted in Dielmo village (13°45′N, 16°25′W), where a longitudinal survey has been carried out since 1990 to identify all malaria episodes and to investigate the relationship between malaria parasites, human hosts and vectors [43]. The village is located 280 km Southeast of Dakar and about 15 km North of the Gambian border. In Dielmo, the rainy season occurs mostly from June to October. In July 2008, long-lasting insecticide-bed nets (LLINs) were distributed to all villagers. This was followed by a decrease to malaria incidence between August 2008 and August 2010 [44]. However, two episodic resurgences of malaria attacks were noted in adults and children aged up to 10 years old in 2010 and 2013 [44, 45].

In the village, since the establishment of the project, mosquitoes have been captured monthly using human landing catches (HLC) from indoor and outdoor habitations between 7 p.m. and 7 a.m. for three consecutive nights. All anopheline species collected were identified in the field using the morphological identification keys of Gilles and Coetzee [46] and the specimens were individually stored in Eppendorf tubes containing silica gel and then taken for further molecular analysis. In this study, mosquitoes were sampled during the rainy season in September and October 2006 (2 years before LLINs), in July 2008 (date of implementation of LLINs), September 2008 and September and October 2010 (2 years after LLINs were first used).

DNA extraction and species identification

Genomic DNA from each mosquito was extracted using the kit NucleoSpin Tissue XS made by Machery-Nagel. DNA extracts were amplified by polymerase chain reaction (PCR) to discriminate species within the An. gambiae complex (Table 1) using the protocol of Wilkins et al. [47], with intentional mismatch primers recognising single nucleotide polymorphisms (SNPs) at the 3-prime end (IMP-PCR).

Table 1

Sampling and identification of mosquitoes

Protocol of identification	Years	Months	Location of capture	An. coluzzii	An. gambiae	Hybrids	An. arabiensis	Total
A (n = 611)	2006	September	Indoor	21	14	1	7	43
		September	Outdoor	44	4	0	17	65
		October	Indoor	10	6	3	6	25
		October	Outdoor	18	5	0	9	32
		Total		93	29	4 (3.2%)	39	165
	2008	July	Indoor	0	2	0	53	55
		July	Outdoor	1	0	0	82	83
		October	Indoor	14	3	1	35	53
		October	Outdoor	10	2	0	24	36
		Total		25	7	1 (3.03%)	194	227
	2010	September	Indoor	8	20	1	42	71
		September	Outdoor	7	13	0	31	51
		October	Indoor	1	16	0	19	36
		October	Outdoor	2	16	0	43	61
		Total		18	65	1 (1.2%)	135	219
	Total			136	101	6	368	611
B (n = 497)		An coluzzii		109	2	0	1	112 (97.32)
		An. gambiae		4	86	0	0	90 (95.55)
		An. coluzzii/An. gambiae hybrids		5	0	1	0	6 (16.66)
		An. arabiensis		0	1	0	288	289 (99.65)

A. Information on population size for each species identified each year, month and location of collection. The mosquitoes were identified according to Wilkins et al.’s protocol [47] (see “Methods”). B. A subset of individuals was also examined according to Santolamazza et al.’s protocol [49] (the percentage of congruent determination with the Wilkins et al.’s protocol is given in brackets)

In order to have a sufficient sample size for microsatellite analysis, i.e. no less than 15 individuals, some samples were pooled as follows (Table 2): An. coluzzii and An. gambiae samples were analysed according to the location of capture, indoor and outdoor in each year, and if necessary indoor and outdoor samples of each species were pooled per year. Anopheles arabiensis samples were analysed according to the location of capture in each month (July; September; October) except in 2006. The identified hybrids between An. coluzzii and An. gambiae (six individuals) were not included in the general microsatellite analysis in order to avoid bias in gene flow estimation, but were subjected to the assignment test.

Table 2

Sample codes and population sizes of An. coluzzii, An. gambiae and An. arabiensis samples analysed using microsatellites markers

Sample species	Months/year	Location of capture	Sample codes	Sample sizes
An. coluzzii	2006	Indoor	ACIND06	22
	2006	Outdoor	ACOUT06	57
	2008	Indoor and outdoor	AC08	25
	2010	Indoor and outdoor	AC10	15
An. gambiae	2006	Indoor and outdoor	AG06	23
	2010	Indoor	AGIND10	32
	2010	Outdoor	AGOUT10	27
An. arabiensis	Sept 2006	Outdoor	AROUTSEP06	15
	2008
	July	Indoor	ARINDJUL08	44
	July	Outdoor	AROUTJUL08	72
	Sept	Indoor	ARINDSEP08	33
	Sept	Outdoor	AROUTSEP08	22
	2010
	Sept	Indoor	ARINDSEP10	38
	Sept	Outdoor	AROUTSEP10	27
	Oct	Indoor	ARINDOCT10	19
	Oct	Outdoor	AROUTOCT10	39

In the sample codes the two first letters refer to the species name (AC: An. coluzzii; AG: An. gambiae; AR: An. arabiensis), the following three letters to the location of capture (IND: indoor; OUT: outdoor); and the number to the year of sampling (06: 2006; 08: 2008; 10: 2010). If applicable, the following three letters after the species name refer to the location of capture (IND: indoor; OUT: outdoor) and the sampling month (JUL: July; SEP: September; OCT: October) is indicated before the year

Several studies have reported different molecular approaches to identify the An. coluzzii and An. gambiae species. However, Santolomazza et al. [48] reported that these methods are not entirely interchangeable and some differences have been reported among results. For this purpose, to avoid biases that could affect the interpretation of our genetic analyses, a subset of specimens, were randomly sampled and identified according to the polymorphism of nearly 200 bp-long the Short Interspersed Elements (SINE200) in division 6 of the X-chromosome as described by Santolamazza et al. [49].

Microsatellite genotyping

Fourteen microsatellite loci (Table 3) selected from the genetic map of An. gambiae published by Zheng et al. [50] were used for genotyping studies. These markers were located on chromosome 3 to avoid potential bias resulting from selective pressures associated with chromosomal inversions on chromosome 2 [26] and genomic island of divergence regions on the X chromosome [29]. Microsatellite markers were amplified for each specimen by multiplexed PCR using fluorescently labeled (PET, NED, FAM, VIC) forward primer in a final volume of 10 µl containing 5 µl of 2× PCR Master Mix (Applied Biosystems^®), 1 µl of primer mix, 3 µl of RNase free water and 1 µl of genomic DNA. Four primer mixes were constituted according to the annealing temperature (Ta) of markers in a final volume of 400 µl, consisting of 12.5 pmol of each primer. Amplification reactions were performed with an initial denaturation step of 10 min at 94 °C followed by 25–30 cycles of 30 s at 94 °C, 30 s at Ta °C, 30 s at 72 °C, and then an extension step of 5 min at 72 °C. PCR products were mixed with Genescan-500 Liz size standard and deionized formamide (Applied Biosystem). Amplified fragments were separated by capillary electrophoresis in an automatic sequencer (ABI 3130xl Genetic Analyser) and the allele’s size scored using GeneMapper software (Applied Biosystem).

