Background
Migraine is a genetic disorder that affects more than 10% of the world’s population and is the third leading cause of disability for 15–49 year old women [
1]. It is characterized by moderate to severe headache lasting up to 72 h often accompanied by nausea, photophobia, phonophobia and vomiting. The International Classification for Headache Disorders 3 (ICHD-3), from the International Headache Society, classifies migraine into two main subtypes: migraine without aura (MO) and migraine with aura (MA). MA has additional neurological symptoms preceding the headache including visual disturbances and sensory function impairment [
2].
Epidemiological studies have shown that after puberty a distinct sex bias in migraine prevalence occurs and females are three times more likely to be affected by this disorder than males [
3,
4]. It is reported that females have longer lasting and more severe migraine attacks than men [
5,
6]. The evident conclusion is that there is a hormonal etiology for these migraines, particularly related to estrogen metabolic pathways [
7,
8]. There is increasing evidence that the late luteal decline in estrogen is not only a trigger for migraine [
9,
10], but potentially also the cause for the increase in pain severity [
11]. In population- and clinic-based studies, between 20% and 60% of women with migraine report an association with menstruation [
12]. This has led to a sub-classification of menstrual migraine (MM), classified in the ICHD-3 appendix for research purposes [
2]. As per the ICHD-3 classification, MM is a sub-classification of MO, as menstruation does not appear to be associated with MA. Women suffering MM have reported symptoms to be more severe, prolonged and resistant to treatment than conventional migraine [
13], and therefore is detrimental to quality of life.
Investigations into the estrogen and progesterone metabolic pathways have been undertaken to understand whether there is an underlying genetic basis for MM. However, there have been many contradictions and conflicting evidence regarding specific gene associations [
14]. For example, estrogen metabolism genes
COMT,
CYP1A1 and
CYP19A1 were found to have no significant association in an Australian cohort [
8,
15], contradictory to earlier studies that found
COMT to be statistically significant in research conducted in an American population [
16].
ESR1 polymorphisms have also been found to have an association with MM [
15], and also with migraine not specifically related to menstruation [
17].
SYNE1 and
TNF genes have been associated with MM, with these findings yet to be replicated in a larger population for further validation [
15].
In 2016, Gormley et al. performed a meta-analysis of 375,000 individuals from 22 genome-wide association (GWA) studies and were able to identify 46 single-nucleotide polymorphisms (SNPs) significantly associated with migraine risk, which implicated 38 genomic loci [
18]. Twenty eight of these loci had not been previously linked to migraine at the time of publication. Subtype analysis was also performed for both MO and MA, which showed that some SNPs were significantly associated with MO. However, no further analysis of other migraine subtypes, including MM, was conducted.
Using a case-control cohort in which the cases were specifically diagnosed with MM, this study aimed to test the hypothesis that SNPs robustly associated with migraine, as determined by Gormley et al. (2016), are also individually or collectively associated with MM.
Methods
Population cohort
A cohort of 268 females affected by MM, as well as 142 controls, were previously recruited by the City of London Migraine Clinic. Details of the demographics for the cohort are presented in Sutherland et al. [
8]. The diagnosis for this classification included documented diary evidence over at least three consecutive menstrual cycles with migraine attacks occurring on day 1 ± 2 in at least two out of three of these cycles and/or at additional times of the cycle. The controls were females who had no personal or familial history of migraine and of a similar age. Biological samples were collected and transported to the Genomic Research Centre, Queensland, Australia. For this particular study DNA samples for 235 MM females and 140 controls were available for genotyping.
Genotyping
AGENACX online MassARRAY® software was used to incorporate 40 of the 46 SNPs identified in the previous meta-analysis [
18] into two multiplex assays. The software was used to design forward, reverse and extension primers for the SNPs to be assayed (sequences available on request).
PCR and extension primers were pooled and balanced according to the MassARRAY protocol (Agena Bioscience, San Diego, CA, USA). Extracted DNA from the MM population samples was diluted to a concentration of 20 ng/μl. Targeted loci were amplified using Taq polymerase, treated with Shrimp alkaline phosphatase (SAP) to dephosphorylate any unincorporated dNTPs, and an extension reaction was performed using iPLEX extension Gold reagents (Agena Bioscience, San Diego, CA, USA) according to the manufacturer’s protocol. Samples were subsequently desalinated with SpectroCLEAN® and the resulting products were spotted onto SpectroCHIPs using a Nanodispenser RS1000. Detection of primer extension products was performed by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. SpectroTYPER software was used to automatically import and analyze the genotyping data with genotypes called based on the calculated mass of the extension products.