Table 3

Microsatellite markers used in this study, repeated pattern (RP) from Zheng et al. [50] and characteristics (allele size, AS; annealing temperature, Ta)

Marker locus	RP	Sequence primer flanking	AS (bp)	Ta (°C)	An. coluzzii (N = 119)		An. gambiae (N = 82)		An. arabiensis (N = 309)
Marker locus	RP	Sequence primer flanking	AS (bp)	Ta (°C)	Na	A	Na	A	Na	A
H59	(GT)9	5′ CCCCTATTAAACCCTGGACG 3′ 3′ TGTTGTTGCCCTGCGTTACC 5′	123	55	10	6.75 ± 1.71	7	6.00 ± 1.00	13	7.33 ± 1.50
H88	(GT)9	5′TGCGGCGGTAAAGCATCAAC 3′ 3′ CCGGTAACACTGCGCCGAC 5′	176	60	NPA	NPA	NPA	NPA	23	13.44 ± 3.05
H93	(GT)4 + 7	5′ TCCCCAGCTCACCCTTCAAG 3′ 3′ GGTTGCATGTTTGGATAGCG 5′	209	55	19	10.75 ± 3.86	20	12.67 ± 0.58	30	13.00 ± 3.81
H119	(GT)6	5′ GGTTGATGCTGAAGAGTGGG 3′ 3′ ATGCCAGCGGATACGATTCG 5′	174	55	17	12.25 ± 1.26	14	10.67 ± 0.58	10	6.89 ± 1.69
H128	(GT)21	5′ CGGGACGGCTAGATAAAGCG 3′ 3′ CCGGGCGACATAACCCACCC 5′	117	55	25	17.5 ± 3.42	24	16.67 ± 3.22	^b	^b
H242	(GT)8	5′TTCATTTCCACCGCAGCTGC 3′ 3′GGCGACACTCAATCCTTCC 5′	69	58	7	5.50 ± 1.00	7	5.67 ± 0.58	^c	^c
H249	(GT)15	5′ ATGTTCCGCACTTCCGACAC 3′ 3′ GCGAGCTACAACAATGGAGC 5′	129	60	22	13.50 ± 1.73	17	12.33 ± 1.16	27	12.67 ± 2.69
H312	(GT)10	5′ TAAACCATCAACCAGCCACC 3′ 3′ ACTGTGTGCGAGTCGGTTGG 5′	108	58	19	12.75 ± 1.50	16	13.00 ± 0.00	29	15.33 ± 4.79
H555	(GT)8	5′GCAGAGACACTTTCCGAAAC3′ 3′ TGTCAACCCACATTTTGCGC 5′	81	55	17	10.50 ± 3.00	15	9.67 ± 3.06	^b	^b
H577	(GT)16	5′ TTCAGCTTCAGGTTGGTCTC 3′ 3′ GGGTTTTTTGGCTGCGACTG 5′	113	55	13	8.50 ± 2.65	14	10.00 ± 1.00	22	10.78 ± 3.31
H746	(GT)14	5′ TGGGTTCGAAATTCGCCAAC 3′ 3′ GACGTGTGCACCCGTTGTG 5′	105	58	14	11.25 ± 1.26	13	10.67 ± 1.16	29	16.89 ± 2.57
H758	(GT)11	5′ TGATTTGCCAGTTCTGCCAG 3′ 3′ GTGATTGGAGTGGCTAGTGG 5′	105	60	^a	^a	^a	^a	11	5.11 ± 0.93
H812	(GT)10	5′CTGGCCCATTTTGCATATGC 3′ 3′ TGCTCCACCAAACCACATC 5′	131	55	^a	^a	^a	^a	15	10.00 ± 1.58
H817	(GT)8	5′ ACTGGTCCGTTGCTGCGCG 3′ 3′ ATGAGTGAATGGTGCGCTGG 5′	124	58	7	6.00 ± 0.82	6	5.00 ± 1.00	^b	^b
Mean					15.46 ± 5.87	10.48 ± 3.89	13.91 ± 5.59	10.21 ± 3.76	20.90 ± 7.56	11.14 ± 4.14

Parameters of polymorphism for An. gambiae, An. coluzzii and An. arabiensis populations are given: number of observed alleles (Na), mean number of alleles per locus (A), number of specimens used (N)

^aNull alleles in An. gambiae and An. coluzzii; ^b null alleles in An. arabiensis, ^c monomorphic locus, not used in the study, NPA not properly amplified

Data analysis

Microchecker 2.2.3 software developed by Van Oosterhout et al. [51] was initially used to examine possible genotyping errors due to null alleles. Genetic diversity was assessed per locus, per population, by estimating the number of observed alleles (Na), and by the mean number of alleles per locus (A) using Arlequin.3.5.1 [52]. The same software was used to test deviation from Hardy–Weinberg equilibrium (HWE) for each locus in each population and to estimate the observed heterozygosity (Ho) and expected heterozygosity (He). Statistical significance of HWE was assessed by the exact probability test available in Genepop 3.2 software [53] and the same software was used to estimate the inbreeding coefficient (Fis) and the linkage disequilibrium between each pair of loci in each population. A possibly significant heterozygosity excess (the signature of a bottleneck) was tested with the Bottleneck program [54] using two mutational models: an infinite allele model (IAM) and a stepwise mutation model (SMM). The probabilities for the sign tests (ps) for heterozygosity excess and for pw Wilcoxon test (two-tailed for heterozygote excess or deficiency) were calculated. Genetic differentiation between populations was assessed using pairwise estimates Fst values according to Weir and Cockerham, computed using Arlequin software [52]. Additionally, an assignment test implemented in the Geneclass 2 program [54] and developed by Paetkau et al. [55] was used for populations of each species to estimate the likelihood of an individual’s multilocus genotype being assigned to the population in which it has the highest likelihood of belonging, compared to the likelihood of being assigned to other populations. The test was thus used including all the individuals of both An. coluzzii and An. gambiae. This partition was used as a reference to assign hybrids to a most likely An. coluzzii or/and An. gambiae population using the Geneclass 2 program [54].

Results

Species composition

In the study 611 individuals were included, namely 136 An. coluzzii, 101 An. gambiae, 6 An. coluzzii/An. gambiae hybrids (2.5%) and 368 An. arabiensis (Table 1), according to IMP-PCR [47]. Note that the hybrid frequency was stable for 2006 and 2008 (3.2 and 3.03%), and decreased significantly after 2008 (1.2% in 2010). A subset of 497 individuals thus determined was also tested according to SINE200 [49]. The concordance between the species identification methods was 97.32% for An. coluzzii, 95.55% for An. gambiae and 99.65% for An. arabiensis. For the six An. gambiae/An. coluzzii hybrids only one was identified as a hybrid with the second method. Therefore, the species identified according to IMP-PCR which could discriminate more hybrids were analyzed with microsatellite markers. Hybrids individuals were then discarded for the general population genetic studies but not for the assignment test.

Genetic structure of Anopheles populations

Fourteen microsatellites previously defined on An. gambiae were tested (Table 3). Polymorphism parameters for An. gambiae, An. coluzzii and An. arabiensis samples (all pooled populations) are given in Table 3. All microsatellites were polymorphic except H127, which was monomorphic in the three species, and H242 in An. arabiensis. Moreover, the locus H88 failed to amplify properly, particularly in An. coluzzii and An. gambiae individuals, even after optimization of PCR conditions. Thus, these loci were removed from further analyses in the concerned species. Moreover, Microchecker analysis performed on each Anopheles population showed the presence of null alleles at the H812 and H758 loci within An. gambiae and An. coluzzii populations, and H817, H128, and H555 in An. arabiensis populations (Table 3). Therefore, these loci were also discarded. A total of 11 polymorphic loci were analysed in An. gambiae and An. coluzzii populations and 10 in An. arabiensis populations.

For the sister species, the total number of observed alleles (Na) for the polymorphic locus ranged from 7 (H242 and H817) to 25 (H128) for An. coluzzii and 6 (H817) to 24 (H128) for An. gambiae, with a mean of 10.48 and 10.21 alleles per locus respectively (Table 3). The multilocus analysis performed for each population showed a mean of allele per locus (A) varying between 8.00 (AC10) and 12.45 (ACOUT06) in An. coluzzii populations and from 10.09 (AG06) to 10.36 (AGOUT10) in An. gambiae populations (Table 4). The observed heterozygosity ranged from 0.706 (ACIND06) to 0.742 (ACOUT06) in An. coluzzii populations and 0.690 (AGOUT10) to 0.725 (AG06) in An. gambiae populations. Significant heterozygote deficits from the Hardy–Weinberg equilibrium were observed in all populations. Positive Fis values were observed, ranging from 0.073 (ACOUT06) to 0.112 (AC08) in An. coluzzii populations, and 0.106 (AG06) to 0.131 (AGIND10) and 0.146 (AGOUT10) in An. gambiae populations, but were not significant according to the confidence interval (Table 4). The Hardy–Weinberg equilibrium tested in each population for each locus showed 17/44 and 17/33 significant departures from Hardy–Weinberg proportions in equilibrium within population of An. coluzzii and An. gambiae, respectively (Additional file 1: Table S1).

Table 4

Genetic variability for each population of An. coluzzii (AC), An. gambiae (AG), and An. arabiensis with: sample size (N), mean number of alleles for all loci (A), observed heterozygosity (Ho), expected heterozygosity (He), P value in Hardy–Weinberg equilibrium and inbreeding coefficient (Fis) and confidence interval (CI), probability for H excess or deficiency for the sign tests (p_s) with, in brackets, the ratio of the number of loci with heterozygote excess to the number with heterozygote deficiency and for the one-tailed Wilcoxon test for H excess (p_w) for the infinite allele model (IAM) and the stepwise mutation model (SMM)

Populations	N	A ± se	Ho ± se	He ± se	P value ± se	Fis CI 95%	IAM	SMM
ACIND06	22	9.455 ± 3.934	0.706 ± 0.202	0.785 ± 0.135	0.000 ± 0.000	0.102 (−0.004 to 0.160)	p_s = 0.305 (8/3) p _w = 0.027	p_s = 0.036 (3/8) p_w = 0.966
ACOUT06	57	12.455 ± 4.458	0.742 ± 0.113	0.800 ± 0.108	0.000 ± 0.000	0.073 (0.023 to 0.109)	p _s = 0.033 (10/1) p _w = 0.006	p_s = 0.00005 (0/11) p_w = 1.00000
AC08	25	10.909 ± 3.646	0.734 ± 0.105	0.824 ± 0.107	0.000 ± 0.000	0.112 (0.042 to 0.137)	p_s = 0.127 (9/2) p _w = 0.008	p_s = 0.033 (3/8) p_w = 0.949
AC10	15	8.000 ± 2.898	0.739 ± 0.150	0.810 ± 0.140	0.000 ± 0.000	0.090 (−0.017 to 0.106)	p_s = 0.130 (9/2) p _w = 0.034	p_s = 0.116 (4/7) p_w = 0.861
AG06	23	10.091 ± 4.110	0.725 ± 0.164	0.809 ± 0.095	0.000 ± 0.000	0.106 (0.037 to 0.126)	p_s = 0.118 (9/2) p _w = 0.034	p_s = 0.110 (4/7) p_w = 0.949
AGIND10	32	10.182 ± 3.125	0.693 ± 0.136	0.796 ± 0.116	0.000 ± 0.000	0.131 (0.061 to 0.175)	p_s = 0.130 (9/2) p _w = 0.034	p_s = 0.007 (2/9) p_w = 0.995
AGOUT10	27	10.364 ± 4.056	0.690 ± 0.156	0.806 ± 0.103	0.000 ± 0.000	0.146 (0.053 to 0.203)	p _s = 0.031 (10/1) p _w = 0.027	p_s = 0.031 (3/8) p_w = 0.938
AROUTSEP06	15	8.500 ± 3.240	0.560 ± 0.130	0.760 ± 0.137	0.000 ± 0.000	0.270 (0.134 to 0.326)	p_s = 0.361 (5/5) p_w = 0.500	p_s = 0.180 (4/6) p_w = 0.920
ARINDJUL08	44	14.000 ± 5.603	0.738 ± 0.125	0.805 ± 0.086	0.000 ± 0.000	0.085 (0.021 to 0.127)	p_s = 0.613 (6/4) p_w = 0.500	p_s = 0.0001 (0/10) p_w = 1.000
AROUTJUL08	72	14.400 ± 5.696	0.649 ± 0.097	0.749 ± 0.103	0.000 ± 0.000	0.135 (0.090 to 0.165)	p_s = 0.354 (5/5) p_w = 0.754	p_s = 0.00012 (0/10) p_w = 1.000
ARINDSEP08	33	11.800 ± 4.237	0.680 ± 0.091	0.780 ± 0.113	0.000 ± 0.000	0.131 (0.049 to 0.179)	p_s = 0.631 (6/4) p_w = 0.385	p_s = 0.00014 (0/10) p_w = 1.000
AROUTSEP08	22	8.500 ± 3.308	0.643 ± 0.092	0.749 ± 0.133	0.005 ± 0.002	0.145 (0.045 to 0.188)	p_s = 0.366 (7/3) p_w = 0.216	p_s = 0.171 (4/6) p_w = 0.984
ARINDSEP10	38	11.400 ± 4.088	0.619 ± 0.101	0.755 ± 0.114	0.000 ± 0.000	0.181 (0.121 to 0.214)	p_s = 0.362 (5/5) p_w = 0.423	p_s = 0.00015 (0/10) p_w = 1.000
AROUTSEP10	27	10.500 ± 3.923	0.692 ± 0.116	0.766 ± 0.117	0.000 ± 0.000	0.099 (0.020 to 0.138)	p_s = 0.358 (5/5) p_w = 0.461	p_s = 0.002 (1/9) p_w = 0.999
ARINDOCT10	19	9.400 ± 3.134	0.730 ± 0.112	0.756 ± 0.098	0.009 ± 0.003	0.035 (−0.065 to 0.081)	p_s = 0.366 (5/5) p_w = 0.839	p_s = 0.002 (1/9) p_w = 0.999
AROUTOCT10	39	11.700 ± 4.029	0.686 ± 0.06	0766 ± 0.104	0.000 ± 0.000	0.106 (0.046 to 0.135)	p_s = 0.609 (6/4) p_w = 0.423	p_s = 0.00016 (0/10) p_w = 0.991

Those in italic indicate only the significant P value for H excess

Concerning the An. arabiensis species, a higher polymorphism than for the two sister species is shown with a total number of alleles ranging from 10 (H119) to 30 (H93), with a mean value of 20.9 and a mean number of alleles per locus of 11.14 (Table 3). The multilocus study performed for each population showed the minimum mean number of alleles of all loci in AROUTSEP06 and AROUTSEP08 populations (8.50) and the maximum in ARINDJUL08 and AROUTJUL08 (14.000 and 14.400) (Table 4). The mean observed heterozygosis (Ho) in An. arabiensis samples ranged from 0.560 (AROUTSEP06) to 0.738 (ARINDJUL08). All the samples presented a deficit in heterozygotes from the Hardy–Weinberg equilibrium. Positive inbreeding coefficients (Fis) ranged from 0.036 to 0.27 but were not significant according to the confidence interval (Table 4). The Hardy-Weinberg equilibrium tested for each locus showed 40/90 significant departures from Hardy–Weinberg proportions in equilibrium (Additional file 1: Table S2).