Validation of MassARRAY results was undertaken using a number of alternative genotyping methods. For rs12845494 and rs2506142, restriction fragment length polymorphism (RFLP) assays were used. This involved amplification of the targeted loci using a standard PCR protocol followed by digestion with the restriction enzymes PstI (NEB #R0140S) for rs12845494, and BsmAI (NEB #R0529L) for rs2506142. The PCR product for rs12845494 was added to a master mix of PstI enzyme with NEBuffer 3.1 and incubated at 37 °C for 16 h. For rs2056142, the PCR product was added to a master mix of BsmAI with SmartCutter® and incubated for an hour at 55 °C. Products were subsequently run on 4% agarose gels for analysis.
For validation of genotypes for the SNP rs1024905 PCR-pyrosequencing was used. The primers 5’ TTTGGCCTCAGACCCCTTTA (biotinylated) and 5’ CATCAATGGATATAGCCCACATAA were used to amplify an 83 bp biotinylated PCR product and genotyping was performed on a QSeq pyrosequencer (Bio Molecular Systems). The biotinylated strand was immobilised on Steptavidin Mag Sepharose® beads (GE Healthcare) and the sequencing primer 5’TGGATATAGCCCACATAAG annealed prior to pyrosequencing using Pyromark® Gold reagents (QIAGEN). Sequencing traces were analyzed with QSeq software.
Sanger sequencing was used to validate genotype data for a subset of the SNPs (rs1024905, rs4910165, rs2506142), as minor allele frequencies deviated from that reported in databases. This was conducted using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on the 3500 Genetic Analyzer (Applied Biosystems).
Statistical analysis
SNPs with low call rates (< 80%) were excluded from further analysis. Statistical analysis was performed on a final set of 34 SNPs using PLINK V1.07 [
19]. Case-Control association of SNPs to MM were analyzed in PLINK using the
--assoc command.
A genomic risk score (GRS) was determined for each of the individuals included in this study using the --
score command in PLINK V1.07 [
19] and the average score calculated. This score was validated manually and the SNPs were weighted using the log odds ratios (OR) determined in the Gormley meta-analysis [
18]. The significance threshold was set to
p = 0.05, as this is a replication study. However, due to the number of SNPs tested, the Bonferroni correction for multiple testing value (
p = 0.001) was also considered.
Analysis and comparison of genomic risk scores for case/control status was performed with logistic regression analysis and Nagelkerke’s pseudo R
2.
Receiver operating characteristic (ROC) - area under the curve (AUC) was also calculated to investigate the classification (diagnostic) value. These analyses were performed using SPSS v23 (IBM Corp., Armonk, NY).
Discussion
The first GWA study in relation to migraine was conducted in 2010 and identified the first significant GWAS association [
20]. In 2011, three more susceptibility loci were identified in migraine, with further categorization into MA and MO subtypes [
21]. Although this study was performed using female migraineurs from the Women’s Genome Health Study, association testing for the MM subtype was not conducted. A small number of GWA studies have been performed attempting to identify SNPs associated with the MO and MA subtypes [
22], or within an isolated population [
23], but at time of writing, there have been no GWA studies specifically analyzing MM. In this study, we tested the association of previously identified migraine-related SNPs in a specific MM cohort and found evidence for a potential role of rs2506142 in the Neuropilin-1 (
NRP1) gene at 10p11.22 (OMIM: 602069).
NRP1 encodes a transmembrane protein that acts as a receptor for class 3 semaphorins, molecules that act to guide neuronal development via repulsive axon guidance in nervous and vascular systems [
24]. Studies using knock-out mice with null or mutated
Nrp1 showed dysmorphic development of axons and the spinal cord in developing embryos [
25]. Interestingly, in another study, angiogenesis and arteriogenesis were revealed to be compromised in the postnatal heart and retina [
26]. Studies have also found that NRP1 is also expressed in smooth muscle cells and may be involved with contractility and mobility of cells within the gastrointestinal system [
27]. Therefore, NRP1 functions could be related to either the neuronal or vascular aspects of migraine pathophysiology.