Genetic differentiation between populations

Estimates of pairwise Fst values were calculated between populations of each sister species (An. coluzzii, An. gambiae), and between populations of the two species (Table 5). Except for two An. gambiae populations (AGIND10 and AGOUT10), no significant differentiation within An. coluzzii or An. gambiae populations (P > 0.05) was observed, indicating for each species no genetic differentiation between populations sampled indoors and outdoors, and/or in different years, including before (2006), during (2008) and after (2010) the implementation LLINs. However, between An. coluzzii and An. gambiae populations a significant but low level of genetic differentiation is observed for 8 pairwise comparisons out of 12, with Fst values ranging from 0.008 to 0.025. An. coluzzii populations sampled in 2010 and outdoors in 2006 were genetically differentiated from all the An. gambiae populations whatever the year (2006, 2010) or the place of sampling (indoors or outdoors). Moreover, the An. gambiae outdoor population sampled in 2010 (AGOUT10) was also genetically differentiated from all the An. coluzzii population whatever the year or the place of sampling. No genetic differentiation is observed between the An. coluzzii population sampled indoors in 2006 (ACIND06) or in 2008 (AC08) and all the indoor An. gambiae populations, whatever the year (AGIND06, AGIND10).

Table 5

Genetic differentiation between pair of An. coluzzii and An. gambiae samples estimated by Fst values (below diagonal) of 11 loci, Fst P value ± standard error (above diagonal), and values in italic represent significant Fst values at 5%

Populations	ACIND06	ACOUT06	AC08	AC10	AGIND06	AGIND10	AGOUT10
ACIND06	0.000	0.449 ± 0.005	0.426 ± 0.006	0.386 ± 0.005	0.150 ± 0.004	0.081 ± 0.003	0.007 ± 0.001
ACOUT06	0.001	0.000	0.155 ± 0.004	0.161 ± 0.004	0.027 ± 0.002	0.0004 ± 0.0002	0.000 ± 0.000
AC08	0.003	0.004	0.000	0.308 ± 0.005	0.082 ± 0.003	0.091 ± 0.003	0.007 ± 0.001
AC10	0.004	0.006	0.005	0.000	0.013 ± 0.001	0.000 ± 0.000	0.003 ± 0.001
AGIND06	0.007	0.008	0.008	0.016	0.000	0.525 ± 0.006	0.436 ± 0.001
AGIND10	0.008	0.011	0.007	0.025	0.001	0.000	0.05 ± 0.002
AGOUT10	0.016	0.015	0.014	0.021	0.003	0.008	0.000

In An. arabiensis populations seven pairwise comparisons out of 36 led to significant Fst values, ranging from 0.06 to 0.014 (Table 6). Furthermore, no genetic differentiation was observed between populations captured indoors and outdoors in the same month, except populations captured in July 2008 (ARINDJUL08/AROUTJUL08). Nevertheless, significant Fst values are observed between sample populations captured from 1 month to another and from 1 year to another.

Table 6

Genetic differentiation between pairs of An. arabiensis samples estimated by Fst values (below diagonal) of ten loci, Fst P value ± standard error (above diagonal), and values in italic represent significant Fst values at 5%

Populations	AROUTSEP06	ARINDJUL08	AROUTJUL08	ARINDSEP08	AROUTSEP08	ARINDSEP10	AROUTSEP10	ARINTOCT10	AROUTOCT10
AROUTSEP06	0.000	0.273 ± 0.004	0.267 ± 0.005	0.745 ± 0.004	0.794 ± 0.004	0.777 ± 0.004	0.825 ± 0.004	0.634 ± 0.005	0.245 ± 0.004
ARINDJUL08	0.005	0.000	0.008 ± 0.001	0.030 ± 0.002	0.197 ± 0.005	0.0002 ± 0.0001	0.141 ± 0.003	0.295 ± 0.005	0.531 ± 0.006
AROUTJUL08	0.006	0.007	0.000	0.053 ± 0.002	0.480 ± 0.005	0.088 ± 0.003	0.846 ± 0.003	0.509 ± 0.006	0.035 ± 0.002
ARINDSEP08	0.0002	0.007	0.006	0.000	0.883 ± 0.004	0.015 ± 0.001	0.325 ± 0.005	0.379 ± 0.005	0.031 ± 0.002
AROUTSEP08	0	0.005	0.001	−0.003	0.000	0.380 ± 0.005	0.808 ± 0.004	0.791 ± 0.004	0.228 ± 0.004
ARINDSEP10	0	0.014	0.005	0.011	0.004	0.00000	0.949 ± 0.002	0.617 ± 0.005	0.004 ± 0.001
AROUTSEP10	0	0.005	0	0.003	0	0	0.000	0.856 ± 0.004	0.466 ± 0.005
ARINDOCT10	0.002	0.003	0.001	0.003	0	0.001	0	0.000	0.325 ± 0.005
AROUTOCT10	0.007	0.00053	0.006	0.008	0.004	0.012	0.001	0.003	0.000

The analysis of data using Bottleneck software showed that all the populations of An. coluzzii and An. gambiae have significant heterozygote deficit under the IAM model with the Wilcoxon test, while the sign test showed only two populations (ACOUT06 and AGOUT10) exhibiting a putative bottleneck. However, under this model, no significant heterozygote excess was detected for the An. arabiensis populations whatever the test used. Under the SMM model, no significant heterozygote excess was detected in populations whatever the species.

Assignment test

The results of the assignment test using Geneclass 2 revealed that for An. coluzzii populations, less than a quarter of individuals (about 8–13.33%) are classified in their original population, except one population (ACOUT06). For An. gambiae populations, around half of the individuals were assigned to their original population except AG06 (21.74%) (Table 7). However, when all samples of An. coluzzii are pooled, 75.63% of individuals are correctly assigned to An. coluzzii, and a similar percentage is observed for An. gambiae (73.17%). The assignment test in hybrids showed that four individuals were highly assigned to An. coluzzii (percentage assignment >95%) while two were highly assigned to An. gambiae (Table 9). For An. arabiensis populations, 7.4–22% of individuals are assigned to their original population (Table 8).

Table 7

The proportion of correct assignment of individuals performed with Geneclass 2 in An. coluzzii and An. gambiae samples

	ACIND06	ACOUT06	AC08	AC10	AG06	AGIND10	AGOUT10
ACIND06	9.09	21.05	16	20	17.39	15.63	0
ACOUT06	22.73	36.84	24	20	13.04	6.25	0
AC08	18.18	7.02	8	26.67	0	6.25	7.40
AC10	13.64	10.53	20	13.33	4.35	0	7.40
AG06	18.18	14.04	12	6.67	21.74	9.38	18.52
AGIND10	13.64	10.53	12	0	26.09	40.63	22.22
AGOUT10	4.55	0	8	13.33	17.39	21.88	44.44
Total	22	57	25	15	23	32	27

Table 8

The proportion of correct assignment of individuals performed with Geneclass 2 in An. arabiensis samples

	AROUT SEP06	ARIND JUL08	AROUT JUL08	ARIND SEP08	AROUT SEP08	ARIND SEP10	AROUT SEP10	ARIND OCT10	AROUT OCT10
AROUTSEP06	13.33	13.64	5.56	9.09	13.64	7.89	11.11	10.53	0
ARINDJUL08	13.33	20.45	13.89	6.06	0	2.63	7.40	0	10.26
AROUTJUL08	6.67	9.09	22.22	18.18	13.64	15.79	3.70	10.53	2.56
ARINDSEP08	13.33	4.55	12.5	18.18	27.27	2.63	0	5.26	7.69
AROUTSEP08	6.67	15.91	11.11	15.15	13.64	7.89	22.22	26.32	15.39
ARINDSEP10	20	4.55	15.28	9.09	9.09	21.05	22.22	10.53	12.82
AROUTSEP10	13.33	4.55	9.72	6.06	18.18	13.16	7.40	10.53	12.82
ARINDOCT10	6.67	6.82	11.11	6.06	4.55	15.79	14.81	10.53	23.07
AROUTOCT10	6.67	20.45	11.11	12.12	0	13.16	11.11	15.79	15.38
Total	15	44	72	33	22	38	27	19	39

Table 9

The proportion of correct assignment of individuals performed with Geneclass 2 in all samples of An. coluzzii, An. gambiae and hybrids

	An. coluzzii	An. gambiae
An. coluzzii	75.63 (90)	26.83 (22)
An. gambiae	24.37 (29)	73.17 (60)
Hybrids	66.67 (4)	33.33 (2)
Total	123	84
Hybrid individuals	An. coluzzii	An. gambiae
HYBINDOCT06	99.795	0.205
HYBINDOCT06	0.118	99.882
HYBINDOCT06	100.000	0.000
HYBINDSEP06	96.176	3.824
HYBINDSEP08	99.919	0.081
HYBINDSEP10	6.292	93.708

The total number of the individuals tested is indicated in brackets. Details for hybrids assigned in An. coluzzii and An. gambiae populations are given in the table

Discussion

The three major vectors of An. gambiae complex, An. coluzzii, An. gambiae and An. arabiensis, have an overlapping distribution in Dielmo as described in many parts of West Africa [5]. The aim of the present study was to elucidate whether implementation of LLINs in Dielmo has an impact on the genetic structure of these populations. Using microsatellite markers, the genetic structure of mosquito populations was analysed before (2006), during (2008) and after (2010) the implementation of LLINs in Dielmo. These microsatellites mapped throughout the chromosome 3 have been chosen to avoid confounding patterns of genetic structure associated to linked-markers on polymorphic inversions on chromosome 2 and putative genes of reproductive isolation on the X chromosome [26, 29]. The results of An. coluzzii and An. gambiae populations should be interpreted with caution due to the low population size of samples compared with those of An. arabiensis, and the resulting pooling of some samples. However, the observed heterozygosity is quite similar whatever the year and the species with significant deficits in heterozygotes in all populations. Various factors could explain the observed heterozygote deficit compared to the expected heterozygosity under HWE. A Wahlund effect due to sample bias cannot be discarded for some pooled samples, but genetic drift due to repetitive reduction in population size resulting from bottlenecks is likely, since all the An. coluzzii and An. gambiae populations exhibit heterozygote excess under the IAM model using the Wilcoxon test with Bottleneck software. This is congruent with entomological data from a previous study showing that after the implementation of LLINs in Dielmo, the relative abundance of Anopheles populations fluctuated substantially in our study area, with a dramatic decrease of An. coluzzii and An. gambiae, while An. arabiensis increased and remained the prevalent species [28]. However, no significant inbreeding is noticed (F_IS values), so at each generation, gene flow would be sufficient to prevent inbreeding. Between pairs of populations within each species no significant genetic structuration (F_ST values) was observed except the two An. gambiae populations sampled indoors and outdoors in 2010 after the implementation of LLINs in Dielmo. Between the sister species, the lack of genetic differentiation between some populations reveals the occurrence of a gene flow. Because the results of the assignation test using neutral markers fails to shown a clear pattern of hybridization (for hybrids, the assignation is not equal for the two species), results are in favour of introgressed individuals, with backcrossing of hybrids with parental species. The asymmetrical situation is observed with a higher proportion of hybrids assigned to An. coluzzii, in favour of the introgression of the genome of An. coluzzii by An. gambiae, except for the only one hybrid in 2010. From a methodological point of view, it should be noted that the IMP-PCR and SINE200 methods are quite equivalent for the species identification but the IMP-PCR method seems more acute to detect hybrids.

Previous studies in West and Central African countries where An. coluzzii and An. gambiae are frequently sympatric reported a strong deficit of hybrids in nature that was below 1%, resulting in reproductive isolation between both species [56, 57]. However, hybrids rates ranged from 7% in Gambia [57] and over 20% in Guinea Bissau [7, 8, 36, 58]. In the study, the figure of 2.5% of hybrids is in agreement with a previous study performed in Senegal [42]. In Guinea Bissau high genetic divergence was found between An. coluzzii and An. gambiae (Fst value = 0.348), but 60% of field-collected hybrids were backcrossed [8]. Indeed, Lee et al. [11] reported that the assortative mating between An. coluzzii and An. gambiae periodically breaks down, explaining high levels of hybridization in various sites in West Africa lying outside coastal areas (5.2–96.9%). Additionally in the laboratory, Diabaté et al. [59] found that F1 hybrids are fully fertile and viable.

In Benin, the occurrence of the Kdr mutation in An. coluzzii populations was attributed to an introgression process involving An. gambiae, which already presented the kdr mutation [60]. In Mali Norris et al. [14] showed before the implementation of ITNs and IRS, a breakdown of assortative mating resulting in high levels of hybrids in 2006 and the introgression of the Kdr mutation in An. coluzzii populations. This led to an increase in the frequency of selectively advantaged backcrossed individuals after the widespread introduction of ITNs. In our study, between An. coluzzii and An. gambiae populations, significant gene flow was found in 2006 and 2008, but for 2010, all the Fst values were significant. Thus, as for Mali populations, there was a breakdown of assortative mating resulting in hybrids in the same year 2006, but the introduction of LLINs had a negative impact on hybridization frequency, which is corroborated by the decrease in the number of hybrids observed in the data after 2008. This study suggests decreased mating success of hybrids or ecological maladaptation, but also a lesser probability of mating between species due to a decrease in An. coluzzii population size. The lack of An. coluzzii could explain the occurrence in 2010 of a unique hybrid assigned to An. gambiae, probably resulting from hybrid backcrossing with the most populous species, An. gambiae. Then, the genetic divergence could be maintained between the two species despite gene flow, which is consistent the speciation-with-gene flow model as proposed by Turner et al. [29].

Regarding the sibling species An. arabiensis, results suggested some spatial and temporal structuration between populations, especially in 2008, of the seven significant F_ST pairwise comparisons, six involved in 2008 collected populations. If An. arabiensis, the most widespread member of the An. gambiae complex was described generally to be genetically less structured compared to the sibling species An. coluzzii and An. gambiae populations, some studies demonstrated genetic distinct subpopulations [37, 39]. The level of genetic differentiation in An. arabiensis populations varies significantly according to geographical distance, as demonstrated in Senegalese and Indian Ocean island populations [40] or in Sudanese to Mozambican populations [61], but also on a local scale in a village in Tanzania due to ecological diversification [39]. Polymorphic inversions were found at differential frequencies in West Africa than in East Africa Anopheles populations [62, 63] and between outdoor and indoor populations [26]. Inversions were involved in local adaptation, with the selection of co-adapted genes affecting behaviour activities [64, 65]. Marsden et al. [66] suggested that chromosomal inversions contribute to population structure in An. arabiensis. This species, although generally considered to be a less efficient vector, was a major malaria vector in Dielmo due to its high human biting rates [67]. This species presents behaviour plasticity according its feeding activities, resting places and also to its great tendency to survive during the dry season [68]. After the implementation of LLINs in 2008 to Dielmo, a reconfiguration of vector abundance was noted, a large decrease in population size was observed in An. coluzzii and An. gambiae, but an expansion of An. arabiensis [28]. The lack of bottleneck effects nor significant inbreeding in populations are in adequacy with large population size. A higher genetic diversity was observed in July 2008 compared with 2006 for both indoor and outdoor populations. This could result from the migration of individuals coming from genetically divergent populations. Indeed, an entomological study conducted in villages around the Dielmo area showed that most of the Anopheles populations in these areas belong to An. arabiensis [69]. The higher genetic diversity coincides with the date of LLIN implementation. A diversifying selection could be envisaged, favouring individuals with genotypes diverging from the mean genotype of the population. Various scenarios could be proposed, such as the occurrence of various resistance genes conferring individual advantage and then their selection, while non-resistant individuals were eliminated. The selection of individuals with divergent behaviour in biting activities could be envisaged, since it was demonstrated in Dielmo for another vector, Anopheles funestus, where a shift to diurnal feeding, essentially after the introduction of LLINs, was observed. This highlights the need to explore the evolution of the genetic basis of behavioural traits in Anopheles populations in the context of vector control of malaria transmission.