The actions of NRP1 are also involved in menstruation. The endometrium undergoes growth, remodeling and shedding of vasculature during the menstrual cycle as a response to the ovarian steroids estrogen and progesterone. An increase in estrogen is seen during the endometrium’s proliferative state, while progesterone is associated with the secretory phase, where maturation and remodeling of the vascular tissue occurs [
28,
29]. Endometrial repair is facilitated by angiogenesis and is initiated following the withdrawal of ovarian hormones. Repair of the endometrial vasculature begins while menstruation is still in progress, meaning the vascular breakdown and repair is occurring concurrently within the endometrium [
28,
29]. The hormones act on these systems via the key regulators, Vascular Endothelial Growth Factors (VEGFs) and their co-receptors from the semophorin family, including NRP1. In particular, estrogen regulates VEGF-A expression, resulting in angiogenesis during the proliferative phase of endometrial remodeling [
28,
30].
Given the involvement of NRP1 in pathways of neurovascular tissue and menstruation, this transmembrane protein could very well play a role in the pathophysiology and etiology of MM. There is limited research regarding the expression of NRP1 specifically during menstruation but an increase in activity has been shown during the proliferative phase of endometrial remodeling [
31], which correlates with the drop in estrogen that is also believed to trigger MM. Further investigation may reveal the correlation between this variant SNP and the associated risk with MM.
GRS analysis was performed to ascertain whether a composite of the 34 SNPs could be used to predict MM in an individual sample. The overall predictive value of MM risk based on these SNPs was low (
p = 0.008). GRS analysis using only the 7 SNPs that were of suggestively significant value (
p < 0.1) yielded a slightly more significant result (
p = 0.0005) with an AUC of 0.61, but would still not be of diagnostic or prognostic value, as an AUC of 0.7 and above is required for a test of good to excellent diagnostic accuracy [
32]. The GRS also did not confer an OR that was greater than any of the SNPs individually investigated. Overall these results provide evidence that while MM and other phenotypes of migraine may have some genetic commonality, including the rs2506142
NRP1 SNP, there may be distinct genetic differences. For example, given the increase in activity of NRP1 during menstruation, it might be that this marker is more predictive of menstrual migraine occurring during menstruation in association with endometrial prostaglandin release rather than estrogen ‘withdrawal’ [
12]. Given that management of MM is currently empirical, a specific marker that could enable more targeted treatment has obvious clinical benefits.
The Gormley et al. meta-analysis did not distinguish sub-classifications other than MA and MO, and included some self-reported migraine by questionnaire, so it is likely that menstrual-migraineurs constituted a proportion of the MO population. Due to the difficulties in gaining a rigorous assessment of migraine in relation to menstruation timing, these group distinctions are lost in large cohort studies. Therefore, some overlap of significant SNPs may be expected between the study by Gormley et al. and our studies. However, a limitation of our study was the small population size, particularly as the effect sizes of migraine susceptibility SNPs identified to date are small [
18], potentially resulting in false-negative results. Furthermore, if a Bonferroni correction for multiple testing is applied, none of the SNPs would be individually significantly associated with MM. Nevertheless, further investigation of rs2506142, as well as the other SNPs, in a larger MM population is warranted. Obtaining a large enough sample size for discovery of MM-specific SNPs is likely to be difficult, as suggested by the lack of MA-specific SNPs found by Gormley et al. [
18]. However, replication-type studies, without the need to correct so stringently for multiple testing, may prove to be informative.
Conclusion
Migraine is the third leading cause of disability for women of reproductive age, with a significant burden on quality of life. While recent GWAS have increased the understanding of the genetic basis of migraine, the etiologies of some of the subtypes, including MM is largely unknown and targeted research is required. Our study suggests that NRP1 may play a particular role in MM, however, replication in a larger MM cohort would be necessary to confirm this. Calculation of a GRS score for the genotyped migraine susceptibility SNPs in the MM cohort indicates some genetic commonality between migraine (MA and MO) and MM, but is not diagnostically useful.
Acknowledgements
The authors would like to acknowledge the participants of this study. We thank the team at the Genomics Research Centre for their support, knowledge and encouragement.