Conclusions

Several studies in Africa carried out after the implementation of interventions strategies have focused on the survival, the status of insecticide resistance and behavioural biting changes of Anopheles and on vector composition. However, little information is available about the genetic structure of the main malaria vectors of the An. gambiae complex involved in Senegal, which is particularly worrying in the context of high coverage of insecticide-treated bed nets in the malaria control programme. In this study, the potential effects of the implementation of LLINs on the genetic structure of An. gambiae, An. coluzzii and An. arabiensis were demonstrated. According to the species, the effect after the implementation of LLINs in Dielmo is differentiated. The sister species An. coluzzii and An. gambiae populations regularly experienced bottleneck, but without significant inbreeding. Since a breakdown of assortative mating resulted in hybrids, the introduction of ITNs had a negative impact on hybridization frequency. As pointed by Marsden et al. [8] the occurrence of a various level of hybrids across West Africa probably results from a “geographic mosaic of reproductive isolation” but this phenomenon could have considerable implications for transgenic control strategies.

Regarding the sibling species An. arabiensis, the study suggested some spatial and temporal structuration between populations, especially in 2008, coinciding with the date of LLINs implementation, which could result from diversifying selection favouring the expansion of this species. Taking into account that vector control is the cornerstone for reducing the burden of malaria disease and that current tools are mainly based on insecticide-treated bed nets, multidisciplinary studies combining epidemiology, ecology, and population genetics are needed to define successful management of malaria vector control.

Authors’ contributions

The study was designed by SS, PMS, CS, MH. SS performed the experiments. SS, MH analysed the data. SS and MH drafted the manuscript. SD, CS, ND, PMS contributed to data interpretation and manuscript draft. All authors read and approved the final manuscript.

Acknowledgements

The authors are grateful to all the Dielmo populations and to Charles Bouganali for his technical assistance. We thank also Semantech Communications for the review of English text.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

Data are achieved and available on request from the corresponding author.

Funding

This publication was made possible through financial support provided by the IDR-DPF (Institut de Recherche pour le Développement-Direction des Programmes de Recherche et de la Formation au Sud).

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Additional file

Barnes KG, Irving H, Chiumia M, Mzilahowa T, Coleman M, Hemingway J, et al. Restriction to gene flow is associated with changes in the molecular basis of pyrethroid resistance in the malaria vector Anopheles funestus. Proc Natl Acad Sci USA. 2017;114:286–91.CrossRefPubMed

Bhatt S, Weiss DJ, Mappin B, Dalrymple U, Cameron E, Bisanzio D, et al. Coverage and system efficiencies of insecticide-treated nets in Africa from 2000 to 2017. eLife. 2015. doi:10.7554/eLife.09672.PubMedPubMedCentral

WHO. World malaria report 2016. Geneva: World Health Organization; 2016 http://apps.who.int/iris/bitstream/10665/252038/1/9789241511711-eng.pdf?ua=1. Accessed 15 Feb 2017.

Sinka ME, Bangs MJ, Manguin S, Rubio-Palis Y, Chareonviriyaphap T, Coetzee M, et al. A global map of dominant malaria vectors. Parasites Vectors. 2012;5:69.CrossRefPubMedPubMedCentral

Fontaine MC, Pease JB, Steele A, Waterhouse RM, Neafsey DE, Sharakhov IV, et al. Extensive introgression in a malaria vector species complex revealed by phylogenomics. Science. 2015;347:1258524.CrossRefPubMed

Coetzee M, Hunt RH, Wilkerson R, Della Torre A, Coulibaly MB, Besansky NJ. Anopheles coluzzii and Anopheles amharicus, new members of the Anopheles gambiae complex. Zootaxa. 2013;3619:246–74.CrossRefPubMed

Oliveira E, Salgueiro P, Palsson K, Vicente JL, Arez AP, Jaenson TG, et al. High levels of hybridization between molecular forms of Anopheles gambiae from Guinea Bissau. J Med Entomol. 2008;45:1057–63.CrossRefPubMed

Marsden CD, Lee Y, Nieman CC, Sanford MR, Dinis J, Martins C, et al. Asymmetric introgression between the M and S forms of the malaria vector, Anopheles gambiae, maintains divergence despite extensive hybridization. Mol Ecol. 2011;20:4983–94.CrossRefPubMedPubMedCentral

Nwakanma DC, Neafsey DE, Jawara M, Adiamoh M, Lund E, Rodrigues A, et al. Breakdown in the process of incipient speciation in Anopheles gambiae. Genetics. 2013;193:1221–31.CrossRefPubMedPubMedCentral

10.

Mancini E, Spinaci MI, Gordicho V, Caputo B, Pombi M, Vicente JL, et al. Adaptive potential of hybridization among malaria vectors: introgression at the immune locus TEP1 between Anopheles coluzzii and A. gambiae in “Far-West” Africa. PLoS ONE. 2015;10:e0127804.CrossRefPubMedPubMedCentral

11.

Lee Y, Marsden CD, Norris LC, Collier TC, Main BJ, Fofana A, et al. Spatiotemporal dynamics of gene flow and hybrid fitness between the M and S forms of the malaria mosquito, Anopheles gambiae. Proc Natl Acad Sci USA. 2013;110:19854–9.CrossRefPubMedPubMedCentral

12.

Lee Y, Marsden CD, Nieman C, Lanzaro GC. A new multiplex SNP genotyping assay for detecting hybridization and introgression between the M and S molecular forms of Anopheles gambiae. Mol Ecol Resour. 2014;14:297–305.CrossRefPubMed

13.

Clarkson CS, Weetman D, Essandoh J, Yawson AE, Maslen G, Manske M, et al. Adaptive introgression between Anopheles sibling species eliminates a major genomic island but not reproductive isolation. Nat Commun. 2014;5:5248.CrossRef

14.

Norris LC, Main BJ, Lee Y, Collier TC, Fofana A, Cornel AJ, et al. Adaptive introgression in an African malaria mosquito coincident with the increased usage of insecticide-treated bed nets. Proc Natl Acad Sci USA. 2015;112:815–20.CrossRefPubMedPubMedCentral

15.

Drake JM, Beier JC. Ecological niche and potential distribution of Anopheles arabiensis in Africa in 2050. Malar J. 2014;13:213.CrossRefPubMedPubMedCentral

16.

Oliver SV, Brooke BD. The role of oxidative stress in the longevity and insecticide resistance phenotype of the major malaria vectors Anopheles arabiensis and Anopheles funestus. PLoS ONE. 2016;11:e0151049.CrossRefPubMedPubMedCentral

17.

Sougoufara S, Doucouré S, Backé Sembéne PM, Harry M, Sokhna C. Challenges for malaria vector control in sub-Saharan Africa: resistance and behavioral adaptations in Anopheles populations. J Vector Borne Dis. 2017;54:4–15.PubMed

18.

Hemingway J, Ranson H, Magill A, Kolaczinski J, Fornadel C, Gimnig J, et al. Averting a malaria disaster: will insecticide resistance derail malaria control? Lancet. 2016;387:1785–8.CrossRefPubMed

19.

Ranson H, Lissenden N. Insecticide resistance in African Anopheles mosquitoes: a worsening situation that needs urgent action to maintain malaria control. Trends Parasitol. 2016;32:187–96. doi:10.1016/j.pt.2015.11.010.CrossRefPubMed

20.

Wiebe A, Longbottom J, Gleave K, Shearer FM, Sinka ME, Massey NC, et al. Geographical distributions of African malaria vector sibling species and evidence for insecticide resistance. Malar J. 2017. doi:10.1186/s12936-017-1734-y.

21.

Chabi J, Baidoo PK, Datsomor AK, Okyere D, Ablorde A, Iddrisu A, et al. Insecticide susceptibility of natural populations of Anopheles coluzzii and Anopheles gambiae (sensu stricto) from Okyereko irrigation site, Ghana, West Africa. Parasites Vectors. 2016. doi:10.1186/s13071-016-1462-0.PubMedPubMedCentral

22.

Okorie PN, Ademowo GO, Irving H, Kelly-Hope LA, Wondji CS. Insecticide susceptibility of Anopheles coluzzii and Anopheles gambiae mosquitoes in Ibadan, South-West Nigeria. Med Vet Entomol. 2015;29:44–50.CrossRefPubMed

23.

Russell TL, Govella NJ, Azizi S, Drakeley CJ, Kachur SP, Killeen GF. Increased proportions of outdoor feeding among residual malaria vector populations following increased use of insecticide-treated nets in rural Tanzania. Malar J. 2011;10:80.CrossRefPubMedPubMedCentral

24.

Sougoufara S, Diédhiou SM, Doucouré S, Diagne N, Sembène PM, Harry M, et al. Biting by Anopheles funestus in broad daylight after use of long-lasting insecticidal nets: a new challenge to malaria elimination. Malar J. 2014;13:125.CrossRefPubMedPubMedCentral

25.

Mayagaya VS, Nkwengulila G, Lyimo IN, Kihonda J, Mtambala H, Ngonyani H, et al. The impact of livestock on the abundance, resting behaviour and sporozoite rate of malaria vectors in southern Tanzania. Malar J. 2015;14:17.CrossRefPubMedPubMedCentral

26.

Coluzzi M, Sabatini A, Petrarca V, Di Deco MA. Chromosomal differentiation and adaptation to human environments in the Anopheles gambiae complex. Trans R Soc Trop Med Hyg. 1979;73:483–97.CrossRefPubMed

27.

Riehle MM, Guelbeogo WM, Gneme A, Eiglmeier K, Holm I, Bischoff E, et al. A cryptic subgroup of Anopheles gambiae is highly susceptible to human malaria parasites. Science. 2011;331:596–8.CrossRefPubMedPubMedCentral

28.

Sougoufara S, Harry M, Doucouré S, Sembène PM, Sokhna C. Shift in species composition in the Anopheles gambiae complex after implementation of long-lasting insecticidal nets in Dielmo, Senegal. Med Vet Entomol. 2016;30:365–8.CrossRefPubMed

29.

Turner TL, Hahn MW, Nuzhdin SV. Genomic islands of speciation in Anopheles gambiae. PLoS Biol. 2005;3:e0030285.CrossRef

30.

Neafsey DE, Lawniczak MKN, Park DJ, Redmond SN, Coulibaly MB, Traoré SF, et al. SNP genotyping defines complex gene-flow boundaries among African malaria vector mosquitoes. Science. 2010;330:514–7.CrossRefPubMedPubMedCentral

31.

Lawniczak MKN, Emrich S, Holloway AK, Regier AP, Olson M, White B, et al. Widespread divergence between incipient Anopheles gambiae species revealed by whole genome sequences. Science. 2010;330:512–4.CrossRefPubMedPubMedCentral

32.

Reidenbach KR, Neafsey DE, Costantini C, Sagnon N, Simard F, Ragland GJ, et al. Patterns of genomic differentiation between ecologically differentiated M and S forms of Anopheles gambiae in West and Central Africa. Genome Biol Evol. 2012;4:1202–12.CrossRefPubMedPubMedCentral

33.

Maliti DV, Marsden CD, Main BJ, Govella NJ, Yamasaki Y, Collier TC, et al. Investigating associations between biting time in the malaria vector Anopheles arabiensis Patton and single nucleotide polymorphisms in circadian clock genes: support for sub-structure among An. arabiensis in the Kilombero valley of Tanzania. Parasites Vectors. 2016;9:109.CrossRefPubMedPubMedCentral

34.

Caputo B, Nwakanma D, Caputo FP, Jawara M, Oriero EC, Hamid-Adiamoh M, et al. Prominent intraspecific genetic divergence within Anopheles gambiae sibling species triggered by habitat discontinuities across a riverine landscape. Mol Ecol. 2014;23:4574–89.CrossRefPubMed

35.

Pinto J, Egyir-Yawson A, Vicente J, Gomes B, Santolamazza F, Moreno M, et al. Geographic population structure of the African malaria vector Anopheles gambiae suggests a role for the forest-savannah biome transition as a barrier to gene flow. Evol Appl. 2013;6:910–24.CrossRefPubMedPubMedCentral

36.

Weetman D, Wilding CS, Steen K, Pinto J, Donnelly MJ. Gene flow-dependent genomic divergence between Anopheles gambiae M and S forms. Mol Biol Evol. 2012;29:279–91.CrossRefPubMed

37.

Kamau L, Munyekenye GO, Vulule JM, Lehmann T. Evaluating genetic differentiation of Anopheles arabiensis in relation to larval habitats in Kenya. Infect Genet Evol. 2007;7:293–7.CrossRefPubMed

38.

Nyanjom SRG, Chen H, Gebre-Michael T, Bekele E, Shililu J, Githure J, et al. Population genetic structure of Anopheles arabiensis mosquitoes in Ethiopia and Eritrea. J Hered. 2003;94:457–63.CrossRefPubMed

39.

Ng’habi KR, Knols BG, Lee Y, Ferguson HM, Lanzaro GC. Population genetic structure of Anopheles arabiensis and Anopheles gambiae in a malaria endemic region of southern Tanzania. Malar J. 2011;10:289.CrossRefPubMedPubMedCentral

40.

Simard F, Fontenille D, Lehmann T, Girod R, Brutus L, Gopaul R, et al. High amounts of genetic differentiation between populations of the malaria vector Anopheles arabiensis from West Africa and eastern outer islands. Am J Trop Med Hyg. 1999;60:1000–9.CrossRefPubMed

41.

Trape J-F, Tall A, Sokhna C, Ly AB, Diagne N, Ndiath O, et al. The rise and fall of malaria in a west African rural community, Dielmo, Senegal, from 1990 to 2012: a 22 year longitudinal study. Lancet Infect Dis. 2014;14:476–88.CrossRefPubMed

42.

Niang EHA, Konaté L, Diallo M, Faye O, Dia I. Reproductive isolation among sympatric molecular forms of An. gambiae from inland areas of south-eastern Senegal. PLoS ONE. 2014;9:e104622.CrossRefPubMedCentral

43.

Trape JF, Rogier C, Konate L, Diagne N, Bouganali H, Canque B, et al. The Dielmo project: a longitudinal study of natural malaria infection and the mechanisms of protective immunity in a community living in a holoendemic area of Senegal. Am J Trop Med Hyg. 1994;51:123–37.CrossRefPubMed

44.

Trape J-F, Tall A, Diagne N, Ndiath O, Ly AB, Faye J, et al. Malaria morbidity and pyrethroid resistance after the introduction of insecticide-treated bednets and artemisinin-based combination therapies: a longitudinal study. Lancet Infect Dis. 2011;11:925–32.CrossRefPubMed

45.

Wotodjo AN, Diagne N, Gaudart J, Richard V, Raoult D, Sokhna C. Malaria risk factors in Dielmo, a Senegalese malaria-endemic village, Between October and November of 2013: a case–control study. Am J Trop Med Hyg. 2015;92:565–8.CrossRefPubMedPubMedCentral

46.

Gillies MT, De Meillon B. The anophelinae of Africa south of the Sahara (Ethiopian zoogeographical region). 1968.

47.

Wilkins EE, Howell PI, Benedict MQ. IMP PCR primers detect single nucleotide polymorphisms for Anopheles gambiae species identification, Mopti and Savanna rDNA types, and resistance to dieldrin in Anopheles arabiensis. Malar J. 2006;5:125.CrossRefPubMedPubMedCentral

48.

Santolamazza F, Caputo B, Calzetta M, Vicente JL, Mancini E, Petrarca V, et al. Comparative analyses reveal discrepancies among results of commonly used methods for Anopheles gambiae molecular form identification. Malar J. 2011;10:215.CrossRefPubMedPubMedCentral

49.

Santolamazza F, Mancini E, Simard F, Qi Y, Tu Z, della Torre A. Insertion polymorphisms of SINE200 retrotransposons within speciation islands of Anopheles gambiae molecular forms. Malar J. 2008;7:163.CrossRefPubMedPubMedCentral

50.

Zheng L, Benedict MQ, Cornel AJ, Collins FH, Kafatos FC. An integrated genetic map of the african human malaria vector mosquito, Anopheles gambiae. Genetics. 1996;143:941–52.PubMedPubMedCentral

51.

Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes. 2004;4:535–8.CrossRef

52.

Excoffier L, Laval G, Schneider S. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evol Bioinform Online. 2005;1:47–50.

53.

Raymond M, Rousset F. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered. 1995;86:248–9.CrossRef

54.

Piry S, Alapetite A, Cornuet J-M, Paetkau D, Baudouin L, Estoup A. GENECLASS2: a software for genetic assignment and first-generation migrant detection. J Hered. 2004;95:536–9.CrossRefPubMed

55.

Paetkau D, Calvert W, Stirling I, Strobeck C. Microsatellite analysis of population structure in Canadian polar bears. Mol Ecol. 1995;4:347–54.CrossRefPubMed

56.

Della Torre A, Tu Z, Petrarca V. On the distribution and genetic differentiation of Anopheles gambiae s.s. molecular forms. Insect Biochem Mol Biol. 2005;35:755–69.CrossRefPubMed

57.

Wondji C, Frédéric S, Petrarca V, Etang J, Santolamazza F, Della TA, Fontenille D. Species and populations of the Anopheles gambiae complex in Cameroon with special emphasis on chromosomal and molecular forms of Anopheles gambiae s.s. J Med Entomol. 2005;42:998–1005.CrossRef

58.

Caputo B, Nwakanma D, Jawara M, Adiamoh M, Dia I, Konate L, et al. Anopheles gambiae complex along The Gambia river, with particular reference to the molecular forms of An. gambiae s.s. Malar J. 2008;7:182.CrossRefPubMedPubMedCentral

59.

Diabaté A, Dabire RK, Millogo N, Lehmann T. Evaluating the effect of postmating isolation between molecular forms of Anopheles gambiae (Diptera: Culicidae). J Med Entomol. 2007;44:60–4.CrossRefPubMed

60.

Weill M, Chandre F, Brengues C, Manguin S, Akogbeto M, Pasteur N, et al. The kdr mutation occurs in the Anopheles gambiae s.s. through introgression. Insect Mol Biol. 2000;9:451–5.CrossRefPubMed

61.

Donnelly MJ, Townson H. Evidence for extensive genetic differentiation among populations of the malaria vector Anopheles arabiensis in Eastern Africa. Insect Mol Biol. 2000;9:357–67.CrossRefPubMed

62.

Petrarca V, Nugud AD, Ahmed MA, Haridi AM, Di Deco MA, Coluzzi M. Cytogenetics of the Anopheles gambiae complex in Sudan, with special reference to An. arabiensis: relationships with East and West African populations. Med Vet Entomol. 2000;14:149–64.CrossRefPubMed

63.

Ayala FJ, Coluzzi M. Chromosome speciation: humans, Drosophila, and mosquitoes. Proc Natl Acad Sci. 2005;102(suppl 1):6535–42.CrossRefPubMedPubMedCentral

64.

Ayala D, Guerrero RF, Kirkpatrick M. Reproductive isolation and local adaptation quantified for a chromosome inversion in a malaria mosquito. Evol Int J Org Evol. 2013;67:946–58.CrossRef

65.

Ayala D, Ullastres A, González J. Adaptation through chromosomal inversions in Anopheles. Front Genet. 2014;5:129. doi:10.3389/fgene.2014.00129.CrossRefPubMedPubMedCentral

66.

Marsden CD, Lee Y, Kreppel K, Weakley A, Cornel A, Ferguson HM, et al. Diversity, differentiation, and linkage disequilibrium: prospects for association mapping in the malaria vector Anopheles arabiensis. G3. 2014;4:121–31.CrossRefPubMed

67.

Fontenille D, Cohuet A, Awono-Ambene PH, Antonio-Nkondjio C, Wondji C, Kengne P, et al. Systematics and biology of Anopheles vectors of Plasmodium in Africa, recent data. Méd Trop. 2003;63:247–53 (in French).

68.

Mathanga DP, Mwandama DA, Bauleni A, Chisaka J, Shah MP, Landman KZ, et al. The effectiveness of long-lasting, insecticide-treated nets in a setting of pyrethroid resistance: a case–control study among febrile children 6 to 59 months of age in Machinga District, Malawi. Malar J. 2015;14:457.CrossRefPubMedPubMedCentral

69.

Niang EHA, Touré A, Ngom EHM, Konaté L, Faye O, Diallo M, et al. Malaria transmission pattern in an area selected for clinical trials in the Sudanian Area of Senegal (West Africa). J Trop Med. 2013;2013. doi:10.1155/2013/907375.

Titel: The implementation of long-lasting insecticidal bed nets has differential effects on the genetic structure of the African malaria vectors in the Anopheles gambiae complex in Dielmo, Senegal
verfasst von: Seynabou Sougoufara
Cheikh Sokhna
Nafissatou Diagne
Souleymane Doucouré
Pape MBacké Sembène
Myriam Harry
Publikationsdatum: 01.12.2017
Verlag: BioMed Central
Erschienen in: Malaria Journal / Ausgabe 1/2017
Elektronische ISSN: 1475-2875
DOI: https://doi.org/10.1186/s12936-017-1992-8

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

^{Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag}

Kostenlos registrieren

Neu im Fachgebiet Innere Medizin

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

25.04.2024 Allergien und Intoleranzreaktionen Nachrichten

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.

Newsletter bestellen

Springer Medizin

Abstract

Background

Results

Conclusions

Electronic supplementary material

Background

Methods

Study area and mosquito sampling

DNA extraction and species identification

Microsatellite genotyping

Data analysis

Results

Species composition

Genetic structure of Anopheles populations

Genetic differentiation between populations

Assignment test

Discussion

Conclusions

Authors’ contributions

Acknowledgements

Competing interests

Availability of data and materials

Funding

Publisher’s Note

Additional file

Weitere Artikel der Ausgabe 1/2017

The malaria testing and treatment landscape in the southern Lao People’s Democratic Republic (PDR)

A metabolomic analytical approach permits identification of urinary biomarkers for Plasmodium falciparum infection: a case–control study

Erratum to: New developments in anti-malarial target candidate and product profiles

Knowledge and perception towards net care and repair practice in Ethiopia

The influence of age on insecticide susceptibility of Anopheles arabiensis during dry and rainy seasons in rice irrigation schemes of Northern Tanzania

Dynamics of Plasmodium vivax sporogony in wild Anopheles stephensi in a malaria-endemic region of Western India

Leitlinien kompakt für die Innere Medizin

Neu im Fachgebiet Innere Medizin

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

Update Innere Medizin